ID: 1018336994

View in Genome Browser
Species Human (GRCh38)
Location 6:162803074-162803096
Sequence TGTGGGGTAAACAACTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018336994_1018337003 4 Left 1018336994 6:162803074-162803096 CCCCCCAAGTTGTTTACCCCACA 0: 1
1: 0
2: 0
3: 5
4: 196
Right 1018337003 6:162803101-162803123 TTGCAAGCTTAATGTGAAGAAGG No data
1018336994_1018337005 28 Left 1018336994 6:162803074-162803096 CCCCCCAAGTTGTTTACCCCACA 0: 1
1: 0
2: 0
3: 5
4: 196
Right 1018337005 6:162803125-162803147 TCAAACCCCACTTCACAGTAGGG No data
1018336994_1018337004 27 Left 1018336994 6:162803074-162803096 CCCCCCAAGTTGTTTACCCCACA 0: 1
1: 0
2: 0
3: 5
4: 196
Right 1018337004 6:162803124-162803146 ATCAAACCCCACTTCACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018336994 Original CRISPR TGTGGGGTAAACAACTTGGG GGG (reversed) Intronic
902266106 1:15266229-15266251 TGTGGCCTTAACTACTTGGGAGG - Intronic
902277842 1:15352277-15352299 TGGGAGGTAAACAGCTAGGGAGG - Intronic
905120107 1:35675211-35675233 GGTGGTGTAAGCTACTTGGGAGG + Intergenic
911674094 1:100639193-100639215 TGTGGTGGAAACTCCTTGGGTGG + Intergenic
914224057 1:145705870-145705892 TGTGGTGTCAGCTACTTGGGAGG - Intronic
915925626 1:160016998-160017020 TGTGGTCTTAACCACTTGGGAGG + Intergenic
916164573 1:161954332-161954354 TGTGGGGTACACAAGTGTGGAGG - Intronic
918940976 1:190996089-190996111 TGTGGGATAAGCAATTTGGATGG + Intergenic
920886433 1:209933172-209933194 TGTGGTATCAATAACTTGGGTGG + Intergenic
1063053572 10:2478743-2478765 TGTGGTACAAACATCTTGGGAGG - Intergenic
1064541148 10:16406415-16406437 TTTGGGGAAGACAATTTGGGTGG - Intergenic
1065281454 10:24143233-24143255 TGAGGGGATAACAACTTGAGTGG - Intronic
1065362223 10:24899237-24899259 TGTGGGAGACACAAATTGGGGGG - Intronic
1067158014 10:43799188-43799210 TGTGTGATGAACAACATGGGGGG + Intergenic
1067719260 10:48714786-48714808 TCTGAGATAGACAACTTGGGAGG + Intronic
1067859849 10:49834716-49834738 TGTGGTGTCACCTACTTGGGAGG + Intronic
1073742657 10:106426256-106426278 TTTGAGGCAAAAAACTTGGGAGG + Intergenic
1073920794 10:108456308-108456330 AGTTGGGGAAACAACTGGGGAGG - Intergenic
1075573326 10:123560673-123560695 TGTGGGGTAAAAGACTGGAGAGG + Intergenic
1076689232 10:132212747-132212769 TCTGCGGTAAACAACGTGGAAGG + Intronic
1076946392 10:133654258-133654280 TGTAATGTAAACAATTTGGGAGG + Intergenic
1078086158 11:8234111-8234133 TGTGGGGGGAACAACATTGGAGG + Intronic
1079695870 11:23481996-23482018 TGTAGGGTCAGCTACTTGGGAGG + Intergenic
1080533478 11:33199144-33199166 TGTGGTTTCAACTACTTGGGAGG - Intergenic
1080666527 11:34341220-34341242 TGAGGAGGAAACAACTTGAGAGG + Intronic
1082040293 11:47679291-47679313 TGTGGTCTCAACTACTTGGGAGG + Intronic
1083240172 11:61382031-61382053 TGTGGGGTTCAGAGCTTGGGCGG - Intergenic
1083453831 11:62764672-62764694 TGTGGTTTCAGCAACTTGGGAGG + Intronic
1085817436 11:79754959-79754981 TGTGTGGAAAACAAATTGTGAGG - Intergenic
1086502668 11:87469512-87469534 TGTGGTCTCAACTACTTGGGAGG + Intergenic
1088861489 11:113804277-113804299 TGTGGTGAATACACCTTGGGTGG + Intronic
1089403838 11:118181273-118181295 TGTAAGGTAAATAACTAGGGAGG - Intergenic
1093053755 12:14534024-14534046 TGTAGTGTCAACTACTTGGGAGG + Intronic
1093462083 12:19416058-19416080 TGTGGTCTCAACTACTTGGGAGG + Intronic
1094203960 12:27820755-27820777 TGTGTGGTAAAAGACATGGGTGG - Intergenic
1095263959 12:40131910-40131932 TGTGAGGTAAATAACTGTGGAGG - Intergenic
1095413815 12:41953536-41953558 TGTGGGATTAACATCTTGGTTGG - Intergenic
1099983675 12:89637517-89637539 TGTGGTCTAAGCTACTTGGGAGG - Intronic
1100181532 12:92091476-92091498 TGTGGTCTCAGCAACTTGGGAGG - Intronic
1100976283 12:100125524-100125546 TGTGGTCTCAACTACTTGGGAGG + Intronic
1101986775 12:109453309-109453331 TGTAGTCTAAACTACTTGGGAGG - Intronic
1103584448 12:121941453-121941475 TGTGGGCCCAACTACTTGGGAGG - Intronic
1106939768 13:34764995-34765017 AGTGGGGAAAACAAGTGGGGAGG + Intergenic
1114068213 14:19084704-19084726 TGTGGGGCCAGCTACTTGGGAGG - Intergenic
1114094050 14:19315321-19315343 TGTGGGGCCAGCTACTTGGGAGG + Intergenic
1117210734 14:53496376-53496398 GGTGGGGAAAACAAATTGGAGGG - Intergenic
1120527807 14:85597750-85597772 TTTGGTTTAAACAACTTGTGAGG + Intronic
1121876144 14:97455398-97455420 TGTGAGGTAGACAACTTGTAAGG + Intergenic
1122003039 14:98679836-98679858 TGTGGTCTCAGCAACTTGGGAGG + Intergenic
1202924435 14_KI270724v1_random:10763-10785 TGTAATGTAAACAATTTGGGAGG - Intergenic
1125735489 15:41922265-41922287 TGTGGGCTCAGCTACTTGGGAGG + Intronic
1128479576 15:68025671-68025693 TCTGGGGGAAACAACTGTGGGGG - Intergenic
1128486068 15:68090322-68090344 TGTGGTCTCAACTACTTGGGAGG - Intronic
1129361126 15:75025037-75025059 TGTGGTCTCAACTACTTGGGAGG - Intronic
1130174206 15:81550663-81550685 TGTAGGGTAAAAAATTGGGGGGG + Intergenic
1130574741 15:85081839-85081861 TTTGGGGTAAAAAAGTTTGGTGG + Intronic
1131143074 15:89993399-89993421 TGTGGGGAGGACAACTTGGAGGG + Intergenic
1131164474 15:90132504-90132526 TGTAGTCTCAACAACTTGGGAGG - Intergenic
1135320197 16:21490533-21490555 TGTGGTCTCAACTACTTGGGAGG - Intergenic
1135373032 16:21922023-21922045 TGTGGTCTCAACTACTTGGGAGG - Intergenic
1135438757 16:22448679-22448701 TGTGGTCTCAACTACTTGGGAGG + Intergenic
1136686652 16:31998810-31998832 TGTGGTCTCAACTACTTGGGGGG + Intergenic
1136787264 16:32942347-32942369 TGTGGTCTCAACTACTTGGGGGG + Intergenic
1136882512 16:33911437-33911459 TGTGGTCTCAACTACTTGGGGGG - Intergenic
1138006662 16:53343615-53343637 TATGGTGTAAGCTACTTGGGAGG - Intergenic
1138112191 16:54332802-54332824 TGTGGGCCAAGCTACTTGGGAGG + Intergenic
1139784545 16:69381600-69381622 TGTGGTGTCAGCTACTTGGGAGG - Intronic
1141200532 16:81894305-81894327 TGTGGTCCCAACAACTTGGGAGG + Intronic
1141739267 16:85879831-85879853 TATGGGGAATACAATTTGGGTGG + Intergenic
1203089498 16_KI270728v1_random:1204019-1204041 TGTGGTCTCAACTACTTGGGGGG + Intergenic
1143910580 17:10245621-10245643 TGTGGTCCAAACTACTTGGGAGG - Intergenic
1144181562 17:12757066-12757088 TGTGTGGGAAACAACATTGGAGG + Intronic
1144821983 17:18081536-18081558 AGTGGTGAGAACAACTTGGGTGG - Intergenic
1147147614 17:38494465-38494487 TGTGGTCTCAACTACTTGGGGGG + Intronic
1147428908 17:40359633-40359655 TGTGGTGTCAGCTACTTGGGGGG + Intergenic
1147833121 17:43311134-43311156 TGTGGTGCCAGCAACTTGGGAGG - Intergenic
1148090166 17:45018730-45018752 TGTGGGGTCAACAGCATGGAGGG - Intergenic
1149960561 17:61105222-61105244 TTTGGGGTAAACCACCTGAGTGG - Intronic
1151082663 17:71346485-71346507 TGTGGAGTGAACAAGTTGTGGGG + Intergenic
1151151039 17:72087020-72087042 GGAGAAGTAAACAACTTGGGTGG - Intergenic
1152335423 17:79697838-79697860 TTTGAGGAAAACGACTTGGGTGG - Intergenic
1153711787 18:7807495-7807517 TGTGGGACACACAACATGGGCGG - Intronic
1155930194 18:31698943-31698965 TGTGGTGTCAGCTACTTGGGAGG + Intergenic
1158308160 18:56129181-56129203 TGTGGGGTATACATCTTCAGTGG - Intergenic
1159506987 18:69351449-69351471 TGTGGGCTCAACTACTCGGGAGG + Intergenic
1161971093 19:7580767-7580789 TGTGGTCTCAGCAACTTGGGAGG + Intergenic
1163896125 19:20061162-20061184 TGTAGTGTCAACTACTTGGGAGG + Intergenic
1164401722 19:27906702-27906724 TGTGGTCTCAACTACTTGGGAGG - Intergenic
1164736140 19:30542931-30542953 TGTGGTCTAAGCTACTTGGGAGG - Intronic
1165359544 19:35327614-35327636 TGTGGTCCAAACTACTTGGGAGG - Intronic
1165822455 19:38685247-38685269 TGTAGGGTACACAATTTGGGTGG - Intronic
928833691 2:35518548-35518570 TTTGGGGTAAAAAATATGGGGGG + Intergenic
929387481 2:41426924-41426946 TATGGGGTAAAGAACTGGAGTGG + Intergenic
929493376 2:42417440-42417462 TGTGGTGCCAGCAACTTGGGAGG - Intronic
930131972 2:47861438-47861460 TGTGGGCTCAGCTACTTGGGAGG - Intronic
930193884 2:48489377-48489399 TGTGGTCTCAACTACTTGGGAGG + Intronic
932144975 2:69308470-69308492 TGTGGGGTGACCAGCTTGCGGGG + Intergenic
932998632 2:76891187-76891209 TGTTGAGCAAACATCTTGGGAGG - Intronic
935413532 2:102790107-102790129 TCTGGGGAAAAGAACTTGCGAGG + Intronic
935746921 2:106196756-106196778 TGTGGGGATTACAATTTGGGTGG - Intergenic
936784556 2:116078388-116078410 TGAGGGTTAAACATCTGGGGAGG + Intergenic
937239476 2:120451011-120451033 TGTGGTCTTAACTACTTGGGAGG + Intergenic
938048673 2:128147094-128147116 TGTGTGGTAAATAATTTGGCTGG - Intronic
938393069 2:130920228-130920250 TGGGGGCTCAGCAACTTGGGAGG - Intronic
938574753 2:132593548-132593570 TGTGTAGTAAAGAACTTGGCTGG - Intronic
938824760 2:134993717-134993739 TGTGGGGTAAAGACTTTTGGTGG + Intronic
939081750 2:137671091-137671113 TGTATCGCAAACAACTTGGGTGG - Intronic
940771306 2:157841903-157841925 TGTAGGGTCAGCTACTTGGGAGG + Intronic
944829603 2:203520208-203520230 TGTGGTCTCAGCAACTTGGGAGG + Intronic
946134790 2:217636797-217636819 TTTGGGGTACACAACATGCGTGG - Intronic
946633415 2:221697218-221697240 TGTAGGGTAAGTTACTTGGGAGG - Intergenic
1169405850 20:5320459-5320481 TGTGGTCTCAACTACTTGGGAGG + Intergenic
1170764520 20:19278771-19278793 TTTGGGGAAAAAAACCTGGGGGG + Intronic
1174289568 20:49498287-49498309 TGTGGGGTAAAGAAGATGGCTGG - Intergenic
1174885636 20:54330644-54330666 TTTGGGGTAAACAAAATGGCTGG + Intergenic
1176723648 21:10412963-10412985 TGTTGGGAAAAAAAATTGGGGGG - Intergenic
1177541624 21:22500369-22500391 TGTGGTCTCAACTACTTGGGAGG - Intergenic
1178746791 21:35259473-35259495 TTTTGGGTGATCAACTTGGGAGG + Intronic
1180486686 22:15807267-15807289 TGTGGGGCCAGCTACTTGGGAGG - Intergenic
1181669580 22:24419917-24419939 TATGGGGTGAACATCTTGAGTGG + Intronic
952340233 3:32439573-32439595 TGTGGTCTCAGCAACTTGGGAGG - Intronic
952854466 3:37757527-37757549 TGTGGCATAAACTACTTGGGAGG + Intronic
953087336 3:39682854-39682876 TGTGGGGTTAGCACCATGGGAGG + Intergenic
954197470 3:49005192-49005214 CATTGGGTAAACAACTTGTGGGG - Intronic
955910803 3:63858126-63858148 TGTGTGGTCACCAACTAGGGTGG - Intronic
957081087 3:75636203-75636225 TGTAATGTAAACAATTTGGGAGG - Intergenic
963622103 3:147623654-147623676 TGTGGGGAAGACAAATTGGAGGG + Intergenic
964812547 3:160681603-160681625 TGTAGTGTCAACTACTTGGGAGG - Intergenic
965707297 3:171521910-171521932 TGTAGTCCAAACAACTTGGGAGG - Intergenic
966388830 3:179430205-179430227 TGTGGGCTCAGCTACTTGGGAGG - Intronic
967668245 3:192200534-192200556 TATGGGGGAAACAATGTGGGAGG - Intronic
967788201 3:193520044-193520066 TGCTGGGTAAACAACGTGGGAGG - Intronic
968174109 3:196534206-196534228 TGTGGTATCAACTACTTGGGAGG + Intergenic
970294729 4:14616666-14616688 TGTGGTCTCAACTACTTGGGAGG + Intergenic
970401070 4:15718542-15718564 TGTAGGGTGAACAAATTGGCAGG + Intronic
972859196 4:43146472-43146494 TGTTGGGTAAGCAACGTTGGGGG + Intergenic
975776880 4:77796959-77796981 TGTGGTCTTAACTACTTGGGAGG + Intronic
976738781 4:88337143-88337165 TGTGGGCCCAACTACTTGGGAGG - Intergenic
982111923 4:152064785-152064807 TGGGGGAGAAGCAACTTGGGGGG - Intergenic
985081684 4:186271709-186271731 TGAAGAGTAAACATCTTGGGTGG - Exonic
985449805 4:190054911-190054933 TGTAATGTAAACAATTTGGGAGG + Intergenic
987101582 5:14595941-14595963 TTTGGGCTGAACCACTTGGGTGG - Intronic
990648897 5:57876603-57876625 TGTGGTCTCAACTACTTGGGAGG - Intergenic
991499884 5:67266708-67266730 TGTGGTTTCAACTACTTGGGAGG + Intergenic
992453498 5:76894548-76894570 TCTGTGGTAAACACCTTGGTGGG - Intronic
995054976 5:107748940-107748962 TGTGACATAAACAACTTGGAAGG - Intergenic
995203239 5:109449656-109449678 TGTGGTCTCAGCAACTTGGGAGG - Intergenic
997298944 5:132788291-132788313 TATGGGGTAAGCAAGTTGGAGGG - Intronic
997307651 5:132851290-132851312 TGTGGTCCCAACAACTTGGGAGG - Intergenic
1000298965 5:159937923-159937945 TGGGGGGTTAACAACTTCAGAGG - Intronic
1000330083 5:160199218-160199240 AGTGGGGAGAACACCTTGGGTGG + Intronic
1001323386 5:170701137-170701159 TGTGGGGTAGGGAAGTTGGGAGG - Intronic
1006654487 6:35578644-35578666 TGTGGTCTAAGCTACTTGGGAGG + Intronic
1007419285 6:41709906-41709928 TGTGGTCTCAACTACTTGGGAGG - Intronic
1010677794 6:78764233-78764255 TGTGCTGTAAACACTTTGGGAGG - Intergenic
1011035490 6:82969484-82969506 TGTGGGCTCAGCTACTTGGGAGG + Intronic
1014929603 6:127319553-127319575 TGTGGGCTTAATAACTTTGGAGG - Intronic
1018336994 6:162803074-162803096 TGTGGGGTAAACAACTTGGGGGG - Intronic
1020065202 7:5183059-5183081 TGTGGGATAAACAGCTGGTGTGG - Intergenic
1022456204 7:30560382-30560404 TGTGGTCTCAGCAACTTGGGAGG - Intergenic
1022706233 7:32804606-32804628 TGTGGTCTCAGCAACTTGGGAGG - Intergenic
1023887704 7:44373132-44373154 TGTGCGGAAGATAACTTGGGTGG + Intergenic
1024701300 7:51906920-51906942 TGTGGGTTGACCAACTTGAGAGG + Intergenic
1025258666 7:57402687-57402709 TGTTGGGTATAAAAATTGGGGGG - Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1028616937 7:92779167-92779189 TCTGAGGAAAGCAACTTGGGTGG - Intronic
1029693024 7:102195334-102195356 CGTGTGTTAAACGACTTGGGGGG + Intronic
1030454151 7:109751649-109751671 TTTGGGGAGAACAAGTTGGGCGG + Intergenic
1031251240 7:119384400-119384422 TGTGTGGTAATTAATTTGGGAGG + Intergenic
1034502933 7:151462722-151462744 TGTTGGGTATAAAAGTTGGGGGG - Intergenic
1037553103 8:19993902-19993924 TGTGGTCTCAGCAACTTGGGGGG + Intergenic
1037882767 8:22580932-22580954 TGTGGGGATAGCAACTGGGGAGG - Intronic
1049800937 8:144517308-144517330 CGTGGGGCACAGAACTTGGGAGG - Intronic
1050581984 9:7068113-7068135 TATGGAGAAAATAACTTGGGAGG + Intronic
1054849157 9:69828559-69828581 TGTGGTCTAAGCTACTTGGGAGG + Intronic
1055891705 9:81130844-81130866 TGTGGTCTCAACTACTTGGGAGG + Intergenic
1060745650 9:126129184-126129206 TGTGGGGTAGAGAACTGGGCAGG - Intergenic
1060846847 9:126844215-126844237 TGTGGGCTAGATAACTTAGGAGG + Intergenic
1060873083 9:127058376-127058398 TGTGTGGAAAACAAACTGGGTGG + Intronic
1061773345 9:132944555-132944577 TGTGAGGTAAACAGCTGAGGGGG - Exonic
1062417650 9:136460789-136460811 TGTGGTCTCAACTACTTGGGAGG + Intronic
1188069060 X:25696355-25696377 TGTGGGTTAAACAGATTGTGGGG - Intergenic
1189004562 X:36982498-36982520 TGTGGTGTCACCTACTTGGGAGG + Intergenic
1189044411 X:37575045-37575067 TGTGGTGTCACCTACTTGGGAGG - Intronic
1189602061 X:42637666-42637688 TGTGGGGTAGACAACTGGAATGG - Intergenic
1190071356 X:47282382-47282404 TGTGGTCTTAGCAACTTGGGAGG - Intergenic
1190744010 X:53310260-53310282 TGTGGTCCAAGCAACTTGGGAGG + Intronic
1192582524 X:72296757-72296779 TGTGGTGCCAACTACTTGGGAGG - Intronic
1192639401 X:72847814-72847836 GGGGGGATAAACAACTGGGGAGG + Intronic
1192642310 X:72872991-72873013 GGGGGGATAAACAACTGGGGAGG - Intronic
1195322942 X:103735455-103735477 TTTGGGGTAAAGAAATGGGGAGG - Intergenic
1196421534 X:115527127-115527149 TGTGGTGTCAGCTACTTGGGAGG - Intergenic
1197232318 X:124018431-124018453 TGTGGGGGAAACACATTGGATGG + Intronic
1198162950 X:134025679-134025701 TGTGGTCTCAACTACTTGGGAGG + Intergenic
1199270472 X:145877006-145877028 TGTGTGACAAACAACTTGGGCGG - Intergenic
1199408625 X:147493289-147493311 TTTGGAGGAAACACCTTGGGAGG + Intergenic
1199798565 X:151227302-151227324 TGGGTGGTAAAAAAGTTGGGTGG + Intergenic
1200988320 Y:9326204-9326226 GGTGGGGGAAACAACGTGGTAGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201856273 Y:18547585-18547607 TGAGGGCTTAACAACTTGAGTGG + Intronic
1201877048 Y:18772799-18772821 TGAGGGCTTAACAACTTGAGTGG - Intronic
1201920247 Y:19226255-19226277 TGTGGTCTCAACTACTTGGGAGG - Intergenic