ID: 1018337150

View in Genome Browser
Species Human (GRCh38)
Location 6:162805172-162805194
Sequence CTATATATAAAGGGCGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018337147_1018337150 13 Left 1018337147 6:162805136-162805158 CCGTTGTTTACTGAAACATTGTT 0: 1
1: 17
2: 34
3: 170
4: 998
Right 1018337150 6:162805172-162805194 CTATATATAAAGGGCGACCTTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018337150 Original CRISPR CTATATATAAAGGGCGACCT TGG Intronic
904027919 1:27516296-27516318 CTATATCTAAGGGGAGAACTGGG + Intergenic
915414470 1:155730027-155730049 ATATATATATATGGCGATCTCGG - Intronic
917469358 1:175313548-175313570 CTGTTTTTAAAGGGCCACCTTGG + Intergenic
921764357 1:218952899-218952921 CCATATGTATAGTGCGACCTAGG - Intergenic
922721065 1:227900560-227900582 CTATGTCTACAGGGGGACCTGGG + Intergenic
1063844414 10:10110100-10110122 CTATAAATAAAGAGAGACATTGG + Intergenic
1070180959 10:74013511-74013533 CTATATCTAAAGTGTGACTTTGG - Intronic
1070577251 10:77688377-77688399 CTACATCTAAAAGGCAACCTAGG - Intergenic
1078031690 11:7758665-7758687 ATATATATATATGGAGACCTAGG - Intergenic
1081819699 11:45980169-45980191 TTATATATAAAGGGCAACTGAGG + Intronic
1088549396 11:110995982-110996004 CTATTTTTAGAGGGTGACCTTGG - Intergenic
1093436410 12:19139877-19139899 CTATATATAAAGAAAGACTTGGG + Intronic
1111963069 13:94832999-94833021 CTTTATGTAAAGGGAGAACTTGG + Intergenic
1114259348 14:21025777-21025799 CTATAAATAGAGGGCGATCGCGG + Intronic
1115033616 14:28830089-28830111 ATATATATTAAGGCAGACCTGGG - Intergenic
1142712630 17:1731611-1731633 ATATATATAAAGGCCGAGCGTGG + Intronic
1147004377 17:37390326-37390348 ATATATATAAAAGGCCAGCTGGG + Intronic
1147500287 17:40956558-40956580 ATATATATCAAGGTCCACCTGGG + Intergenic
1156967535 18:43113324-43113346 TTATATATAAATGGCAACCTTGG - Intronic
1168122907 19:54264146-54264168 GTAAATATAAAGGATGACCTCGG - Intronic
928303389 2:30146854-30146876 CTAGAAATAAAGGGCGTTCTGGG + Intergenic
929849561 2:45571912-45571934 CTACATATAATGGGAGACCCAGG + Intronic
941865110 2:170326388-170326410 CTATATGTGAAGGACCACCTAGG + Intronic
947303265 2:228714046-228714068 CTAAAAATAAAGAGGGACCTTGG - Intergenic
1170324384 20:15140130-15140152 CTATGTATAGAGGACGACATGGG - Intronic
959040166 3:101413271-101413293 CTATATATAATAGGAGACTTAGG - Intronic
972319514 4:37960371-37960393 CTAAATATAAAGTGGGACCACGG + Intronic
973940248 4:55901472-55901494 ATATATATAAAAGAAGACCTGGG + Intronic
982284679 4:153722999-153723021 ATATATATAAAAGGAGATCTAGG + Intronic
983858917 4:172679896-172679918 CTATATATGAAGGGAAACCTTGG - Intronic
984611367 4:181843398-181843420 GTATATATCAGGGGCTACCTTGG - Intergenic
991287744 5:64997981-64998003 CTATTTATAAAGGACCACGTTGG - Intronic
994871726 5:105360227-105360249 CTATATATAAAGAGAGACAGTGG + Intergenic
994904300 5:105816959-105816981 CAAGATATAAAGGGAGAACTAGG + Intergenic
998725679 5:145010858-145010880 ATATATATAAATGACAACCTAGG - Intergenic
999689360 5:154133437-154133459 CTATATATAAAGAGACATCTGGG + Intronic
1006272007 6:32972164-32972186 CTATATATAAAGGGCTGGCGCGG + Exonic
1008603510 6:53118151-53118173 ATATATATAAAGGGCTAGCCTGG - Intergenic
1013730051 6:113154696-113154718 CTGTATAAAAAGGACGGCCTTGG - Intergenic
1015335265 6:132029750-132029772 CTATATATAGAATGGGACCTAGG - Intergenic
1018337150 6:162805172-162805194 CTATATATAAAGGGCGACCTTGG + Intronic
1022950312 7:35332242-35332264 CTATCTGTAAATGGCGACCATGG - Intergenic
1023334382 7:39152889-39152911 CTATATATAAAGGCAGCACTAGG - Intronic
1034025506 7:147699152-147699174 ATATATATAAAGGGTTATCTAGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035252771 7:157607947-157607969 CCATCTTTAAAGGGTGACCTCGG - Intronic
1055987455 9:82065689-82065711 CCATATATAAAGAGTGACGTTGG + Intergenic
1187594367 X:20755475-20755497 CCAGATAGAAAGGGCCACCTGGG - Intergenic
1188349114 X:29105136-29105158 CTCTATATAAAGGAAGACATTGG + Intronic
1192427378 X:71089231-71089253 TAAAATATAAAGGGCAACCTGGG + Intergenic
1193148323 X:78100443-78100465 TTATATATAAAAGGGGATCTGGG + Intronic
1199407469 X:147479347-147479369 CCATTTACAAAGGGAGACCTAGG - Intergenic