ID: 1018338201

View in Genome Browser
Species Human (GRCh38)
Location 6:162818905-162818927
Sequence ATTTTGTTGCATGCATAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 1, 2: 8, 3: 61, 4: 492}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018338201_1018338204 2 Left 1018338201 6:162818905-162818927 CCCTTTTATGCATGCAACAAAAT 0: 1
1: 1
2: 8
3: 61
4: 492
Right 1018338204 6:162818930-162818952 CAAACCTCTCAAATTTGAAAGGG No data
1018338201_1018338206 17 Left 1018338201 6:162818905-162818927 CCCTTTTATGCATGCAACAAAAT 0: 1
1: 1
2: 8
3: 61
4: 492
Right 1018338206 6:162818945-162818967 TGAAAGGGAGAAACTCAAAATGG No data
1018338201_1018338203 1 Left 1018338201 6:162818905-162818927 CCCTTTTATGCATGCAACAAAAT 0: 1
1: 1
2: 8
3: 61
4: 492
Right 1018338203 6:162818929-162818951 ACAAACCTCTCAAATTTGAAAGG 0: 1
1: 0
2: 3
3: 24
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018338201 Original CRISPR ATTTTGTTGCATGCATAAAA GGG (reversed) Intronic
900074598 1:802906-802928 GTCTTGTTGGAGGCATAAAATGG - Intergenic
900883625 1:5400426-5400448 ATTCTGTTTCATGCATAGATGGG - Intergenic
902772311 1:18652287-18652309 ATTTTGCTGCAGGAATAAAATGG - Intronic
903103193 1:21052163-21052185 AATTTATTGCCTGCAAAAAACGG - Intronic
903864034 1:26385039-26385061 ATTGTATTGCATACATATAATGG - Intergenic
905318382 1:37097839-37097861 ATTCTGTTGCATGTACAAATGGG - Intergenic
906618373 1:47251990-47252012 CTTTTGTTGCTTGTATAGAATGG - Intronic
906924513 1:50100627-50100649 ATTAGGATTCATGCATAAAAAGG + Intronic
908330612 1:63067371-63067393 ATGTTGGTACATCCATAAAATGG + Intergenic
908379715 1:63584932-63584954 ATTTTTGTGACTGCATAAAATGG + Intronic
908474506 1:64474299-64474321 AACTTGTTGCATGAATAAATAGG - Intronic
909964178 1:81887058-81887080 ATTTTGTTGTATGTTTAATATGG + Intronic
911528599 1:99016241-99016263 ATATTGTTGAATACATATAATGG - Intergenic
911606396 1:99910128-99910150 GTTTTGTTGCATGGATATATTGG + Intronic
912001653 1:104843106-104843128 ATATTGTTGCAGGCATCAAAAGG + Intergenic
912223977 1:107710281-107710303 ATTATGTAGTATACATAAAATGG + Intronic
915710771 1:157896161-157896183 ATGTTGTTACATGCATCAATAGG + Intronic
916236388 1:162592962-162592984 ATCTTGTTGCATGCTGGAAATGG + Intronic
916627850 1:166578580-166578602 ATTCTGTTTCATTCCTAAAATGG - Intergenic
917036897 1:170757925-170757947 ATGTTGTAGAAAGCATAAAATGG - Intergenic
917159512 1:172041740-172041762 ATTTGATTGCAGTCATAAAATGG - Intronic
917188233 1:172386384-172386406 ATTTTGTTGCAGGATGAAAATGG - Intronic
917880951 1:179335263-179335285 ATTTTGTTTTATGCTTACAAGGG + Intronic
917909307 1:179625555-179625577 TTTTTGGTGCAAGTATAAAATGG + Intronic
918002862 1:180514128-180514150 ATTTTATTAAATGCAAAAAAAGG + Intergenic
918024169 1:180726631-180726653 ATTTTCTTACATGTATAAAGTGG + Intronic
918030691 1:180806164-180806186 ATTTTCTTGCATGTATAAAATGG - Exonic
918288472 1:183082098-183082120 ATTGTGGTACATGCATACAATGG - Intronic
918699902 1:187595862-187595884 AATATGATGCATGAATAAAATGG - Intergenic
919138182 1:193536788-193536810 ATTGTATTGCATGCATATAATGG + Intergenic
919195854 1:194284869-194284891 ATTTTCTTCCATGCTTAATATGG + Intergenic
919197616 1:194309074-194309096 CTTTTTCTGTATGCATAAAATGG - Intergenic
919215699 1:194550555-194550577 ATTTTCTCTCATCCATAAAATGG - Intergenic
919234511 1:194822949-194822971 ATTTTGATACAGGCATACAATGG + Intergenic
919444419 1:197684243-197684265 ATTTTTTTTCACACATAAAAGGG - Intronic
920026078 1:202998106-202998128 AATGTGGTGCATACATAAAATGG + Intergenic
920662504 1:207928228-207928250 ATTATGTTGTATCCATATAATGG - Intergenic
921797010 1:219357816-219357838 ATTTTGGTACATGCATACAATGG + Intergenic
921877502 1:220215073-220215095 ATTATAGTGCATCCATAAAATGG - Intronic
922145965 1:222944841-222944863 AATTTGTTACATGCATACAGTGG - Intronic
922270445 1:224027812-224027834 GTCTTGTTGGAGGCATAAAATGG - Intergenic
924939006 1:248797446-248797468 ACTGTGTTGCATCCATACAATGG - Intergenic
1064317068 10:14268032-14268054 ATTGTGTTGCAGGCATCAAATGG + Intronic
1064607956 10:17063791-17063813 AATTTGGTGCATGAATAAACTGG - Intronic
1064736395 10:18385841-18385863 ATTATGTTGCATCCATATGATGG - Intronic
1066423902 10:35287369-35287391 ATTTTACTGTATGCTTAAAATGG - Intronic
1066611702 10:37255365-37255387 ATTTTGTTACATGGATATATTGG - Intronic
1067191228 10:44069807-44069829 AGTGTGGTGCATGCATACAATGG + Intergenic
1067933339 10:50585801-50585823 ATTGTATTTCAGGCATAAAATGG - Intronic
1068095874 10:52490337-52490359 ATTTTTTTTCATCTATAAAATGG + Intergenic
1068326692 10:55498770-55498792 ATTATGTAGCATGCATAGCAAGG - Intronic
1068448723 10:57158946-57158968 ATTTTGTTACATTTATATAATGG - Intergenic
1068871004 10:61944702-61944724 ATTCTGTTGTATGCCTCAAAGGG - Intronic
1069765105 10:70850670-70850692 ATTTTGGCACATCCATAAAATGG + Intronic
1070254439 10:74802042-74802064 ATTTTGTCACATGCATGGAATGG - Intergenic
1071753549 10:88509580-88509602 ATTTTGTGGCATTTTTAAAAAGG - Intronic
1072778999 10:98231016-98231038 TTTTTGTTGAATGTATTAAAGGG - Intronic
1073533027 10:104250333-104250355 ATTGTGTTGTATTCATATAATGG - Intronic
1073789305 10:106923365-106923387 ATTTTGGTACATCCATACAATGG - Intronic
1073796653 10:106995807-106995829 ATTTTCATACAGGCATAAAAAGG + Intronic
1074970869 10:118536165-118536187 AGTATTATGCATGCATAAAAAGG - Intergenic
1075264887 10:120991617-120991639 ATTTTGATGCATGGAAAAAAAGG + Intergenic
1075309728 10:121403900-121403922 ATTCTGGTGCATCCATAGAAGGG + Intergenic
1076593080 10:131603440-131603462 AATTTGTGGCATTAATAAAAAGG - Intergenic
1078241200 11:9532104-9532126 ATTTTATTACATACACAAAATGG - Intergenic
1078811319 11:14768573-14768595 ATTTTGATGTATTCATACAATGG - Intronic
1078881757 11:15457520-15457542 TTTTTCTTGCAGCCATAAAAAGG + Intergenic
1078888492 11:15530316-15530338 ATCTTGATACATGCATAAAATGG - Intergenic
1079401258 11:20108042-20108064 AGTTTGTTGCAAGGATGAAATGG + Intronic
1080935548 11:36858983-36859005 ATTTTGTTACATGCATAGATTGG - Intergenic
1081092645 11:38891956-38891978 ATTTTGTAGCATGTAGAATAAGG + Intergenic
1081230737 11:40582878-40582900 GTTTTGATACATGCATACAATGG + Intronic
1081404203 11:42677459-42677481 ATTTTGTTGAATTTAAAAAACGG - Intergenic
1081555251 11:44154052-44154074 ATTTTGATACAGGCATACAATGG + Intronic
1082705228 11:56486702-56486724 ATATTATTGCATTCATAACATGG - Intergenic
1082898580 11:58220183-58220205 ATTTTGCTGGATTCATATAATGG + Intergenic
1083001434 11:59295384-59295406 ATTTTGTTGCCTAGATTAAAGGG - Intergenic
1085102526 11:73813702-73813724 ATTTTGTTTCATGCTTAAAAAGG + Intronic
1085977754 11:81680232-81680254 GTTTTGTTACATGGATATAATGG - Intergenic
1086191991 11:84090701-84090723 ATTTGGTAACATGCATCAAAAGG + Intronic
1086618909 11:88861139-88861161 ATTTCTTTGCATGCCTAAAGTGG - Intronic
1087047785 11:93857827-93857849 TATTTGTTGAATGAATAAAATGG - Intergenic
1087597845 11:100276170-100276192 GTTTTTTGGCATGCAGAAAAGGG - Intronic
1088773630 11:113060547-113060569 ATTTTTATGCATTCATAGAAGGG - Intronic
1089676883 11:120096272-120096294 ATTTTTGAACATGCATAAAATGG - Intergenic
1089988453 11:122835591-122835613 TTTTTGTTGCATTTACAAAAGGG - Intergenic
1090030440 11:123201639-123201661 ATTTTGTTGCATTAATTAAGGGG - Intergenic
1091474208 12:755274-755296 ATTTTTATGCATGCATAATGTGG - Intronic
1092136475 12:6151748-6151770 ATCTTCTTTCATGCATATAATGG + Intergenic
1092184980 12:6471947-6471969 ACTCTTGTGCATGCATAAAAAGG + Intergenic
1092636866 12:10460865-10460887 ATTATGTTGCCTGCAAAAAGAGG + Intergenic
1092972425 12:13710049-13710071 ATTCTGTTATATTCATAAAATGG + Intronic
1093088530 12:14893795-14893817 ATTTTGTTGAGAGGATAAAAGGG + Intronic
1093120808 12:15268771-15268793 ATTTTATTAAATACATAAAATGG + Intronic
1093285024 12:17248381-17248403 ATTTTATTGATTGAATAAAATGG + Intergenic
1093290201 12:17310284-17310306 ATTTTGATACAAGCATACAATGG + Intergenic
1093487704 12:19669762-19669784 AATTTGATACATGCATACAATGG + Intronic
1093644600 12:21570542-21570564 AATTGGTTGGATGAATAAAATGG + Intronic
1094240589 12:28218793-28218815 ATATTGTTGCATATATAAATAGG + Intronic
1094679643 12:32656948-32656970 ATTTTGTTAGATGGATAAAGTGG - Intergenic
1094762426 12:33550124-33550146 ATGTTGGTGCATCCATACAATGG - Intergenic
1097718756 12:62997779-62997801 ATTATGTTGCATCCGTATAACGG - Intergenic
1097923631 12:65104366-65104388 ATTCTGTTGCATGCATATGAAGG - Intronic
1098628050 12:72697460-72697482 ATGTTGGTGCAAGCAGAAAAAGG + Intergenic
1098717901 12:73855347-73855369 ATTTTGTTACATGTGTAAATTGG + Intergenic
1099376963 12:81903888-81903910 GTTGTGTTGGATGCATAAAAGGG - Intergenic
1099597563 12:84686833-84686855 ATTTTGTTTTATGTTTAAAAAGG + Intergenic
1100104668 12:91155516-91155538 ATTTTGGAGCATGCATTAAGAGG + Intronic
1100330351 12:93575698-93575720 ATTTGGTTAATTGCATAAAATGG - Exonic
1100656730 12:96654536-96654558 AATTTGTTATATGCATACAATGG + Intronic
1101144559 12:101829110-101829132 ATTTTGTTGCAGTCCTGAAATGG - Intronic
1101452723 12:104795011-104795033 ATTATGGTGCATCCATACAATGG - Intergenic
1103261382 12:119592241-119592263 ATTTTGATGGATTAATAAAATGG - Intergenic
1103732006 12:123033920-123033942 ATTTTGTTGCATGCACAGATTGG - Intronic
1104546909 12:129721350-129721372 ATTTTATGGGATGCAAAAAAGGG + Intronic
1104613581 12:130250272-130250294 TATTTGTTGAATGCATTAAATGG - Intergenic
1105288923 13:19033564-19033586 ATTATGGTGTATCCATAAAATGG - Intergenic
1105778422 13:23683967-23683989 ATTTTCTTGCCTACATAAAAGGG + Intergenic
1105804413 13:23943857-23943879 TTTCAGTTGCATCCATAAAATGG - Intergenic
1106014581 13:25856488-25856510 ATTTTGTTACATGAATATATGGG - Intronic
1106317487 13:28607571-28607593 AGTTTGTTGAATGAATGAAATGG + Intergenic
1106523571 13:30519967-30519989 ACTCTTTTGCATACATAAAAAGG + Intronic
1107575727 13:41719762-41719784 ATTTTATCACATGCATAATAAGG - Intronic
1108101334 13:46959708-46959730 ATTTTGTTCTCTACATAAAAGGG + Intergenic
1108227122 13:48301384-48301406 ATTTTCCTGCAGCCATAAAAAGG - Intergenic
1108306038 13:49134383-49134405 ATATTATTGCAGCCATAAAAAGG - Intronic
1108865339 13:54916973-54916995 ATTTTGATACATGCATACAATGG + Intergenic
1108980776 13:56510399-56510421 ACTTTCTTTCATCCATAAAAAGG + Intergenic
1109212945 13:59555837-59555859 GTTTTGATACATGTATAAAATGG - Intergenic
1109257861 13:60105402-60105424 ATTTTGTAGCACCAATAAAATGG - Intronic
1109566643 13:64125662-64125684 ATTGTGTTTCATACATAATACGG + Intergenic
1109665252 13:65526591-65526613 ATTATATTGCATTCATACAATGG - Intergenic
1109694672 13:65938401-65938423 ATTCTGTTGCAAGCATTTAAGGG - Intergenic
1110002895 13:70228368-70228390 ATTTTTCTTCATGTATAAAATGG + Intergenic
1110034518 13:70665078-70665100 ATTTTTTTTCATCCATAAAATGG - Intergenic
1110344847 13:74434119-74434141 ATTTTGTTGCATAGAAAAGAGGG + Intergenic
1110933485 13:81252975-81252997 AGTATTTTGCATGCATAAAATGG + Intergenic
1111314511 13:86535450-86535472 ATTTTGGTGTATACATACAACGG - Intergenic
1111595758 13:90407870-90407892 ATTTTGTTATAGGCATAAAATGG + Intergenic
1111801828 13:92990457-92990479 ATTATGTTGCATTCCTACAATGG + Intergenic
1111928722 13:94491374-94491396 ATATTGTTGTCTTCATAAAAGGG - Intergenic
1112786675 13:102958768-102958790 GTTTTTTTTCATGTATAAAATGG + Intergenic
1112875350 13:104031456-104031478 CTTTTGTTATATGCATAATATGG - Intergenic
1114744259 14:25130842-25130864 ATTTTCTTCCATTCTTAAAAAGG + Intergenic
1114839174 14:26243048-26243070 TTTTTGTTATATGAATAAAATGG + Intergenic
1115830894 14:37339587-37339609 ATTGTGGTATATGCATAAAATGG + Intronic
1116321334 14:43468126-43468148 ATTTTGTTGGGGGCATAAAGAGG - Intergenic
1116600967 14:46922080-46922102 TTTTTTTAGCATGGATAAAAAGG + Intronic
1116612584 14:47095466-47095488 ATTTATTGGCCTGCATAAAAAGG - Intronic
1117085940 14:52201361-52201383 ATATTTGTGCATACATAAAAGGG - Intergenic
1117101848 14:52356517-52356539 ATTGTGGTGCATTCATATAATGG + Intergenic
1117198105 14:53361584-53361606 ATTTTGTTATATGCATAGATCGG + Intergenic
1118372349 14:65148092-65148114 ATTTTGTTATATGCATATAATGG - Intergenic
1118398684 14:65359690-65359712 AATGTGTTCCATGCATACAATGG - Intergenic
1118547429 14:66907209-66907231 ATTATGCTGCATCCATACAATGG + Intronic
1118548730 14:66925187-66925209 ATTTTGATACAGGCATACAATGG + Intronic
1119069395 14:71567367-71567389 ATTCTGGTGTATGCAAAAAATGG + Intronic
1119585175 14:75827176-75827198 ATTTTGTTTCTTTCAAAAAAAGG - Intronic
1120672275 14:87376289-87376311 TTTTTGTTGGATGAATAAATGGG + Intergenic
1120679738 14:87466158-87466180 AGATTGTTCCATTCATAAAAGGG - Intergenic
1120782539 14:88498487-88498509 ATTTTGTTGAATGAATAAATGGG - Intronic
1121158081 14:91705912-91705934 ATTTTCATGCATTAATAAAAGGG + Intronic
1121876081 14:97454790-97454812 GTTTTATTGAATGAATAAAATGG + Intergenic
1122376326 14:101261922-101261944 ATTTTATTACAGGCATATAATGG - Intergenic
1122684520 14:103494577-103494599 ATTTTATTACATGTATATAATGG + Intronic
1124105853 15:26737190-26737212 ATTCTGGTGCATGCTTCAAAAGG + Intronic
1124339829 15:28883753-28883775 ATTTTGTTGCATACTTAGAAAGG + Intergenic
1124440683 15:29683955-29683977 ATTTTGTGGCATGTTTAGAAAGG + Intergenic
1124798913 15:32810328-32810350 ATTTTGTTGCAAACAAAAGATGG - Intronic
1124858404 15:33413051-33413073 ATATTATTTCATGGATAAAATGG + Intronic
1126358904 15:47825123-47825145 ATTGTGTTACATGTATATAATGG - Intergenic
1126526029 15:49655183-49655205 ATGTGGTTGCATGCAGATAATGG - Exonic
1126579333 15:50228766-50228788 ATCTTGTTTGAGGCATAAAAGGG - Intronic
1126804790 15:52336909-52336931 ATTTTGATGAATGCACAAAAAGG + Intronic
1127033077 15:54885502-54885524 ATTTTGATACAGGCATATAATGG + Intergenic
1127561094 15:60136822-60136844 GTTTTGTTTAATGCATAAAAGGG + Intergenic
1128540516 15:68526128-68526150 ATTGTGGTACATGCATATAATGG - Intergenic
1129781602 15:78275849-78275871 ACTTTGTCCCTTGCATAAAATGG + Intronic
1130214563 15:81955886-81955908 ATTTTGTTGTGTGCATAACTTGG + Intergenic
1130787049 15:87110625-87110647 ATCTTGTTACATGCATAGAATGG - Intergenic
1130934956 15:88461104-88461126 ATTTTGTTTCTTGCTTAGAAAGG - Intronic
1131633529 15:94205726-94205748 ATTTTCTTGGAGGCTTAAAATGG - Intergenic
1132039725 15:98515032-98515054 ATATTGTTAAATGCCTAAAAGGG + Intergenic
1133006673 16:2885677-2885699 AATGTGGTGCATGTATAAAATGG - Intronic
1133179026 16:4038568-4038590 ATTTTGTTGCAGCAGTAAAACGG + Intronic
1133638583 16:7695183-7695205 ATTATGTTGCATGCTTCATAAGG + Intronic
1133694416 16:8247948-8247970 ATGTTGGTGCATGTATAACATGG + Intergenic
1133832486 16:9336459-9336481 ATTTGTTGGCATGCAAAAAATGG - Intergenic
1133883982 16:9808952-9808974 ATTCTGATGCATGCATATCATGG + Intronic
1134008881 16:10836540-10836562 ATTTTGAATCATGCAAAAAATGG + Intergenic
1136964989 16:34897511-34897533 ATTTTAATGGATTCATAAAATGG - Intergenic
1137311890 16:47270685-47270707 ATTGTGATGCATCCATACAATGG + Intronic
1138108953 16:54308063-54308085 ATTTTGTTGCATGGCTACCATGG + Intergenic
1138873545 16:60922178-60922200 ATTTTTTCACATCCATAAAATGG - Intergenic
1138974696 16:62189837-62189859 AATTTGTTGAATGCATGAACTGG - Intergenic
1140431344 16:74906649-74906671 ACTGTGTTGCATTCATACAATGG + Intronic
1140575216 16:76159828-76159850 ATTTTATTTCCTGCAAAAAAAGG + Intergenic
1140589402 16:76333643-76333665 AATATGATGCATGCAAAAAAAGG - Intronic
1140677482 16:77347150-77347172 ATTTTGCTGTATTCATACAATGG - Intronic
1141326498 16:83064775-83064797 GTTTTGATACATGTATAAAATGG + Intronic
1141399701 16:83736762-83736784 ATCTTATTGCAGGCACAAAAAGG + Intronic
1142533180 17:596217-596239 ACTTTTGTGCATACATAAAAAGG - Intronic
1148008781 17:44457631-44457653 ATTTTGTTAATTGCATGAAAAGG + Intronic
1149854671 17:60070502-60070524 ATTTTGATGCATTTATTAAATGG + Intronic
1150829289 17:68504895-68504917 ATTTTGATACAGGCATACAATGG - Intergenic
1150934514 17:69620700-69620722 ATTTTGTTATATGCATAGAATGG + Intergenic
1150971976 17:70039147-70039169 ATTGAATTGCATGCTTAAAATGG + Intergenic
1151413558 17:73947179-73947201 TATTTGTTGAATGAATAAAAAGG - Intergenic
1153469200 18:5424561-5424583 ATTTTACTGTATGCATAAAGTGG - Intronic
1153644214 18:7180058-7180080 ATTTTGTCGGATGCGAAAAATGG - Intergenic
1154470799 18:14699064-14699086 ATTATGGTGTATCCATAAAATGG + Intergenic
1155448046 18:25933437-25933459 ATTTTGTTACATGCATAGAATGG + Intergenic
1155575219 18:27238374-27238396 GTTTTGTTACATGGATATAATGG + Intergenic
1155642426 18:28034758-28034780 AATCTGTTTCATGCAAAAAAAGG - Intronic
1155888003 18:31231928-31231950 AATTTATTGCATGAATATAATGG - Intergenic
1156037064 18:32776398-32776420 ATTTTATTCCATGTGTAAAATGG - Intergenic
1156047096 18:32889128-32889150 ATTTTGTTACAGGCATAGATTGG - Intergenic
1156057391 18:33024397-33024419 ATTTGGATGCATGCATACAGAGG - Intronic
1156563285 18:38154033-38154055 ATTATGTTGCCTTTATAAAATGG + Intergenic
1157636780 18:49164804-49164826 ATTTAGTTGAATGCTTAGAAAGG + Intronic
1157841642 18:50964767-50964789 ATTTTGATACAGGCATACAATGG - Intergenic
1157971392 18:52273727-52273749 CTTTTTTTGCATTCATAAAATGG + Intergenic
1158126781 18:54108601-54108623 AATTTGCTGCAGGCATAAATAGG + Intergenic
1158738751 18:60114728-60114750 ATTTTGTTGCAAGCAAGAGAAGG - Intergenic
1159116609 18:64121236-64121258 ATTTTGTTACATGCATAGCTTGG + Intergenic
1159432436 18:68370712-68370734 ATTGTGTTACGTGCATACAATGG + Intergenic
1159725991 18:71960483-71960505 ATTTTGTTTCGTGCAAAATAAGG + Intergenic
1160471556 18:79139592-79139614 ATTTTGATGCAGGCATTCAATGG + Intronic
1162851760 19:13436602-13436624 AATCTGTTGAATGCATAAATGGG - Intronic
1163922655 19:20307112-20307134 ATTTTGTTGAATGTTTATAAAGG - Intergenic
1164893846 19:31851505-31851527 ATTGTGGTGCATTCATACAATGG + Intergenic
925365396 2:3307913-3307935 ATTTTGATACATGTATACAATGG - Intronic
926788316 2:16542766-16542788 ATGTTGTTGCATGTATCAATAGG - Intergenic
926837565 2:17041023-17041045 ATTCTGTTGCATCCACACAATGG + Intergenic
926859737 2:17296409-17296431 ATTTTGTTACATGAAAAATAGGG - Intergenic
927226971 2:20776692-20776714 ATAATATTTCATGCATAAAAAGG - Intronic
927301226 2:21517939-21517961 AATGTGGTGCATGCATACAATGG + Intergenic
927367965 2:22320721-22320743 ATATTGTTTCATGTATAAATAGG + Intergenic
929006226 2:37395824-37395846 ATTTTGGTACATCCATACAATGG - Intergenic
929099740 2:38300315-38300337 ATTTTGATGTAAGCCTAAAAAGG + Exonic
929351625 2:40963311-40963333 ATTTTGTTACATGCATAGAATGG + Intergenic
930569617 2:53068851-53068873 ATTTTATTCAATGCATATAAAGG + Intergenic
930999057 2:57759640-57759662 ATTACGCTGCATGCATAAAACGG + Intergenic
932065103 2:68548555-68548577 AATTTGTTGAATGAATAAATAGG - Intronic
932227707 2:70055973-70055995 ACTATGATGCATACATAAAATGG + Intergenic
933176848 2:79183912-79183934 ATTTTGTTGCCAGGAAAAAAAGG + Intergenic
933260336 2:80125030-80125052 ATTTTGTTAAATGTCTAAAATGG - Intronic
933839691 2:86276423-86276445 ATTGTGTGGGATGCATCAAAAGG - Intronic
933885676 2:86718190-86718212 ATTTTGTTGAGTGCCTTAAATGG + Intronic
933924502 2:87078515-87078537 ATTTTGTTGAGTGCCTTAAATGG - Intergenic
934114535 2:88773910-88773932 ATTGTGGTGCAGTCATAAAATGG - Intergenic
934309174 2:91848350-91848372 ATTCTGTTGCATCAAGAAAATGG - Intergenic
935052230 2:99533662-99533684 ATGATATTGCATCCATAAAAAGG + Intergenic
935599289 2:104906104-104906126 TTTTTGTTTGATGCATAGAAAGG + Intergenic
936698486 2:114981302-114981324 ATTTTGTTGAATCAATATAATGG + Intronic
936744040 2:115552109-115552131 ACTTTGTTTCATTGATAAAAAGG - Intronic
936807420 2:116352766-116352788 ATTTTCTAGCATGAATAAACAGG - Intergenic
936850968 2:116897075-116897097 ATTTTGATACATGCATACAAGGG + Intergenic
936918392 2:117663133-117663155 ATATCTTTGCATGTATAAAATGG - Intergenic
937937858 2:127260388-127260410 ATTTTCATGGATGGATAAAAAGG + Intronic
938168546 2:129055198-129055220 ATTTGGTAGCATGCTTAAGATGG - Intergenic
938366721 2:130740448-130740470 ATTATACTGCATCCATAAAATGG + Intergenic
939371213 2:141303192-141303214 ATTTTGTTACATGCATAGAATGG + Intronic
939553962 2:143651429-143651451 ATTTTGTTGTATCCATACAGTGG - Intronic
940608933 2:155965802-155965824 ATTTTGTTATAGTCATAAAATGG - Intergenic
941975299 2:171397796-171397818 ATTTTATTGCATTCATTAGATGG + Intronic
942385748 2:175441114-175441136 ATTTTTTTAGATGCATGAAATGG - Intergenic
942720294 2:178944192-178944214 ATTTGTTTTGATGCATAAAATGG + Intronic
943402644 2:187434732-187434754 ATTGTGTTACATTCATACAATGG + Intronic
943432634 2:187823956-187823978 ATTTAATTGTATGCACAAAATGG + Intergenic
943611123 2:190035781-190035803 ATTGTGGTACATCCATAAAATGG - Intronic
944270601 2:197781696-197781718 ACTTTACTGCATGCATAAATAGG + Intronic
945454457 2:210034095-210034117 TTGTTGTTGGATGAATAAAAGGG - Intronic
945773773 2:214079257-214079279 AACTTGCTGAATGCATAAAAAGG - Intronic
946676352 2:222163806-222163828 ATTGTGGTGCATTCATAAAATGG + Intergenic
946974818 2:225136703-225136725 ATTTGGTTGCTTTAATAAAAGGG + Intergenic
947160720 2:227211342-227211364 ATTTTGTTACATTCATAGGATGG - Intronic
948596111 2:239080865-239080887 GTTTTATTTCATGCACAAAAGGG + Intronic
1170053180 20:12169621-12169643 AATTTAGTGCATTCATAAAATGG + Intergenic
1172945746 20:38687483-38687505 ATTTTATTGCAGCCATAAAAAGG - Intergenic
1174777521 20:53358700-53358722 ATTTTATTTTATGCATAAATTGG - Intronic
1175622672 20:60463279-60463301 ATTATGTTACATCCATAAGATGG - Intergenic
1176803685 21:13458873-13458895 ATTATGGTGTATCCATAAAATGG - Intergenic
1177165166 21:17593621-17593643 TTTCTGTTGTGTGCATAAAAGGG - Intergenic
1177515356 21:22143663-22143685 ATTTTGATACATGTATACAATGG + Intergenic
1178817084 21:35941317-35941339 AATGTTTTGCATACATAAAATGG + Intronic
1180730458 22:17978171-17978193 AATGTGGTGCATACATAAAATGG + Intronic
1183104880 22:35608608-35608630 GTTTTGTGGCATTCATGAAATGG - Intronic
1183843916 22:40524347-40524369 GATTTGTTGTAGGCATAAAATGG - Intronic
1184919857 22:47598346-47598368 ATTTTGGAGCATCCAGAAAATGG - Intergenic
949255903 3:2045742-2045764 ATTGTGTTACATCCATACAATGG - Intergenic
950769280 3:15298272-15298294 ATTTTTTTTCATCCATAAAATGG - Intronic
951133558 3:19076619-19076641 ATTTTGCTGTAAGCCTAAAATGG + Intergenic
951143677 3:19199383-19199405 CTTTTGTTACATGATTAAAAAGG - Intronic
951227639 3:20139738-20139760 ATTTTTTTGCCTGCAAAGAAAGG + Intronic
951311730 3:21134512-21134534 ATTCTCTTGCAAGTATAAAAAGG + Intergenic
951344630 3:21532317-21532339 ATTTTGTTGCATAAATAATAAGG - Intronic
951380348 3:21976658-21976680 ATTTTGGTACATCCATAAAATGG + Intronic
951513107 3:23526679-23526701 ATTTTGTTTCCTGCTTCAAAAGG + Intronic
951673813 3:25214795-25214817 CTGTTTTTGCATACATAAAATGG - Intronic
951703146 3:25516452-25516474 ATTTTGATTCATTCATTAAAGGG + Intronic
951853384 3:27168231-27168253 ATTCTGTGCCATGTATAAAATGG - Intronic
952105163 3:30061089-30061111 ATTATGATGCATCCATATAATGG - Intergenic
953261863 3:41347508-41347530 AGGGTGTTGCATGCATGAAAGGG - Intronic
953592358 3:44271042-44271064 ATTTTGATACACTCATAAAATGG - Intronic
954167778 3:48774192-48774214 TGTTTGTTGCATGCATAGAATGG + Intronic
954260746 3:49436938-49436960 ATTGTGTAGCATGCTTAAACGGG + Intergenic
954607159 3:51920998-51921020 ATTTTAATACATGCATAGAATGG - Intergenic
955817207 3:62857496-62857518 ATAATGTTACATCCATAAAATGG + Intronic
956381315 3:68667330-68667352 AATTTGTAGTATGCACAAAATGG - Intergenic
958579303 3:95996657-95996679 ATTTTATTGCATGCATCCAGGGG - Intergenic
958722813 3:97866384-97866406 ATTGTGCTGCATCCATAATATGG + Intronic
959142335 3:102501479-102501501 ATTTTGATCCATGGAAAAAAGGG - Intergenic
959225146 3:103571611-103571633 ATTTTGATGTATCCATTAAATGG + Intergenic
959434936 3:106303103-106303125 ATTTTCCTCCATGCAGAAAAAGG - Intergenic
959523527 3:107348149-107348171 ATGTGGTTGGATTCATAAAAAGG - Intergenic
959524954 3:107366581-107366603 ATTTTGTTGAGTGTATGAAAAGG + Intergenic
959789377 3:110339202-110339224 ATTTTGGTGTATCCATACAATGG - Intergenic
959807296 3:110572031-110572053 ATTTTCTTGCATGCATTGAAGGG - Intergenic
960204715 3:114882555-114882577 ATTTTGTGACATCCATAAAATGG + Intronic
961224911 3:125235158-125235180 ATTTTGTTAAATGTATGAAAGGG - Intronic
961934842 3:130572058-130572080 AATTTGTTTCTTGCATAAAGAGG - Intronic
962993670 3:140603705-140603727 ATTTTGATACATTCATACAATGG - Intergenic
963491517 3:146007682-146007704 ATTGAGTTGCATGCTTTAAATGG + Intergenic
964204297 3:154154698-154154720 ATGTTGTTACATGAATAAAGAGG - Intronic
964350832 3:155802291-155802313 ACTTTTTTTCATGCTTAAAAAGG - Intronic
964574659 3:158151735-158151757 AACTTTTTGCATGCCTAAAAGGG - Intronic
965544371 3:169900302-169900324 ATTTTGTTGCTTTCAAAGAAAGG + Intergenic
965986502 3:174760112-174760134 GTTTCCTTGCATACATAAAATGG - Intronic
966330018 3:178801261-178801283 ATTTTGATACAGGCATACAATGG - Intronic
966625920 3:182017058-182017080 ATTTTGTTGTATATATGAAAAGG + Intergenic
966682485 3:182657527-182657549 ATTTTCTTGGATGCTTAATATGG - Intergenic
967474343 3:189898637-189898659 ATTTTGTAGTAAGCATATAAAGG - Intergenic
969233579 4:5849408-5849430 ATCTTGGTCCATGCAGAAAATGG - Exonic
970782519 4:19755508-19755530 AATTTGTTGCCTCCACAAAAGGG + Intergenic
970798398 4:19943102-19943124 AATTTCTTTCATCCATAAAATGG - Intergenic
971099527 4:23448174-23448196 ATTGTTGTGTATGCATAAAATGG - Intergenic
971848918 4:31958259-31958281 ATTTTTTTGCATTGATATAAAGG - Intergenic
972081501 4:35156678-35156700 ATTTTGTCACATACATAAATTGG - Intergenic
972956115 4:44394257-44394279 ATTTCTTTGCCTGTATAAAAGGG - Intronic
974621297 4:64359148-64359170 ATTTAATTGCATGCATTAACAGG - Intronic
974738027 4:65965270-65965292 ATTTTGAAACATACATAAAAAGG - Intergenic
974862775 4:67543861-67543883 ATTTTGTAGAATGAATCAAATGG - Intronic
975442199 4:74423861-74423883 TTTTTGTTTCATGAATAAAAGGG - Intergenic
976436153 4:85020750-85020772 ATTCTATTTCATGCCTAAAAGGG - Intergenic
976995788 4:91431913-91431935 ATTATGTTGCATCTATACAATGG - Intronic
977094814 4:92727834-92727856 AGTTTTTTTCATCCATAAAATGG - Intronic
977909669 4:102518576-102518598 CTTTTGTTGCATTAAAAAAAAGG + Intronic
978454846 4:108877352-108877374 TTTTTGTTTCATGCAGAAACAGG - Intronic
979222926 4:118250067-118250089 ATTGTGGTACATCCATAAAATGG - Intronic
979308634 4:119176186-119176208 AATTTGTTGCATGAATACATGGG + Intronic
980740538 4:136944975-136944997 ATTTTGTTGCATGCATAGGTTGG + Intergenic
982282180 4:153694592-153694614 ATTTTGATACAGGCATACAATGG + Intergenic
983043847 4:162961283-162961305 ATTTTGTTATATTCATATAATGG + Intergenic
983080773 4:163382598-163382620 ATTGAGTTGTATGCTTAAAATGG + Intergenic
983525539 4:168756997-168757019 ACTCTGTAGCATGGATAAAATGG - Intronic
983603570 4:169558578-169558600 ATGGTGTTGCATGTATAAACAGG + Intronic
983654642 4:170070640-170070662 ATTTTCTTGCAAGCTAAAAAAGG + Exonic
983986380 4:174065032-174065054 TTCTTGTGGAATGCATAAAATGG - Intergenic
984047973 4:174826210-174826232 ATTTTGATGTATTCATATAATGG + Intronic
984086485 4:175318964-175318986 ATTTTCATGTATTCATAAAATGG + Intergenic
984119935 4:175729670-175729692 ATTTTGATGCAGGCATGCAATGG - Intronic
984596572 4:181675767-181675789 ATTTTTTTGCATGCAAAATGAGG + Intergenic
986083360 5:4417216-4417238 ACTTAGTTGCATGAAGAAAATGG + Intergenic
986676506 5:10190206-10190228 ATTTTGTGTCATGCTTAGAAAGG - Intergenic
986805443 5:11304620-11304642 ATTTTGTTCCTTGCAAGAAAGGG + Intronic
986952423 5:13105443-13105465 ATTTTGTTGCATTTATACAAAGG - Intergenic
987744695 5:21955164-21955186 ATTTTTTTTCATTTATAAAATGG - Intronic
987818547 5:22933482-22933504 ATTGAGTTGGATGCATAAAGGGG - Intergenic
987926118 5:24344251-24344273 ATTTTTCTTCATTCATAAAATGG - Intergenic
988012223 5:25503565-25503587 ATTTGGTATCATGGATAAAATGG - Intergenic
988780584 5:34517792-34517814 AATTTGGTACATCCATAAAATGG + Intergenic
988954371 5:36299749-36299771 ATTTTGCTACATCCATATAAAGG + Intronic
989381983 5:40818141-40818163 ATTTTGGTATATGCATACAATGG - Intergenic
989392217 5:40912840-40912862 ATTTTGTTACATGGATATATTGG + Intronic
990072252 5:51797705-51797727 ATTTTGTTCCATGCATAGATTGG + Intergenic
990157285 5:52892619-52892641 ATTGTGGTGCATCCATACAATGG + Intronic
990503433 5:56420886-56420908 TTTTTGTTGAATGAATAAATTGG + Intergenic
990904343 5:60787725-60787747 ATTATGTTGTCAGCATAAAAGGG - Intronic
991135691 5:63179726-63179748 CTTTTTTTGCATGAAGAAAATGG - Intergenic
991937261 5:71814775-71814797 ATTTTTCTGCATGTATAAGAGGG + Intergenic
992093964 5:73343137-73343159 ATTGTGTTGCCTGCTAAAAATGG - Intergenic
992181806 5:74204842-74204864 ACTTTGATACATGTATAAAATGG - Intergenic
992464331 5:76988791-76988813 ATTTTGTGGCATTGAAAAAAGGG + Intergenic
993023954 5:82625214-82625236 ATATTGTTGCATGATTTAAAGGG - Intergenic
993348105 5:86810580-86810602 ATTTTGATACATGCATACAATGG - Intergenic
993739841 5:91524821-91524843 ATTTTTGTGCATGCATAAAAAGG + Intergenic
993774770 5:91978904-91978926 ATTTTCTTGAATGAAAAAAAAGG - Intergenic
993972843 5:94441325-94441347 ATTCTGTTGCATGCATGGTAAGG + Intronic
994233746 5:97338386-97338408 ATTTAGAAGCATGGATAAAATGG + Intergenic
994907266 5:105857592-105857614 AATGTGTTACATGCAAAAAATGG - Intergenic
995456962 5:112362066-112362088 ATTGTGTTACATACTTAAAATGG - Intronic
995617590 5:113983653-113983675 ATTCTGGTACATCCATAAAATGG - Intergenic
995907669 5:117145355-117145377 ATTCTGTTGCATAGAAAAAAAGG + Intergenic
995911435 5:117192482-117192504 ATTTTTTCACATACATAAAATGG - Intergenic
995986985 5:118188800-118188822 ATTTTCTCACATGCATAAAATGG - Intergenic
997126578 5:131233290-131233312 ATTATGCTACATGCATACAATGG - Intergenic
997132965 5:131295408-131295430 ATTATGGTGCATCCATATAATGG + Intronic
998026625 5:138821952-138821974 ATTTTGTTACATAAAGAAAACGG - Intronic
998713162 5:144849399-144849421 GTTGTGTTGGATGCATAAAGGGG + Intergenic
998903965 5:146883730-146883752 ATGTTGTAGCATGCACAAACAGG - Intronic
999090409 5:148931226-148931248 ATTTTAATACATGCATAGAACGG + Intronic
1000519854 5:162282037-162282059 ATGCTATTTCATGCATAAAATGG - Intergenic
1001814586 5:174657434-174657456 ATTATGGTGTATTCATAAAATGG - Intergenic
1003743097 6:8965568-8965590 TTTTTGTTCTATGCTTAAAATGG + Intergenic
1004948999 6:20647118-20647140 ATTTTCTTGTCTGCATAATATGG + Intronic
1005266099 6:24113705-24113727 ATTATGCTGCATCCATAAAATGG + Intergenic
1006260489 6:32864873-32864895 ATTTTATTGAATGGAAAAAATGG - Intergenic
1008074099 6:47127729-47127751 AGTATTTTGCATCCATAAAAAGG - Intergenic
1008196170 6:48523670-48523692 ATTTTGTTCTATGCAGAAAATGG - Intergenic
1008372731 6:50753304-50753326 ATTTTGTTTTGAGCATAAAAAGG - Intronic
1008386670 6:50899408-50899430 ATTGTGTTGCATCTATACAATGG - Intergenic
1009369799 6:62884443-62884465 ACTTTTGTGCATACATAAAAAGG - Intergenic
1009824109 6:68844750-68844772 AATTTGGTACATGCACAAAATGG + Intronic
1009831640 6:68944450-68944472 CTCTTGCTGGATGCATAAAATGG + Intronic
1010454612 6:76040270-76040292 ATTTTGTTGCAGCAATAAATAGG + Intronic
1011374358 6:86673900-86673922 GTTGTGTTGGATGCATAAAGGGG + Intergenic
1011560559 6:88609595-88609617 ATTTTGTTCCATCTATAAAGTGG - Intergenic
1011827186 6:91322411-91322433 CTTTTTCTGCATGCATATAAAGG - Intergenic
1012154647 6:95802737-95802759 GGTTTGTTGCATTTATAAAATGG + Intergenic
1012221922 6:96658779-96658801 ATTTTGTAGCCTGAATAATATGG - Intergenic
1012402508 6:98854481-98854503 ATTCTGCTGTATGCATCAAAAGG + Intergenic
1013280629 6:108633618-108633640 ATTGTACTGCATGCACAAAAGGG - Intronic
1016193262 6:141297429-141297451 ATTTTGATGCCTTTATAAAAGGG - Intergenic
1016405645 6:143726859-143726881 ATTTTGTTCCATTCATATACTGG + Intronic
1016842735 6:148540798-148540820 TTTTTATTGCATACAGAAAAGGG - Intronic
1017186367 6:151604807-151604829 ATTTTGATGCATGTATACAATGG + Intronic
1017567222 6:155700426-155700448 AGTATGATGCATTCATAAAATGG - Intergenic
1017857189 6:158360083-158360105 TTTTTTTTGGAGGCATAAAAGGG - Intronic
1018338201 6:162818905-162818927 ATTTTGTTGCATGCATAAAAGGG - Intronic
1020498021 7:8880683-8880705 ATTTTGTTGTAAGTACAAAATGG - Intergenic
1020695954 7:11414150-11414172 GTTTTGTTGCAACCATAAAAGGG - Intronic
1020910884 7:14129431-14129453 TTTTAGTTGCATGAACAAAAGGG + Intergenic
1021638596 7:22715726-22715748 ATTTTGTGACATACTTAAAATGG - Intergenic
1022279946 7:28897904-28897926 ATTTATTTGCATTTATAAAAGGG - Intergenic
1023217506 7:37879557-37879579 ACTTAGTTGCATACATACAATGG - Intronic
1023593439 7:41802981-41803003 GTTTTGTGTCATGCTTAAAAAGG + Intergenic
1023858836 7:44204272-44204294 ATTTTGGTGAATGCATAATTTGG - Intronic
1023959959 7:44918205-44918227 ATTTTGTTACATGTATAGAATGG + Intergenic
1024130078 7:46342259-46342281 ATGTTGTTGAGTGAATAAAAAGG - Intergenic
1024437665 7:49377809-49377831 CTTTTAATGCATGCATGAAAGGG + Intergenic
1024473313 7:49785750-49785772 ATTTTGTTGGATACATCAATCGG - Intronic
1024725988 7:52195857-52195879 AATGTGTTGTATGCATACAATGG + Intergenic
1024791420 7:52968715-52968737 ATTGTATTGTATGCAGAAAAAGG - Intergenic
1025790793 7:64685226-64685248 GTTGTGTTGGATGCATAAAGGGG - Intronic
1025798160 7:64759030-64759052 ATTGCGTTGGATGCATAAAGGGG + Intergenic
1027666143 7:81044512-81044534 ATTTGGTTGTATGCATCTAATGG + Intergenic
1027963582 7:84978036-84978058 ATTTTGCTGCAAACCTAAAATGG - Intergenic
1028050888 7:86184593-86184615 ATTTTGGTGTATTCATACAATGG - Intergenic
1028162618 7:87502792-87502814 GTTTTGGTGCATTCACAAAATGG - Intergenic
1028293732 7:89100802-89100824 AATTTGTTACAGGCATACAATGG - Intronic
1028363549 7:89998056-89998078 ATTTTGATACATGCATACAATGG - Intergenic
1028864283 7:95689891-95689913 ATTTTGGTGTATCCATAAACTGG + Intergenic
1030744511 7:113148802-113148824 ATTTTGATACAGGCATACAAGGG - Intergenic
1031028436 7:116707920-116707942 ATTTTATTTAGTGCATAAAAGGG + Intronic
1031135094 7:117875384-117875406 ATTGGGCTGCATGTATAAAAGGG - Intergenic
1031207885 7:118784770-118784792 AATGTGTTGTATACATAAAATGG - Intergenic
1032307011 7:130744070-130744092 ACTTTGCTTCATTCATAAAAGGG + Intergenic
1033041188 7:137919694-137919716 ATTATGGTGCATCCATACAATGG + Intronic
1033384501 7:140859260-140859282 AGTTTGTTTCATGCAAGAAAAGG + Intronic
1033636258 7:143214007-143214029 TATTTGTTGAATGAATAAAAAGG + Intergenic
1034135748 7:148767579-148767601 ATTTTTTTCAGTGCATAAAAGGG + Intronic
1035343166 7:158177735-158177757 ATTTTGTTTGATCCACAAAATGG - Intronic
1035359780 7:158303656-158303678 ATTTTCTTCCATGAATAAAATGG - Intronic
1035411025 7:158642215-158642237 AATTTGTGAGATGCATAAAAGGG + Intronic
1035532072 8:360957-360979 ATTTTTTTTCATTCATAGAAAGG + Intergenic
1036606858 8:10314759-10314781 ATTGTGGTGCATTCATACAATGG + Intronic
1036785373 8:11682002-11682024 GTTTTGTTTCATGAATCAAAAGG + Intronic
1036908473 8:12730155-12730177 ATTATGGTACATCCATAAAACGG + Intronic
1037358221 8:18045574-18045596 ATTTTGTTGAATGAATAAATGGG + Intergenic
1038099606 8:24358602-24358624 CTTTTGCTGCTTCCATAAAAAGG + Exonic
1038430263 8:27494238-27494260 GTTGTGTTGGATGCATAAAAGGG + Intronic
1038950377 8:32407996-32408018 TTTTGTTTGCAGGCATAAAAAGG - Intronic
1039241521 8:35561797-35561819 ATTTTGATACATTCATAAAATGG + Intronic
1039244128 8:35589281-35589303 TTTTTGGTGCATTCATACAATGG - Intronic
1039692489 8:39877997-39878019 GTTGTGTTGGATGCATAAAGGGG + Intergenic
1040886511 8:52269248-52269270 ATTTTGTTGCAGAGATAAATGGG + Intronic
1041248012 8:55907217-55907239 ATTTTGATATATTCATAAAATGG + Intronic
1041734390 8:61094477-61094499 AATTTGCCTCATGCATAAAAAGG - Intronic
1042796969 8:72675051-72675073 ATTTAGTTGTATGCAAGAAAAGG - Intronic
1042890668 8:73606904-73606926 TTATTGTTGCATGCATGAATTGG - Intronic
1042914475 8:73861818-73861840 ATTTTGTTTGTTGTATAAAATGG + Intronic
1043025991 8:75069558-75069580 TATTTGTTGAATGAATAAAAAGG + Intergenic
1043117459 8:76276279-76276301 ATTTAATTGTATGTATAAAATGG + Intergenic
1043611002 8:82063536-82063558 ATTTTGTAGCTATCATAAAAGGG - Intergenic
1044004841 8:86927566-86927588 GTTGTGTTGGATGCATAAAGGGG + Intronic
1044132805 8:88547183-88547205 ATATTGTTGCATAAATAAATGGG + Intergenic
1044294778 8:90515315-90515337 ATTTTGTTTCATGTGTAAATTGG + Intergenic
1044947042 8:97398941-97398963 AATTTTCTGCATTCATAAAATGG - Intergenic
1045136587 8:99226799-99226821 ATTTTGTTGCATGCGTAAAATGG + Intronic
1045512932 8:102828018-102828040 ATTTTATTGCAATCATACAAGGG + Exonic
1046209460 8:111048935-111048957 AATTTGTTGGATGCATATAGCGG + Intergenic
1046216243 8:111151700-111151722 ATTTTGGTGCTTTCTTAAAATGG + Intergenic
1046518642 8:115296016-115296038 ATTTTGTTGCTTCCTTAAACAGG - Intergenic
1046799356 8:118408193-118408215 CTTTTGTAGCATGTATACAAGGG - Intronic
1048836445 8:138523545-138523567 TTTTTGTTTCATGTGTAAAATGG - Intergenic
1049048389 8:140171397-140171419 ATTTTACTGTATGTATAAAATGG + Intronic
1050116458 9:2268536-2268558 ATTTAGTTAGATGCAAAAAAAGG - Intergenic
1050704628 9:8383207-8383229 ATTTTGTTCTATGGCTAAAAGGG - Intronic
1050906022 9:11007115-11007137 ATTTTGATACAGGCATACAATGG + Intergenic
1051026031 9:12612542-12612564 ATTTTGTTGAACCCATAAAAAGG + Intergenic
1051072176 9:13183795-13183817 ATTTTATTTCATCAATAAAAGGG + Intronic
1051735676 9:20196999-20197021 ATTATGTTACATCCATATAATGG - Intergenic
1051783118 9:20712321-20712343 ATATTGTTCCATGTGTAAAATGG + Intronic
1051810446 9:21042810-21042832 ATTGTGTTATATTCATAAAATGG - Intergenic
1051831792 9:21287343-21287365 GTTTTATTGCATGCTTAATATGG + Intergenic
1052106060 9:24517709-24517731 ATTTTATTACATGCATAAATTGG - Intergenic
1052589528 9:30473365-30473387 ATTTTATTGCATGCAGCAAATGG - Intergenic
1054853912 9:69877539-69877561 ATTTTGTTGCAAGTATAAATGGG + Intronic
1055202206 9:73679178-73679200 ATTTTGATACATGTATACAATGG - Intergenic
1055844167 9:80540984-80541006 ATTTTGTTTCTTGCATACACTGG - Intergenic
1056004792 9:82257415-82257437 CCTTTGTTCCATGTATAAAATGG - Intergenic
1056875311 9:90323729-90323751 AGTGTGATACATGCATAAAATGG - Intergenic
1056875949 9:90330546-90330568 ATTTAGTAAAATGCATAAAATGG + Intergenic
1056925648 9:90832233-90832255 ATTTTGTTTCATGCATAAGATGG + Intronic
1057723535 9:97552719-97552741 ATTATGGTGCATCCATACAATGG - Intronic
1057977977 9:99627233-99627255 ATTTTGTTACATGCATAGACTGG - Intergenic
1058918740 9:109593147-109593169 ATATAGTTCCATGCACAAAATGG + Intergenic
1058946098 9:109857750-109857772 AGGTTGTTTCATCCATAAAATGG + Intronic
1059179882 9:112201626-112201648 CTTTTGTTGGATTCATAAATGGG - Intergenic
1059679934 9:116576311-116576333 GTTTTCTTGCATGTATAATAGGG - Intronic
1060247849 9:121961410-121961432 TTTTTTTTTCATCCATAAAAGGG - Intronic
1061645822 9:132000676-132000698 ATATTGTTGCATGTATCAATAGG - Intronic
1061687426 9:132293189-132293211 ATTTTATTGCATGCTTCAAATGG - Intronic
1187066177 X:15840455-15840477 TTTTTGTGGCATGGATAAAATGG - Intronic
1187071242 X:15890862-15890884 ATTTTGATACAAGCATACAATGG - Intergenic
1187634980 X:21217732-21217754 ATTATGTTGTATATATAAAATGG + Intergenic
1187673215 X:21689291-21689313 ATTCTGATGCATGCCAAAAATGG - Intergenic
1188246657 X:27842984-27843006 ATTGTGGTGCATGCATACAACGG - Intergenic
1188518098 X:31009266-31009288 ATTTTGGTGCATTCATACAATGG + Intergenic
1188534371 X:31180133-31180155 ATATTGTTGGATGAATAAATAGG - Intronic
1188582617 X:31733618-31733640 ATTTTCTTCAATACATAAAATGG - Intronic
1188802881 X:34553165-34553187 ATTTTTTTGCTTGGATTAAAGGG + Intergenic
1189508782 X:41639940-41639962 ATTATGATACATGCATACAATGG - Intronic
1189879756 X:45478137-45478159 ATTTTGTTGCATCAATAATGGGG + Intergenic
1190390874 X:49930453-49930475 ATTTTGATGCATCCATACAATGG + Intronic
1190806870 X:53846238-53846260 ATTTTGATACAGTCATAAAATGG - Intergenic
1190902264 X:54687791-54687813 ATTTTGTAGCCTAGATAAAATGG - Intergenic
1192105654 X:68313923-68313945 ATTTTGATACAGGCATACAATGG - Intronic
1192388565 X:70699817-70699839 ATTTTGTGTCATGCCTAGAAAGG - Intronic
1193680493 X:84513169-84513191 ATTTTGATACAAGCATACAATGG - Intergenic
1194537801 X:95128219-95128241 ATTTTCATGCAGGCATACAATGG - Intergenic
1194577617 X:95633016-95633038 TGTTTGTTGCATACACAAAAAGG + Intergenic
1195342653 X:103920110-103920132 ATTATGTTGCTTTTATAAAAAGG - Intronic
1196216512 X:113058515-113058537 ATGTTGTTGCATGTATCAATAGG + Intergenic
1196536025 X:116845457-116845479 ATTTTCTTGCTTTCATAAAATGG + Intergenic
1196567036 X:117220149-117220171 ATTTTGTTGCAAGCATAGAATGG - Intergenic
1196841506 X:119863779-119863801 ATTGTGTTCTATGCATACAATGG + Intergenic
1197830203 X:130633770-130633792 GTTTTGCTTCCTGCATAAAATGG - Intronic
1198929918 X:141844170-141844192 ATTTTAGTGTATTCATAAAATGG - Intronic
1198997827 X:142595577-142595599 ATTTTCTTGCATGTGAAAAATGG - Intergenic
1199009083 X:142738134-142738156 ACTTTGTTGGATACAGAAAATGG + Intergenic
1199061333 X:143358584-143358606 ATTTTGTTGCACTTTTAAAATGG - Intergenic
1199916385 X:152346036-152346058 ATTGTGTTGCATGATTAAACAGG + Intronic
1199941712 X:152634016-152634038 ATTTTTTTCCATGCTGAAAAAGG - Intergenic
1201404397 Y:13635392-13635414 GTTGTGTTGGATGCATAAAGGGG - Intergenic
1201468836 Y:14312905-14312927 GTTGTGTTGGATGCATAAAGGGG - Intergenic
1201646382 Y:16237041-16237063 AATGTGTTTCAGGCATAAAATGG - Intergenic
1201656431 Y:16348276-16348298 AATGTGTTTCAGGCATAAAATGG + Intergenic
1201863929 Y:18629517-18629539 ATTTTGTAGCATGCTTGGAAAGG - Intergenic
1201869393 Y:18690861-18690883 ATTTTGTAGCATGCTTGGAAAGG + Intergenic
1202131271 Y:21613336-21613358 ATTTCGTTACATCCTTAAAAAGG + Intergenic
1202584882 Y:26411920-26411942 ATTTCGGTGCATCCATACAATGG + Intergenic