ID: 1018343396

View in Genome Browser
Species Human (GRCh38)
Location 6:162876319-162876341
Sequence CTGTATTATTAGAGGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018343396_1018343401 17 Left 1018343396 6:162876319-162876341 CCTGCTGTCCTCTAATAATACAG 0: 1
1: 1
2: 2
3: 17
4: 184
Right 1018343401 6:162876359-162876381 GCAACTGCCAGCAGGATCCCTGG 0: 1
1: 0
2: 1
3: 20
4: 184
1018343396_1018343400 9 Left 1018343396 6:162876319-162876341 CCTGCTGTCCTCTAATAATACAG 0: 1
1: 1
2: 2
3: 17
4: 184
Right 1018343400 6:162876351-162876373 TGGCATCAGCAACTGCCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 206
1018343396_1018343402 18 Left 1018343396 6:162876319-162876341 CCTGCTGTCCTCTAATAATACAG 0: 1
1: 1
2: 2
3: 17
4: 184
Right 1018343402 6:162876360-162876382 CAACTGCCAGCAGGATCCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018343396 Original CRISPR CTGTATTATTAGAGGACAGC AGG (reversed) Intronic
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
902162195 1:14540021-14540043 CTGTATTACTAGGGGAGAGAGGG + Intergenic
904532455 1:31178222-31178244 CTGTATTTTTAGTGGAGATCGGG - Intergenic
905986534 1:42288796-42288818 CTGACTTAATAGAAGACAGCTGG - Intronic
906978374 1:50600751-50600773 CTGTCTTAATAGAAGACAACTGG - Intronic
907087895 1:51694321-51694343 CTGACTTAATAGAAGACAGCTGG + Intronic
909165049 1:72211534-72211556 ATGAATTAATAGAAGACAGCTGG - Intronic
909469458 1:76010752-76010774 CTTTAATATCAGAAGACAGCTGG + Intergenic
910010759 1:82458707-82458729 CTGGCTTACTAGAGGACAGCTGG + Intergenic
915520440 1:156439369-156439391 CTGTAGCATTGGAGGACAGGGGG + Intergenic
915542628 1:156578071-156578093 CTGCTTAATGAGAGGACAGCAGG - Intergenic
915856649 1:159395834-159395856 CTGGTTTAATAGAAGACAGCTGG - Intergenic
917578696 1:176350614-176350636 CTGGCTTAATAGAGCACAGCTGG - Intergenic
917601046 1:176574156-176574178 CTGTATTATAAGTTGACAGCTGG - Intronic
919908539 1:202095401-202095423 CTGGCTTAATAGAAGACAGCTGG - Intergenic
924486664 1:244490743-244490765 TTGTATTAATAAAAGACAGCTGG - Intronic
1063356015 10:5399076-5399098 CTGAGTTATTAGAGTAGAGCTGG - Intronic
1063579544 10:7293269-7293291 TTGTATTTTTAGAAGACACCGGG + Intronic
1065035992 10:21639174-21639196 CTGTATTGTGAGATTACAGCAGG - Intronic
1066424103 10:35290050-35290072 TTGTATTTTTAGTAGACAGCAGG - Intronic
1067419842 10:46135591-46135613 TTGTATTTTTAGAGGACACAGGG - Intergenic
1067426176 10:46213820-46213842 TTGTATTTTTAGAGGACACAGGG + Intergenic
1067505192 10:46842188-46842210 TTGTATTTTTAGAGGACACAGGG - Intergenic
1068034299 10:51740523-51740545 CTGGATTGATAGAAGACAGCTGG + Intronic
1070206656 10:74270409-74270431 CTGACTTAGTAGAAGACAGCTGG + Intronic
1070299730 10:75194436-75194458 CTGTATGAACAGAGGACAGTGGG - Intergenic
1071684498 10:87740794-87740816 CTGACTTAATAGAAGACAGCTGG - Intronic
1072162214 10:92778930-92778952 CTTTATATTTAGAAGACAGCCGG + Intergenic
1072596044 10:96872942-96872964 CTGTAGTATTATATGACAGCAGG + Intronic
1073014722 10:100388851-100388873 CTGACTTAATAGAAGACAGCTGG - Intergenic
1079546567 11:21640228-21640250 CTGAATTATTTGAGAACAACAGG - Intergenic
1080483278 11:32675483-32675505 CGCTATTACTAGAGGACAGTTGG - Intronic
1087670588 11:101101691-101101713 CTATCTTAATAGAAGACAGCTGG - Intronic
1088950840 11:114568352-114568374 CTCTATTAATAGAAGAAAGCAGG + Intergenic
1089072514 11:115711351-115711373 CTGTATGACTGGAGGAGAGCAGG - Intergenic
1089140781 11:116282181-116282203 TTGTATTTTTAGAAGACAGACGG + Intergenic
1092467688 12:8748089-8748111 CTGTATACTTAGATGACAGTAGG + Intronic
1093194464 12:16113249-16113271 CTCTATAATTAGATGGCAGCTGG + Intergenic
1093280280 12:17185841-17185863 CTGTGATAATAGAGGACAGCTGG + Intergenic
1095149186 12:38770878-38770900 ATATATTATGAGAGTACAGCAGG - Intronic
1096269629 12:50154546-50154568 CTGGCTTAATAGAAGACAGCTGG - Intronic
1100494290 12:95110302-95110324 CACTATTATTAAAGGAAAGCAGG + Intronic
1102846028 12:116183724-116183746 CTGCATTTTTAGAGGCAAGCAGG + Intronic
1104413140 12:128576080-128576102 TTGTATTATTAGTGGAGAGGAGG - Intronic
1105665238 13:22548404-22548426 CTGTATTAATAAAGGTGAGCAGG + Intergenic
1106030601 13:25998682-25998704 TTTTATTATTAGAGGAAAGTTGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107281015 13:38735079-38735101 TTGGCTTAATAGAGGACAGCTGG + Intronic
1107633761 13:42370970-42370992 CTGGCTTACTAGAGGACAGCTGG - Intergenic
1107982713 13:45748787-45748809 CTGAATTATTAAACCACAGCAGG - Intergenic
1109734019 13:66457247-66457269 CTGTTTTATTTTAGGAAAGCTGG - Intronic
1114301300 14:21380998-21381020 CTGTATTATTAGAATATCGCAGG - Intronic
1116174257 14:41446618-41446640 CTTAATTATTAGAAGACTGCTGG - Intergenic
1117740490 14:58814136-58814158 CTGTATCATTAGTTGACAGATGG + Intergenic
1117931620 14:60848353-60848375 CTGTATTTTTAGGGCCCAGCAGG + Intronic
1118221427 14:63858038-63858060 CTGTATCATTACATGACAGAAGG + Intronic
1119015880 14:71053874-71053896 CTGGGTTATTAAAAGACAGCTGG + Intronic
1121734869 14:96211232-96211254 CTGCACTCTTAGAGCACAGCAGG - Intronic
1122255274 14:100471700-100471722 CTGTATTGATTGAGGACACCAGG - Intronic
1124686185 15:31784398-31784420 CTGGCTTAATAGAAGACAGCTGG - Intronic
1126532122 15:49722227-49722249 CTGGCTTAATAGAAGACAGCTGG + Intergenic
1126680738 15:51199695-51199717 CTGGAGGATGAGAGGACAGCTGG - Intergenic
1128044695 15:64607413-64607435 CTGGTTTAATAGAAGACAGCTGG - Intronic
1128558646 15:68649805-68649827 CTGGCTTATTAGAAGACAGCTGG + Intronic
1129104893 15:73299757-73299779 CTGGCTTAATAGAAGACAGCTGG + Intronic
1129353855 15:74974380-74974402 CTGGCTTAATAGAAGACAGCTGG - Intronic
1130616382 15:85412407-85412429 CTGGCTTAATAGAAGACAGCTGG - Intronic
1130636320 15:85624026-85624048 GAGCATTACTAGAGGACAGCAGG + Intronic
1132074895 15:98811750-98811772 CTGTATTTTTAGTGGACACGGGG - Intronic
1132135864 15:99337956-99337978 CTGAATTCTTTGAGAACAGCAGG + Intronic
1132471848 16:108842-108864 TTGTATTTTTAGTAGACAGCGGG + Intronic
1135137103 16:19893135-19893157 CTGACTTAATAGAGGACAGCGGG - Intergenic
1135210033 16:20517594-20517616 TTCTATTTTTAGAGGACAGTGGG - Intergenic
1137527631 16:49250090-49250112 CTGGATGATGAGAGGACAACAGG + Intergenic
1140341071 16:74162817-74162839 CTCTATAATGAGAGGACAGAAGG + Intergenic
1140428073 16:74877715-74877737 CTGTATTTTTAGTAGACAGGGGG + Intronic
1141251441 16:82362644-82362666 CTGTATTCTAGGGGGACAGCTGG + Intergenic
1143982723 17:10883816-10883838 CTGCCTTTTCAGAGGACAGCAGG + Intergenic
1145785521 17:27591401-27591423 CTGCATTAGGTGAGGACAGCCGG - Intronic
1147241761 17:39095171-39095193 CTGTATTTTCAGAGGACAGCTGG - Intronic
1147613334 17:41813798-41813820 GGGTATTATAAGAAGACAGCCGG + Intronic
1150474863 17:65467218-65467240 TTTTATTTTTAGAGGACAGCTGG + Intergenic
1155071710 18:22322561-22322583 CTGAAATATTAGAGGTCAGCTGG + Intergenic
1155473148 18:26211708-26211730 CTGGCTTAGTAGAAGACAGCTGG - Intergenic
1155509291 18:26560858-26560880 CAGTCTTTTTAGAGGACAGTGGG + Intronic
1156834798 18:41539736-41539758 CTGTACTTTTTGAGGACAACAGG - Intergenic
1157623641 18:49030802-49030824 CTGCCTTAATAGAAGACAGCTGG + Intergenic
1158921895 18:62201824-62201846 CTCTTTTATTAGTCGACAGCTGG + Intronic
1160907753 19:1459816-1459838 GTGTATTATTAGAGGACTCAGGG + Intronic
1161132618 19:2600328-2600350 CTGGCTTAATAGAAGACAGCTGG + Intronic
1162247818 19:9417196-9417218 TTGTATTATTAGTGGAGAGAGGG - Intronic
1166551676 19:43669637-43669659 CTGTATTTTTAGTGGAGACCGGG - Intronic
1167449580 19:49559226-49559248 CTCTATTGGGAGAGGACAGCTGG - Intronic
926582674 2:14648520-14648542 CTGTTTTAATAGAAGACAACTGG + Intronic
928616796 2:33048378-33048400 CTCTACTATTAGAAGACAACAGG - Intronic
929746068 2:44660193-44660215 CTGTCTTAGTGGAAGACAGCTGG + Intronic
929763750 2:44827281-44827303 CTGGCTTAATAGAAGACAGCTGG + Intergenic
930792635 2:55350511-55350533 CTTTATTATTAAAGAACAGAAGG - Intronic
933241047 2:79920534-79920556 CTTTATTATTAGAGGAGAAGAGG - Intronic
933934664 2:87192442-87192464 CTATGTTATTAGAGGTCTGCAGG + Intergenic
935149599 2:100421819-100421841 CTGGCTTAATAGAAGACAGCTGG - Intergenic
935197789 2:100829942-100829964 CTTTCCTATTGGAGGACAGCAGG - Intronic
935280022 2:101508898-101508920 CTGGCTTAATAGAAGACAGCTGG - Intergenic
936358479 2:111773454-111773476 CTATGTTATTAGAGGTCTGCAGG - Intronic
938585266 2:132684479-132684501 CTGAATTTTAAAAGGACAGCTGG - Intronic
940581919 2:155591276-155591298 CTGTAATATCAGAAGTCAGCAGG + Intergenic
941105390 2:161346053-161346075 TTGTATTTTTAGAAGACAGAGGG + Intronic
942577737 2:177382723-177382745 CTGACTTAGTAGAAGACAGCCGG - Intronic
943468183 2:188256895-188256917 CTGTCTTTTTTGAGGACAACAGG + Intergenic
945867996 2:215197856-215197878 CTGCATCATTGGAGAACAGCCGG + Intergenic
946087501 2:217189021-217189043 ATGAATTATCAGAGGTCAGCTGG - Intergenic
946287436 2:218715157-218715179 CTGACTTAATAGAAGACAGCTGG + Intronic
946979513 2:225193628-225193650 CTGGCTTAATACAGGACAGCTGG - Intergenic
947314768 2:228844150-228844172 CTGGCTTAATAGAAGACAGCTGG + Intergenic
947379812 2:229534662-229534684 CTGTTTTAAAAGAAGACAGCTGG - Intronic
1168881042 20:1206457-1206479 CTGTCTTAATAGAACACAGCTGG + Intronic
1172427017 20:34862432-34862454 GTGTATTTTTGGAGGACAGAGGG + Intronic
1172543832 20:35743453-35743475 CTGAATTTTTAGAGGTTAGCAGG + Intergenic
1174859780 20:54079944-54079966 CTGCCTTAATAGAAGACAGCTGG - Intergenic
1179204155 21:39258260-39258282 CTGTATTTTTAGAGTACAAAAGG + Intronic
1179544080 21:42102875-42102897 CTGTATTACTCCAGCACAGCAGG + Exonic
951068523 3:18296473-18296495 CTGTATTTTTAGAAGAGACCAGG - Intronic
956928093 3:74010995-74011017 CTATATTACTAAAGGACATCAGG + Intergenic
958829233 3:99067576-99067598 CTGTATTATAAAATGACAACAGG + Intergenic
959797559 3:110449856-110449878 ATGTATGATTCTAGGACAGCTGG - Intergenic
960407605 3:117281247-117281269 CTGTATAATTAGAGGACATCAGG + Intergenic
960761137 3:121074865-121074887 ATGTGTGATTGGAGGACAGCAGG - Intronic
961719938 3:128886808-128886830 TTGGCTTATTAGAAGACAGCTGG + Intronic
962945154 3:140162074-140162096 CTGGCTTAATAGAAGACAGCTGG + Intronic
963002614 3:140696446-140696468 CAGTATTATTGGAGGTCACCTGG - Intronic
964265736 3:154893484-154893506 CTGTCTTATTAGAGGGCAGGTGG - Intergenic
964274475 3:154995015-154995037 CTGTTTTATCAGAGGACATGTGG - Intergenic
965417294 3:168412885-168412907 GTGAATTAATAGAAGACAGCTGG - Intergenic
966590024 3:181672524-181672546 CTGGCTTAATAGAAGACAGCTGG - Intergenic
969244701 4:5924840-5924862 GTGCATTATTACAGAACAGCAGG + Intronic
971082639 4:23232114-23232136 CTGGATTTTTTGAGGACAGCTGG + Intergenic
972850235 4:43040123-43040145 ATTGATTATTAGATGACAGCTGG + Intergenic
973670288 4:53210522-53210544 CTGGTTTAATAGAAGACAGCTGG - Intronic
974468847 4:62292983-62293005 CTGGATATTTACAGGACAGCTGG - Intergenic
979772096 4:124539236-124539258 CTGTATTAACAGAGGACAACTGG + Intergenic
980405536 4:132350656-132350678 CTGGCTTAATAGAAGACAGCTGG - Intergenic
981824411 4:148923872-148923894 ATGTCTTATTAGAAGACTGCTGG - Intergenic
993060029 5:83028115-83028137 TTGTATTTTTAGTAGACAGCGGG + Intergenic
993662830 5:90660094-90660116 CTGGCTTAATAGAAGACAGCTGG - Intronic
1001809851 5:174619304-174619326 ATGAATTATGAGAGGAAAGCAGG - Intergenic
1003045138 6:2726978-2727000 CTGTATTATTATCTCACAGCGGG + Intronic
1004317954 6:14607372-14607394 CTGGCTTAATAGAAGACAGCTGG + Intergenic
1007270577 6:40633467-40633489 CTGGTTTATCAGAAGACAGCTGG - Intergenic
1008036491 6:46750462-46750484 CTGACTTAATAGAAGACAGCTGG + Intronic
1009508185 6:64512606-64512628 CTGTGTTATTTGAGGAAAGTGGG + Intronic
1009842728 6:69097018-69097040 CTTTAATGTTAGAGGACATCAGG - Intronic
1010068446 6:71713733-71713755 CTGGCTTAATAGAAGACAGCTGG - Intergenic
1010741180 6:79507182-79507204 CTGGCTTAATAGGGGACAGCTGG - Intronic
1011345300 6:86362829-86362851 ATTTATTATCACAGGACAGCAGG - Intergenic
1012911350 6:105121438-105121460 TTGTATTTTTAGTGGACACCAGG + Intronic
1013677848 6:112486832-112486854 CTATAATATCTGAGGACAGCTGG - Intergenic
1014074990 6:117225420-117225442 TTGTAATATTAGAGGCCAGGAGG - Intergenic
1014355099 6:120398711-120398733 CTGTCTTGTTAGAGGATGGCTGG - Intergenic
1015570471 6:134616274-134616296 CTTTCTTATTACACGACAGCAGG - Intergenic
1016940372 6:149478321-149478343 CTGGGTTAATAGAAGACAGCTGG - Intronic
1018268608 6:162052027-162052049 CTGTGTTATTAGATGAGATCGGG + Intronic
1018343396 6:162876319-162876341 CTGTATTATTAGAGGACAGCAGG - Intronic
1019991144 7:4692196-4692218 CTGGCTTAATAGAAGACAGCTGG + Intronic
1022074622 7:26955172-26955194 CAGCATTATTCGAGGCCAGCCGG + Intronic
1022149312 7:27583973-27583995 CTGGCTTAATAGAAGACAGCTGG + Intronic
1022984915 7:35643100-35643122 CTCTATTATTAGAGGACAGCAGG - Intronic
1023535606 7:41205914-41205936 CTGGATCAATAGAAGACAGCTGG - Intergenic
1026208348 7:68279370-68279392 ATGTAAGATTTGAGGACAGCCGG - Intergenic
1026300731 7:69095816-69095838 CTTTATTATTTGAGGAGATCAGG + Intergenic
1027800519 7:82744360-82744382 CTGGATTATGAGAGGACCTCAGG - Intergenic
1028211115 7:88076208-88076230 TTGTATTTTTAGTGGACAGGGGG + Intronic
1028331748 7:89603617-89603639 ATGTATTATTAGAGTAAGGCAGG - Intergenic
1031839582 7:126721401-126721423 ATGTATTATTATAGTACAGTTGG - Intronic
1034625522 7:152489274-152489296 CTGGCTTAATAGAGGACAGCTGG - Intergenic
1035726516 8:1827672-1827694 TTGTATCATTAGAGTAAAGCAGG + Intronic
1036624691 8:10459075-10459097 CTGGCTTAATAGAAGACAGCTGG + Intergenic
1037088814 8:14886942-14886964 ATGTATTATTAGATTACAGTGGG + Intronic
1037791072 8:21942482-21942504 GTGTCTTATTGGAGTACAGCTGG + Intronic
1039298706 8:36186066-36186088 CTATATCATTAGAGAACAACAGG + Intergenic
1040046170 8:42966009-42966031 CTGTTTTAATAGAAGACAGCTGG - Intronic
1040654545 8:49490986-49491008 TTATATTATTAAATGACAGCTGG - Intergenic
1041015119 8:53585298-53585320 CAGTATTATGAGATGAGAGCAGG - Intergenic
1043115348 8:76245706-76245728 CTGGCTTAATAGATGACAGCTGG + Intergenic
1045237293 8:100364510-100364532 CTGAACTACTAAAGGACAGCTGG - Intronic
1045415123 8:101958475-101958497 CTGTGTTATTAAAGGACTGAGGG + Intronic
1045674471 8:104591575-104591597 CTGGTTTAATAGAAGACAGCTGG + Intronic
1047071668 8:121351847-121351869 CTGGTTTAATAGAAGACAGCTGG + Intergenic
1047376679 8:124305007-124305029 CTGGCTTAATAGAAGACAGCTGG - Intergenic
1047705664 8:127497064-127497086 CTTTATTATTAGAGGAGAGTAGG + Intergenic
1050421378 9:5468801-5468823 TTGTATTATAAAAGGACAGTGGG - Exonic
1050944849 9:11503855-11503877 CTGTGTTTTTACAGAACAGCAGG - Intergenic
1051805173 9:20984593-20984615 CTGGCTTAATAGAAGACAGCTGG + Intronic
1052676464 9:31632230-31632252 CTGACTTATGAGAAGACAGCCGG + Intergenic
1054917878 9:70512395-70512417 CTGTCTTAATAGAAGACAGCTGG - Intergenic
1055226223 9:74000284-74000306 CTGAATTAATAGAAGACAGCAGG + Intergenic
1061625386 9:131838216-131838238 CTGTTTTATTCGTGGACTGCTGG + Intergenic
1185936224 X:4259969-4259991 AATTATTATTATAGGACAGCAGG - Intergenic
1186343916 X:8671196-8671218 CTGTATCATGACAGGACACCTGG - Intronic
1188053605 X:25516037-25516059 CCGCCTTATTAGAAGACAGCTGG - Intergenic
1189485974 X:41432277-41432299 CTGACTTAATAGAAGACAGCTGG + Intergenic
1189897506 X:45671072-45671094 CTGGATTAATAAAAGACAGCTGG + Intergenic
1194647577 X:96476345-96476367 CTGGAATAATAGAAGACAGCTGG + Intergenic
1196364490 X:114908752-114908774 CTGAATTCTTAGAGAGCAGCAGG - Exonic
1198467095 X:136912926-136912948 TTGTATTATTTCAGGACAGTAGG + Intergenic
1198677357 X:139145085-139145107 CTGGGTTAATGGAGGACAGCTGG + Intronic