ID: 1018349751 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:162943878-162943900 |
| Sequence | ACAATCCTCTGGTTTCCAAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 203 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 13, 4: 187} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018349751_1018349754 | 23 | Left | 1018349751 | 6:162943878-162943900 | CCACTTGGAAACCAGAGGATTGT | 0: 1 1: 0 2: 2 3: 13 4: 187 |
||
| Right | 1018349754 | 6:162943924-162943946 | TCACACCACACCTGCCATCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018349751 | Original CRISPR | ACAATCCTCTGGTTTCCAAG TGG (reversed) | Intronic | ||