ID: 1018349751

View in Genome Browser
Species Human (GRCh38)
Location 6:162943878-162943900
Sequence ACAATCCTCTGGTTTCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018349751_1018349754 23 Left 1018349751 6:162943878-162943900 CCACTTGGAAACCAGAGGATTGT 0: 1
1: 0
2: 2
3: 13
4: 187
Right 1018349754 6:162943924-162943946 TCACACCACACCTGCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018349751 Original CRISPR ACAATCCTCTGGTTTCCAAG TGG (reversed) Intronic