ID: 1018351491

View in Genome Browser
Species Human (GRCh38)
Location 6:162964510-162964532
Sequence AGGATATGGCCTATGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018351486_1018351491 1 Left 1018351486 6:162964486-162964508 CCTGAGGGGCAGCATTCCAGAAG 0: 1
1: 1
2: 0
3: 20
4: 166
Right 1018351491 6:162964510-162964532 AGGATATGGCCTATGAAGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018351491 Original CRISPR AGGATATGGCCTATGAAGGC TGG Intronic
901247109 1:7740382-7740404 AGGATTTGGCAAATGATGGCAGG - Intronic
901370560 1:8794099-8794121 AAAAAATGGCCTCTGAAGGCTGG + Intronic
902384299 1:16067660-16067682 AGGAGCTGGCATAGGAAGGCAGG - Intronic
906798198 1:48714131-48714153 AGGTGATGGCCTATGAAGTGAGG - Intronic
907321088 1:53602766-53602788 AGGATGTGGGCTTTGAAGTCTGG - Intronic
908064655 1:60389645-60389667 AGGAAGTGGCATATGAAGGTAGG - Intergenic
912393538 1:109321707-109321729 AGGATTTGGACAAAGAAGGCAGG - Intronic
912978917 1:114353162-114353184 AGGATTGGGCCTAAGAAGTCAGG + Intergenic
913672439 1:121110376-121110398 AGAATAAGTCCTATGAAGGTAGG - Intergenic
914024203 1:143897740-143897762 AGAATAAGTCCTATGAAGGTAGG - Intergenic
914241162 1:145854035-145854057 GGGATATGGATGATGAAGGCTGG + Intronic
914662696 1:149805767-149805789 AGAATAAGTCCTATGAAGGTAGG - Intronic
918265547 1:182838931-182838953 ATGAGATGGCATATGAAGGGCGG - Intergenic
921563760 1:216691012-216691034 AGAAAATGGCAAATGAAGGCAGG - Intronic
921777532 1:219119136-219119158 AGGATATGTTCAATGAAAGCAGG - Intergenic
923346631 1:233059504-233059526 AGAATATGACCTAGGGAGGCTGG + Intronic
1064596649 10:16952371-16952393 AGGATGTGGCCTCCGCAGGCTGG + Exonic
1065909002 10:30285292-30285314 AGGGTTTGGCCACTGAAGGCTGG + Intergenic
1067688343 10:48481290-48481312 AGCATTTGGGCTACGAAGGCTGG + Intronic
1068424958 10:56847854-56847876 AGAATATTGCCTTTGAAGGAAGG - Intergenic
1068915355 10:62425815-62425837 AAGACAAGGTCTATGAAGGCAGG + Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070676736 10:78417111-78417133 AGGGTTTGGCCAATGAAGTCAGG - Intergenic
1070844657 10:79512415-79512437 AGGAAATGGCCTAAAAAGGTGGG + Intergenic
1070929146 10:80247893-80247915 AGGAAATGGCCTAAAAAGGTGGG - Intergenic
1072911885 10:99509478-99509500 AGGACTTGGCCTATCATGGCTGG + Intergenic
1073385235 10:103121767-103121789 ATGATATGGCCTAGAAAGGAGGG + Intronic
1074367635 10:112872222-112872244 AGGAGATGGCCCATGTAGGAGGG - Intergenic
1078068528 11:8093684-8093706 AGGATATGGCCATTGAAGACGGG - Intronic
1080597248 11:33784393-33784415 AGGACATGTCCTATGAAGAGAGG + Intergenic
1081751307 11:45513177-45513199 AGGAAATAGCCCATGAAGGCAGG + Intergenic
1082071182 11:47940982-47941004 AGGATAGGGCTTGTGAATGCTGG - Intergenic
1082828612 11:57598766-57598788 AGGCTAGGGCCTGTGAAGACAGG + Intronic
1083479512 11:62934510-62934532 AGGATCTGGCCTAGGGAGGAGGG + Intergenic
1084419871 11:69054944-69054966 AGGAGACGGCCTGTGATGGCAGG + Intronic
1084937327 11:72594063-72594085 ACCATATGGTCTGTGAAGGCAGG + Intronic
1084988898 11:72904147-72904169 AGAATATGGTCTGGGAAGGCTGG + Intronic
1087751261 11:102010170-102010192 AGGACTTGGGCTGTGAAGGCAGG + Intergenic
1087860914 11:103154573-103154595 AGGAAATGGCCAATGAAGACTGG + Exonic
1089150116 11:116357845-116357867 AGGAGAAGGCCTTGGAAGGCAGG - Intergenic
1089173434 11:116532108-116532130 AGGGTCTGGACTAGGAAGGCTGG + Intergenic
1089624895 11:119745147-119745169 AGGATAAGGGCTATGGAGGGAGG + Intergenic
1090724645 11:129513469-129513491 AGGATATGGTCTATTTTGGCAGG + Intergenic
1092038145 12:5359191-5359213 AGGGAATGGCCTGTGAAGGTAGG + Intergenic
1093652030 12:21657360-21657382 ACCAGGTGGCCTATGAAGGCTGG - Intronic
1101800580 12:108018303-108018325 AAGTTATGGCCAATGAAGGACGG + Intergenic
1102972313 12:117178882-117178904 AGTATAAGCCCCATGAAGGCAGG + Intronic
1103999107 12:124849147-124849169 AGCATATGGACTTTGAAGGCAGG - Intronic
1104268445 12:127260211-127260233 AGGATATGAGGCATGAAGGCGGG - Intergenic
1112103486 13:96215758-96215780 AGGATATGGGCTATGGAGTAAGG + Intronic
1112502371 13:99953027-99953049 AGGATCTGGGCGTTGAAGGCTGG + Intergenic
1115620969 14:35139880-35139902 AGGATCTGGCTTCTGAAGGTAGG - Intronic
1117688575 14:58281202-58281224 ATTATATTGCCTATGAAGGAAGG - Intronic
1118083255 14:62386712-62386734 ATGATATGGACAATGAAGTCTGG + Intergenic
1119696555 14:76718043-76718065 TGGATTTGGCCCATGAAGGCAGG - Intergenic
1123909921 15:24956117-24956139 AGGCTATGGCATAAGAAGACTGG + Intronic
1125361428 15:38868439-38868461 AGGATATTGCCCTTCAAGGCTGG + Intergenic
1130649973 15:85756936-85756958 AAGAAATGTCCTTTGAAGGCAGG + Intergenic
1133495423 16:6312975-6312997 GGGATATGGGCTATGAAGAAAGG + Intronic
1140295610 16:73706741-73706763 AGGAGATGGCTTTTGAAGGATGG - Intergenic
1142104700 16:88296043-88296065 AGGATATTGCCCCTGAAGGGTGG + Intergenic
1143369355 17:6428812-6428834 AGCATATGGCCTCTGGAGCCAGG - Intronic
1149231882 17:54544472-54544494 AGGATCTGGCCTAAACAGGCAGG - Intergenic
1150753143 17:67884710-67884732 AAGAAAATGCCTATGAAGGCTGG - Intronic
1151188979 17:72383869-72383891 AGGATATGGGCTTTGAAGTCAGG + Intergenic
1151364976 17:73611420-73611442 AGGCTATGGCATAGCAAGGCTGG + Intronic
1152977640 18:238280-238302 AGGAGATGCCCACTGAAGGCAGG + Intronic
1152987347 18:332781-332803 AAGATATTGCCTATCAAGCCTGG - Intronic
1153859341 18:9185136-9185158 GGGATGTAGCCTATGAAGGATGG + Intronic
1153925719 18:9833166-9833188 AGAAAATGGCCCAGGAAGGCCGG + Intronic
1158692774 18:59675986-59676008 TGGAGATGGCCTATGAAGGTAGG - Intronic
1159985907 18:74840717-74840739 AGGCTATGGCCTATGTAAACAGG - Intronic
1161869818 19:6861622-6861644 AGGATATAGCCTCTGAAGCCTGG + Intergenic
1164870657 19:31640420-31640442 GGGAAATGGGCTCTGAAGGCAGG + Intergenic
1167005276 19:46772139-46772161 AGAATATGGACTATGCTGGCCGG - Intronic
931014932 2:57965825-57965847 AGGGTATGACCAATGAAGTCTGG - Intronic
936831908 2:116656701-116656723 ATGATATAGCCAATGAAAGCTGG - Intergenic
938810960 2:134852428-134852450 AGAATATTGCCTACGATGGCTGG - Intronic
939949958 2:148458296-148458318 AGAATGTGGCCTATAAAGGCGGG + Exonic
940032860 2:149283352-149283374 AGGATATGGCCTAGGAAAAGTGG + Intergenic
941644683 2:168027235-168027257 AGCATATGGCCCATGGTGGCTGG - Intronic
944953732 2:204783772-204783794 AGGATATGGACCCTGAAGCCAGG - Intronic
945875441 2:215273409-215273431 AGGATTTGGTCTCTGAATGCAGG + Intergenic
1168798516 20:628600-628622 AGGGTAAGCCCCATGAAGGCAGG + Intergenic
1171960302 20:31488634-31488656 AGGATGTGGGCTCTGAAGGAAGG + Intergenic
1172196508 20:33095381-33095403 AGGATTAGGCCTATGCAGGCTGG - Intronic
1172485711 20:35296698-35296720 AGGACATGCCCAAGGAAGGCAGG + Intergenic
1174494250 20:50929126-50929148 AAGATTTGGCCTATGAAGAAGGG + Intronic
1183838932 22:40481455-40481477 AGCATATGTTCTATGAGGGCAGG - Intronic
949596057 3:5548248-5548270 AGGATGTGGCCAATGAAGACAGG - Intergenic
952983558 3:38757801-38757823 TGAAGATGGCCTATGAAGGAAGG + Intronic
953343403 3:42154929-42154951 AGGATATGGGCTAGGGAGGTGGG + Intronic
954437202 3:50502735-50502757 AGGAAAAGGCCCTTGAAGGCAGG + Intronic
954809004 3:53236487-53236509 AGGATAGGGCCTCTGAAGTGTGG - Intronic
955766874 3:62354196-62354218 AGGAGCTGGCTTCTGAAGGCGGG - Intergenic
958722464 3:97861161-97861183 GGGATATGGCTGATGAAGACTGG - Intronic
959146499 3:102552098-102552120 AAGCTATGGTCTATGTAGGCTGG + Intergenic
960362804 3:116734805-116734827 ATGATATGGACAATGAAGTCTGG + Intronic
962649765 3:137476796-137476818 AGCATAAGCCCCATGAAGGCAGG + Intergenic
963719083 3:148839215-148839237 AGGGTATGGCCAAGGAATGCAGG + Intronic
966629713 3:182058997-182059019 AAGGTAAGGCCTATAAAGGCAGG - Intergenic
967788872 3:193526073-193526095 ATGATATGGCCTAGCAAGCCAGG - Intronic
969442679 4:7226647-7226669 GGGAGGTGGCCTATGAAAGCTGG - Intronic
975454550 4:74574959-74574981 AGGATATTGTCTATGAAAACAGG - Intergenic
976692842 4:87886937-87886959 AGGCTATGGCTTTTGCAGGCTGG + Intergenic
980685618 4:136223994-136224016 AGTATGTGCCCAATGAAGGCAGG + Intergenic
984474094 4:180215375-180215397 AGAAAATGGCCCAGGAAGGCTGG - Intergenic
988740760 5:34067141-34067163 AGGATATGGACAATGAATCCAGG - Intronic
989387387 5:40867165-40867187 AGGATAGAGCCTGAGAAGGCAGG - Intergenic
991308610 5:65210150-65210172 TGGATAAGATCTATGAAGGCCGG + Intronic
991346604 5:65675036-65675058 ATGATATGCCCTTGGAAGGCAGG - Intronic
991966334 5:72095105-72095127 AGAGTAAGGCCTATGAAGGGAGG + Intergenic
992632850 5:78698612-78698634 GGGATATGGCCAAGGAATGCTGG + Intronic
993854749 5:93059851-93059873 AGGATAAGCTCAATGAAGGCAGG + Intergenic
999364277 5:151011689-151011711 AGGACATGGAGTATCAAGGCTGG + Intergenic
1000568587 5:162882528-162882550 AGTATATGTTCCATGAAGGCAGG + Intergenic
1001437602 5:171712342-171712364 TGGGCATGGCCTAAGAAGGCAGG - Intergenic
1001576089 5:172764782-172764804 AGGATGAAGGCTATGAAGGCAGG - Intergenic
1002758197 6:180852-180874 AGGACATGGCCAATGATGGGGGG + Intergenic
1003087537 6:3072776-3072798 AGAATATGGCCTAAGAGGGTGGG + Intronic
1003644155 6:7900912-7900934 AGGATTTCCCCTATGAATGCTGG + Intronic
1003795356 6:9596542-9596564 AATTTAAGGCCTATGAAGGCAGG - Intronic
1007694973 6:43726143-43726165 AGGAGGTGGCCCATGAAAGCAGG + Intergenic
1007952625 6:45885860-45885882 TGGAGATGGCCTAAGAAGGATGG + Intergenic
1016354612 6:143204518-143204540 AGGCTAGGGCTTATGAAGCCTGG - Intronic
1018351491 6:162964510-162964532 AGGATATGGCCTATGAAGGCTGG + Intronic
1022316935 7:29254222-29254244 ATGATAAGCTCTATGAAGGCAGG + Intronic
1024259449 7:47563004-47563026 AGGGTATGGCCAGAGAAGGCTGG - Intronic
1024531587 7:50398166-50398188 AGGTTATGGCTGATGATGGCTGG - Intronic
1025024735 7:55506985-55507007 AGGTTATGCCATATTAAGGCTGG - Intronic
1026102483 7:67394557-67394579 TGGATATGCCCTGTGGAGGCAGG + Intergenic
1026738665 7:72964951-72964973 TGGTGATGGCCTATAAAGGCAGG + Intronic
1026789679 7:73323594-73323616 TGGTGATGGCCTATAAAGGCAGG + Intronic
1027105069 7:75400118-75400140 TGGTGATGGCCTATAAAGGCAGG - Intronic
1032489786 7:132315793-132315815 AGAATATGTCCTAGGCAGGCTGG + Intronic
1034541677 7:151762502-151762524 AGGATGGGGGCTAGGAAGGCTGG + Intronic
1037587163 8:20285267-20285289 AGGATATGGCCAGTGAAGGAAGG - Intronic
1039298687 8:36185794-36185816 AGGATCTGGCCTATAAAAACAGG - Intergenic
1041407451 8:57515749-57515771 AGCAAATGGCCTAAAAAGGCGGG + Intergenic
1041808658 8:61883871-61883893 AAGACATGCTCTATGAAGGCAGG + Intergenic
1044500808 8:92953358-92953380 AATATAAGGCATATGAAGGCAGG - Intronic
1044850618 8:96423925-96423947 AGAAAATGGCCTGTGAAGTCAGG + Intergenic
1048327950 8:133453212-133453234 AGGATTTGGCCTGGGAACGCTGG - Intergenic
1051489046 9:17640636-17640658 AGCATATGCCCTCAGAAGGCTGG + Intronic
1055028112 9:71744076-71744098 AGAATATGGCACAAGAAGGCTGG + Intronic
1055196677 9:73602408-73602430 ATTATATAGCCTATAAAGGCAGG - Intergenic
1059093842 9:111391164-111391186 AGGATAGGGCCTATGACTGAGGG - Intronic
1059305456 9:113349939-113349961 AGGGTGTGGCCTCTGAAGTCAGG + Intronic
1061311721 9:129767947-129767969 AAGAGATGGCCTAAGGAGGCCGG + Intergenic
1186048941 X:5568760-5568782 ATGACATGGCCTATCATGGCTGG + Intergenic
1186137528 X:6534685-6534707 AGGACATGGCGGATGAAGTCGGG + Intronic
1186266903 X:7842994-7843016 AGGACATGGCGGATGAAGTCGGG - Intronic
1186298200 X:8170831-8170853 AGGACATGGCGGATGAAGTCGGG + Intronic
1186324596 X:8465241-8465263 AGGACATGGCGGATGAAGTCGGG - Intronic
1187338574 X:18401928-18401950 AGGATAGGGCCTTGGGAGGCTGG - Intergenic
1187809749 X:23162432-23162454 AGGATATGGGTTATGAAGATAGG + Intergenic
1189311045 X:40017820-40017842 AGAATATGGCAGATGTAGGCTGG - Intergenic
1192555422 X:72085205-72085227 AGGGCCTGGGCTATGAAGGCAGG - Intergenic
1193335415 X:80282571-80282593 AGGAAATGGCAGATGAAGGTAGG - Intergenic
1193837801 X:86367058-86367080 AGGATATGAGCTGTGAAGACAGG + Intronic
1194378246 X:93162668-93162690 AGGTCATGGCCCAAGAAGGCTGG - Intergenic
1194980295 X:100433454-100433476 AGGATATGGACTTTGCAGTCTGG - Intergenic
1195141860 X:101968654-101968676 GGGATGTGGCCTCTGAAGTCAGG + Intergenic
1199716806 X:150512517-150512539 ATCAGATGGCCTCTGAAGGCAGG - Exonic
1201438875 Y:13986628-13986650 AGGACATGGCGGATGAAGTCGGG + Intergenic
1201445698 Y:14056080-14056102 AGGACATGGCGGATGAAGTCGGG - Intergenic