ID: 1018352336

View in Genome Browser
Species Human (GRCh38)
Location 6:162973104-162973126
Sequence CAGCATCACTTTACCGTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018352336_1018352339 7 Left 1018352336 6:162973104-162973126 CCTAGTACGGTAAAGTGATGCTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1018352339 6:162973134-162973156 TGATTGCTATGGATTTTGAGTGG No data
1018352336_1018352338 -4 Left 1018352336 6:162973104-162973126 CCTAGTACGGTAAAGTGATGCTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1018352338 6:162973123-162973145 GCTGATGTTGGTGATTGCTATGG 0: 1
1: 0
2: 2
3: 17
4: 221
1018352336_1018352340 8 Left 1018352336 6:162973104-162973126 CCTAGTACGGTAAAGTGATGCTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1018352340 6:162973135-162973157 GATTGCTATGGATTTTGAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018352336 Original CRISPR CAGCATCACTTTACCGTACT AGG (reversed) Intronic
907122935 1:52023477-52023499 CAGCATAACTATACCTTGCTCGG + Exonic
913131571 1:115842480-115842502 CATCTTCACTTTAACGTTCTGGG - Exonic
913437390 1:118861426-118861448 CAGTATCACTTTACTGTCCCAGG - Intergenic
916934133 1:169610227-169610249 CAGGATCATTTTACAGGACTAGG - Intronic
919869118 1:201807202-201807224 CAGCATTTCTTTAGAGTACTTGG - Intronic
1068882765 10:62067468-62067490 CAGCATCAATTTAAGGTAGTGGG - Intronic
1089452090 11:118605933-118605955 CAGCTCCTCTTTACTGTACTGGG - Intergenic
1089708729 11:120299755-120299777 CAGCAGCACTTGACTGGACTTGG - Intronic
1089754039 11:120673396-120673418 CAGCATCACTGCACAGTCCTCGG - Intronic
1094042324 12:26131147-26131169 CAGCATCATTTTATTGTATTAGG + Intronic
1097610903 12:61818635-61818657 CAGCATCACTCTTCCTTACTGGG + Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1112901370 13:104362256-104362278 CAGCATTACTTTACTGGGCTTGG - Intergenic
1113717933 13:112526928-112526950 CAGCATCATCATACCGTCCTGGG + Exonic
1114232575 14:20797387-20797409 CAGCAACACATGACTGTACTTGG + Intergenic
1126882525 15:53114695-53114717 CAGCAGCTCTTTCCCTTACTAGG + Intergenic
1146654704 17:34628475-34628497 CACCATCACTAGACTGTACTGGG - Intronic
1152978038 18:242860-242882 CAGCATCTCTGTACCTTACATGG - Intronic
1168634900 19:57988623-57988645 CAGCATCACATCACGGTACAGGG + Exonic
1168663619 19:58185788-58185810 CAGCATCACTTCCCTGTACAGGG - Intronic
1168666996 19:58211636-58211658 CAGCATCACATCGCGGTACTCGG - Exonic
928251685 2:29686565-29686587 GAGCATCACTTTACCTCTCTGGG - Intronic
929161372 2:38835768-38835790 CAGCATCAGTTTATCGTTTTAGG - Intronic
930861218 2:56075434-56075456 TAGCTTCACTTGACCTTACTTGG - Intergenic
931264921 2:60652199-60652221 CAGCATCACTCCACCACACTCGG + Intergenic
932322957 2:70835306-70835328 GAGCATCAGCTCACCGTACTGGG + Intronic
932588325 2:73045967-73045989 CTGCATCAGTTTACCTCACTTGG - Intronic
934638723 2:96013213-96013235 CAGCATCACTTGCCCATGCTGGG + Intergenic
939449075 2:142349142-142349164 CAGAATCACTTGACCACACTTGG - Intergenic
944098488 2:195995810-195995832 AGGCATCACATTACCTTACTTGG - Intronic
1174852157 20:54006038-54006060 CAGCCTCACTCTACCTTACCAGG + Intronic
1175482054 20:59318684-59318706 CACCAGCACTTTACCGCGCTTGG + Intronic
1175571585 20:60026787-60026809 CAGCATAAATTTACCCTACAGGG - Intronic
1177631930 21:23740279-23740301 CAGCCTCAGTCTACAGTACTAGG + Intergenic
1178796002 21:35745051-35745073 CAGAATCACTTTACCCCTCTAGG + Intronic
1179298899 21:40089321-40089343 CAGCAGCTCTTTCCTGTACTTGG + Intronic
1179489046 21:41728405-41728427 CAGCACCTCCTTCCCGTACTGGG + Intergenic
1181103218 22:20555327-20555349 CAGCATCACTTAACCCTTCTGGG - Intronic
1183640870 22:39091668-39091690 CAGCTTCACTTTGTTGTACTCGG - Intergenic
949123490 3:417322-417344 CAGCATCACTCAGCCGTCCTGGG - Intergenic
953171480 3:40511546-40511568 CAGCATCACTTCCCTGTACAGGG - Exonic
953173589 3:40529395-40529417 CAGCATCACCTCCCCGTACAGGG - Exonic
956723673 3:72139367-72139389 CTGCAACTTTTTACCGTACTGGG + Intergenic
957092181 3:75741767-75741789 CAGCATCACGTTCCTGTACAGGG + Intronic
958148398 3:89657641-89657663 CATCATCACTTCTCCTTACTGGG - Intergenic
966006548 3:175020783-175020805 CAACTACAATTTACCGTACTGGG + Intronic
978441375 4:108737756-108737778 CAGCCTCCCTTAACCATACTCGG - Intergenic
978529732 4:109701822-109701844 CAGCTTCACTTTGCCGACCTTGG - Intronic
989089483 5:37715186-37715208 AAGCAACACTTTCCCTTACTTGG + Intronic
996491894 5:124107752-124107774 CAGCATCACTCTGGCTTACTGGG - Intergenic
997091353 5:130862729-130862751 CAGAATTACTTTACTGTGCTGGG + Intergenic
1004040877 6:11973888-11973910 CAGAATCACTTTATTGTATTTGG - Intergenic
1010859875 6:80897652-80897674 CAGCATGATTTTACGGTAATGGG + Intergenic
1013530555 6:111016111-111016133 CAGCATCTCTTTATTGTTCTTGG + Intronic
1018352336 6:162973104-162973126 CAGCATCACTTTACCGTACTAGG - Intronic
1024752893 7:52489597-52489619 CGGCATCATTTTATTGTACTGGG - Intergenic
1039394830 8:37216677-37216699 ATGCATCACATTACCGTATTAGG + Intergenic
1045474087 8:102538381-102538403 CAGCATCACTTCACTGAACATGG + Intronic
1052486178 9:29102689-29102711 CAACATCACTTTATAGTATTTGG + Intergenic
1189770731 X:44424005-44424027 CAGCAAAACTTTAACATACTTGG + Intergenic
1196624391 X:117861600-117861622 CCTCATCACTTTACCTTTCTGGG - Intergenic
1200654429 Y:5884940-5884962 CAGCATCTCTTTATCTTAATTGG + Intergenic