ID: 1018354963

View in Genome Browser
Species Human (GRCh38)
Location 6:163003656-163003678
Sequence GCTTATCAACAGCTGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018354959_1018354963 -8 Left 1018354959 6:163003641-163003663 CCCAGGAATTTTTTGGCTTATCA 0: 1
1: 0
2: 1
3: 27
4: 225
Right 1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 177
1018354956_1018354963 2 Left 1018354956 6:163003631-163003653 CCATCTTCTCCCCAGGAATTTTT 0: 1
1: 0
2: 5
3: 56
4: 491
Right 1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 177
1018354958_1018354963 -7 Left 1018354958 6:163003640-163003662 CCCCAGGAATTTTTTGGCTTATC 0: 1
1: 0
2: 1
3: 34
4: 234
Right 1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 177
1018354960_1018354963 -9 Left 1018354960 6:163003642-163003664 CCAGGAATTTTTTGGCTTATCAA 0: 1
1: 0
2: 1
3: 20
4: 236
Right 1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 177
1018354955_1018354963 3 Left 1018354955 6:163003630-163003652 CCCATCTTCTCCCCAGGAATTTT 0: 1
1: 0
2: 4
3: 35
4: 275
Right 1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018354963 Original CRISPR GCTTATCAACAGCTGGAGGT AGG Intronic
901791543 1:11655794-11655816 GCTTTTCAACAGCTACAGGAGGG + Exonic
902172219 1:14621196-14621218 GCTAATCAATGGCTGGAGGGTGG + Intronic
902820067 1:18938323-18938345 CCTTCCCAGCAGCTGGAGGTGGG - Intronic
904900969 1:33856715-33856737 GCTGCCCAACAGCTGGAGGATGG + Intronic
907397238 1:54199887-54199909 GCTTATGAGCAGTTGGAGCTTGG - Intronic
907469310 1:54662422-54662444 GCTTCTCAGCAGGTTGAGGTGGG + Intronic
908176523 1:61560905-61560927 GGTTTTCAATAGCTTGAGGTTGG - Intergenic
911205186 1:95085529-95085551 CCTTAGCCACAGCTGGAGTTTGG - Intergenic
915070931 1:153266236-153266258 GGTTACCAGGAGCTGGAGGTGGG - Intergenic
915681385 1:157584998-157585020 TTGTATCAAAAGCTGGAGGTAGG + Intronic
919506931 1:198410610-198410632 GCTTCTCAACAGCTGGGGAAGGG + Intergenic
919975302 1:202606686-202606708 GCTAATCTACAGCTGCATGTGGG - Intronic
920238387 1:204525207-204525229 GATTAACATCAGTTGGAGGTTGG + Intronic
920291701 1:204928018-204928040 GCTTTTCAGCAGGTGGAGGCAGG + Intronic
920806864 1:209242934-209242956 CCTTGTCAACAGCTGGAGCAAGG - Intergenic
922296817 1:224257238-224257260 GCTTATCAACAGATGAAAGGAGG - Intronic
922912695 1:229230749-229230771 GCTTAGCAATAGTAGGAGGTAGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1067399006 10:45953716-45953738 GTCTAGCAACAGCTGGAGTTAGG - Intergenic
1067551528 10:47239837-47239859 GCTTATTAACAGCAGAAAGTAGG - Intergenic
1067867328 10:49922932-49922954 GTCTAGCAACAGCTGGAGTTAGG - Intronic
1068128330 10:52867997-52868019 ACTTATTAACAGGTAGAGGTTGG + Intergenic
1068629696 10:59286567-59286589 GGTTATCAAGAGCTGGTGCTGGG + Intronic
1083525879 11:63364472-63364494 GGTTTTCAGAAGCTGGAGGTAGG - Intronic
1084403339 11:68957158-68957180 TCTTCACAGCAGCTGGAGGTGGG + Intergenic
1088809138 11:113378272-113378294 GCTTATCCATTGCTGGCGGTGGG - Intronic
1089307235 11:117534236-117534258 GATTCTCAGCACCTGGAGGTGGG + Intronic
1091303162 11:134520584-134520606 GCTTGTCAACAGCTGGTTATAGG + Intergenic
1093108002 12:15112420-15112442 GCTCAGTACCAGCTGGAGGTTGG + Intronic
1093255548 12:16862744-16862766 GTTTATTCACAGCTGGAAGTAGG - Intergenic
1094069876 12:26401365-26401387 TCTTATCAAGAGCTCCAGGTTGG - Intronic
1096463781 12:51837186-51837208 GCTTATTCACGGCTGGAGCTGGG - Intergenic
1097321824 12:58234070-58234092 GTATATCAACAGGTGGAGGTGGG - Intergenic
1098317233 12:69205711-69205733 GGTTACCAAGGGCTGGAGGTGGG - Intergenic
1098664085 12:73138201-73138223 GCTTATCAGCGGGTGAAGGTTGG - Intergenic
1100199674 12:92284828-92284850 ATTTATCAACAGCTGGAGCCTGG + Intergenic
1102497274 12:113328463-113328485 GCTCTTCAGCAGCTGGAGGAGGG - Intronic
1105251803 13:18705901-18705923 GCAGCTCAACATCTGGAGGTGGG - Intergenic
1105381335 13:19890276-19890298 GCTACTCAAGAGCTTGAGGTGGG - Intergenic
1105963026 13:25359526-25359548 GCTTCTCAAACGCTGCAGGTGGG - Intergenic
1107074307 13:36305308-36305330 GATTGTCAAGAGGTGGAGGTGGG - Intronic
1107187106 13:37536435-37536457 GATTATAAAGAGCTGGAGGAAGG + Intergenic
1107899405 13:44996995-44997017 GCTTGTCAGGAGCTGGAGGGGGG - Intronic
1108515886 13:51202156-51202178 TCTTATCACCATCTGGGGGTGGG - Intergenic
1110324543 13:74198962-74198984 GCTTAACCAGAGCTGGAGGAAGG + Intergenic
1112714964 13:102173801-102173823 GATTATCAAAAGCTGAGGGTAGG + Intronic
1114160051 14:20155324-20155346 GCTTATCAAAGGATGGAGGATGG - Intergenic
1116428305 14:44817230-44817252 AATTATCAACAGCTAGAGGTGGG + Intergenic
1118698413 14:68408988-68409010 GGTTGCCAAGAGCTGGAGGTGGG + Intronic
1120934754 14:89883878-89883900 GCTACTCAAGAGATGGAGGTGGG + Intronic
1121797673 14:96748620-96748642 GCTTCCCAACAGCTGGAGTCTGG - Intergenic
1122255228 14:100471414-100471436 ACTTACCAAAAGCTGGAGGTGGG - Intronic
1125820098 15:42622477-42622499 GCTAATCAAGAGTCGGAGGTGGG - Intronic
1125926614 15:43568329-43568351 GAATATCATCAGGTGGAGGTAGG - Intronic
1125939758 15:43667894-43667916 GAATATCATCAGGTGGAGGTAGG - Intronic
1126358257 15:47818774-47818796 ACAGATCAACAGCTGGAGTTAGG + Intergenic
1128249422 15:66153978-66154000 GGGTATCAACAGCTGCAGGGGGG + Intronic
1128661294 15:69502905-69502927 GCTTGTCCTCAGCTGAAGGTAGG + Intergenic
1130115469 15:81001594-81001616 GCTTCCCAAGAGCTGGAGGCAGG + Exonic
1130374472 15:83316189-83316211 GGTTTTCAAGAGCTGGGGGTGGG - Intergenic
1130680755 15:85994305-85994327 GGTTACCAACAGCTGGAGAGAGG - Intergenic
1131251880 15:90836421-90836443 TCTTCTGAACAGCTGGAGTTGGG + Intergenic
1131726211 15:95228100-95228122 GCTTAACAGCAGATGGGGGTGGG - Intergenic
1133410427 16:5563847-5563869 GGTTACCAACAGCTAGAGATGGG - Intergenic
1133781537 16:8942657-8942679 GCTGCTCAAGAGCTTGAGGTGGG - Intronic
1134015327 16:10884158-10884180 GCTTCTCAGCAGTTGGAGGCAGG - Intronic
1134510472 16:14842522-14842544 GCTTATCAACAGCACCAGTTGGG - Intronic
1134698113 16:16241010-16241032 GCTTATCAACAGCACCAGTTGGG - Intronic
1134973724 16:18553667-18553689 GCTTATCAACAGCACCAGTTGGG + Intronic
1137245212 16:46697236-46697258 GCTACTCAAGAGGTGGAGGTGGG + Intronic
1138148803 16:54636614-54636636 GCCTTTAAACAGCTGGAGTTGGG + Intergenic
1139515817 16:67451803-67451825 GCACAACCACAGCTGGAGGTTGG - Intronic
1140120854 16:72081954-72081976 GCTCATCAAAAGCTGGAGGGAGG + Intronic
1141756289 16:85993335-85993357 TCTCATCAACAGCTGGATGGTGG + Intergenic
1142994176 17:3751192-3751214 GCTCATGAGGAGCTGGAGGTGGG + Intronic
1146588181 17:34101139-34101161 GCTTATAAACAGCTGGGCGGGGG - Intronic
1146610565 17:34301540-34301562 GCTTATCAATCACTGGATGTGGG - Intergenic
1147384464 17:40073090-40073112 GCTTATCAGCTCCTGGGGGTGGG + Intronic
1151917588 17:77129858-77129880 GGTCATAAACAGCTGGAGGGAGG - Intronic
1152372860 17:79901332-79901354 GCTTATCCTCAGCTGCAGGAGGG - Intergenic
1154320089 18:13342803-13342825 CCTAATCAAAAGCTGTAGGTTGG - Intronic
1155663484 18:28279264-28279286 GGTTACCAGGAGCTGGAGGTTGG - Intergenic
1156501281 18:37560405-37560427 ACTTATCAACATCTGGAATTTGG + Intronic
1162128103 19:8510395-8510417 CCTCAACCACAGCTGGAGGTGGG + Exonic
1163272656 19:16263477-16263499 TCTTAGAAAGAGCTGGAGGTGGG - Intergenic
1163563153 19:18032892-18032914 GCATATTAAAAGCTGGGGGTTGG - Intergenic
1164653998 19:29907356-29907378 GCTGATCAAGAGGTTGAGGTAGG - Intergenic
1166407868 19:42534777-42534799 GATTATCAAGATCTGGGGGTAGG + Intronic
1166620118 19:44290082-44290104 GCTTCTCAAAAACTGGAGCTTGG - Intronic
1167729853 19:51245747-51245769 GTTTATCAACTGCTGTTGGTGGG + Intergenic
1167885862 19:52499456-52499478 ACTTATGGACAGCTGAAGGTGGG - Intronic
931380358 2:61747284-61747306 GCTTATCCAAGGGTGGAGGTGGG + Intergenic
932266928 2:70375844-70375866 GATTACCAAGGGCTGGAGGTTGG - Intergenic
932894841 2:75629862-75629884 ACTTATCAGGAGCTTGAGGTGGG - Intergenic
933493397 2:83017513-83017535 GGTTATCAGCAGCTGCAGGAAGG + Intergenic
938195029 2:129319399-129319421 TCATATCCACAGCTGCAGGTTGG + Intergenic
941033692 2:160542326-160542348 GCTACTCAAGAGATGGAGGTGGG - Intergenic
943397520 2:187358242-187358264 GCTTCTCAAGAGCCTGAGGTGGG + Intronic
945034293 2:205690960-205690982 ACTTAATAACAGCTGGGGGTGGG + Intronic
1175019228 20:55826604-55826626 GCTCATGAACACCAGGAGGTGGG + Intergenic
1175020441 20:55842305-55842327 GGTTACCAAGGGCTGGAGGTGGG + Intergenic
1175688662 20:61049909-61049931 GCAATTCAGCAGCTGGAGGTGGG + Intergenic
1178241571 21:30908140-30908162 GGTTACCAAAGGCTGGAGGTGGG - Intergenic
1179451185 21:41469446-41469468 GCTTCTCATCTGCTTGAGGTGGG - Intronic
1180046806 21:45310347-45310369 GCATGTCCACAGGTGGAGGTGGG + Intergenic
1181683709 22:24514301-24514323 TCTCAGTAACAGCTGGAGGTGGG + Intronic
949526322 3:4908221-4908243 GCTAATGAACAGCTGGAGTCAGG + Intergenic
949625161 3:5857508-5857530 GCCTATCAGAAGGTGGAGGTTGG - Intergenic
949627606 3:5885254-5885276 GGTTATGAACAGCTTGAAGTAGG - Intergenic
950148053 3:10665786-10665808 GCTTATCCCCTGCTGGAGGCGGG - Intronic
950601784 3:14041534-14041556 CCTTATCAAAAGCTGGAAATAGG - Intronic
952199976 3:31116153-31116175 GCCTATCAAAAGTTGGAGGGTGG + Intergenic
954854382 3:53630533-53630555 GCTTATCAGGAGTTGGTGGTTGG - Intronic
955376604 3:58402343-58402365 GCTACTCCACAGCTAGAGGTGGG - Intronic
955644691 3:61124415-61124437 GCTTAACAACGGCTGGTGGTGGG + Intronic
956486286 3:69725255-69725277 GCTTATCAACATCTTGACTTTGG + Intergenic
958857721 3:99406925-99406947 GCCTATCAGAAGGTGGAGGTTGG - Intergenic
959512327 3:107227826-107227848 GCTGATCTACAGCTGGAGCCTGG + Intergenic
961882441 3:130071646-130071668 GCTTATCCACAGATGCAGGACGG + Intergenic
965087277 3:164114652-164114674 GATTATAAACAGTGGGAGGTAGG + Intergenic
966114212 3:176442784-176442806 GCTTATCACAGGGTGGAGGTTGG - Intergenic
966480284 3:180400476-180400498 GCCTATCAAAAGGTGGAGGGTGG - Intergenic
967641778 3:191874159-191874181 CCTCATCTACACCTGGAGGTTGG + Intergenic
967934419 3:194715455-194715477 TCTTATCCAGAGCTGGAGGCTGG - Intergenic
970069415 4:12140118-12140140 GATTATCAGGGGCTGGAGGTGGG + Intergenic
970768254 4:19577567-19577589 GGTGAACCACAGCTGGAGGTGGG - Intergenic
972205574 4:36768269-36768291 GATTAGCAAGAGCTGGAGCTAGG - Intergenic
972305299 4:37824989-37825011 GATTTTCAAGAGCTGGGGGTTGG - Intergenic
974051417 4:56945618-56945640 GCTTCTCAGGAGGTGGAGGTGGG - Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
984852664 4:184167823-184167845 GCATATCAACAGATGGTGCTGGG + Intronic
985020061 4:185679199-185679221 GCTTATCAACAGCAGGGCATTGG - Intronic
985914327 5:2906145-2906167 GCCTCTCAGCAGTTGGAGGTAGG - Intergenic
989196896 5:38725073-38725095 GTTTATCGCCAGCTGGAGGTGGG + Intergenic
990220339 5:53581473-53581495 GTTTATGTACAGCTGGAGATTGG - Intronic
991292264 5:65044612-65044634 GCTTCCCCACAGCTGCAGGTGGG + Intergenic
991985608 5:72283454-72283476 CCTCATCCACAGCTGGAGCTTGG + Intronic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
993589578 5:89778038-89778060 GCTTTTCCACTGCTGGAGTTGGG + Intergenic
993744280 5:91576838-91576860 GCCTATCAAATGGTGGAGGTTGG + Intergenic
999705838 5:154271862-154271884 GCAGAGCAGCAGCTGGAGGTAGG - Intronic
1000249687 5:159482213-159482235 GCTTATTAGCAGGTGGAGGGTGG - Intergenic
1001718608 5:173837787-173837809 GGTTGTCAGCAGCTGGAGGGAGG + Intergenic
1006285538 6:33091512-33091534 ACTTATTTACATCTGGAGGTTGG - Intergenic
1006356579 6:33562601-33562623 GCTACTCAAGAGGTGGAGGTGGG - Intergenic
1008918578 6:56817947-56817969 GGTTATCAAAAGAGGGAGGTGGG + Intronic
1011479796 6:87782671-87782693 GCTTATCAAGTGCTAGAGGTTGG - Intergenic
1012363404 6:98410199-98410221 GCTTATAAACAGCAAGGGGTTGG - Intergenic
1013493395 6:110673104-110673126 GGTTATCAGGAGCTGGGGGTAGG - Intronic
1015872818 6:137794253-137794275 ACTAATCAACACCTGTAGGTTGG + Intergenic
1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG + Intronic
1019523617 7:1471201-1471223 GCTCATCAGCCGCTGCAGGTTGG + Exonic
1020451138 7:8321780-8321802 GCTTAGCATGGGCTGGAGGTAGG - Intergenic
1022878254 7:34558507-34558529 GCCTATCAGAAGGTGGAGGTTGG + Intergenic
1027858519 7:83544690-83544712 GCCTATAAACAGGTAGAGGTGGG + Intronic
1028193876 7:87882240-87882262 TCTTTTCAACAGCTGGTGCTGGG + Intronic
1028455832 7:91036955-91036977 GGTTGTGAACAGCAGGAGGTGGG + Intronic
1032053532 7:128665930-128665952 GCTTCTCAAGAGGTTGAGGTGGG - Intergenic
1033647420 7:143316077-143316099 GTCTATAAATAGCTGGAGGTGGG + Intergenic
1035782486 8:2239508-2239530 ACCTACCACCAGCTGGAGGTTGG - Intergenic
1035809633 8:2480080-2480102 ACCTACCACCAGCTGGAGGTTGG + Intergenic
1035857142 8:2987810-2987832 GCTTGTCAAGAGCAGGAGGTTGG - Intronic
1036692032 8:10950151-10950173 GCTTCCCAACAGGTGGGGGTGGG + Intronic
1042060807 8:64815300-64815322 CCTTATCAAGAGCTTGAGCTGGG + Intergenic
1042906165 8:73774217-73774239 GCTTCAGAACAGCTGGAGGCAGG - Intronic
1045468912 8:102493797-102493819 GCTACTCAACAGATTGAGGTGGG + Intergenic
1046389037 8:113543642-113543664 GCTTATAAACAGCAGATGGTAGG - Intergenic
1046612428 8:116440851-116440873 GATTTTGAACAGCTGGAGGCTGG - Intergenic
1049795833 8:144496927-144496949 GCTTGTCGACAGCTAGAGGCTGG + Exonic
1049940146 9:537660-537682 GATTCTCAACAGGTGGGGGTGGG + Intronic
1050100774 9:2117151-2117173 GCTTAACAACGGCTGGACTTAGG - Intronic
1050813309 9:9777584-9777606 GCTACTCAAGAGCCGGAGGTGGG + Intronic
1051143539 9:14003520-14003542 CCTGATCATCAGGTGGAGGTAGG - Intergenic
1054246186 9:62668429-62668451 GCTTTTCAAAAGCTGGATTTTGG + Intergenic
1054560308 9:66702962-66702984 GCTTTTCAAAAGCTGGATTTTGG + Intergenic
1054809268 9:69421959-69421981 GCTTCTCCCCAGCTGGAGGAAGG + Intergenic
1058180668 9:101794393-101794415 GCTTATGAACACCAGGAGATGGG - Intergenic
1058982666 9:110184603-110184625 ACTTGTGAACAGCAGGAGGTCGG - Intergenic
1059258461 9:112952774-112952796 GCTACTCAAGAGCTTGAGGTGGG + Intergenic
1062133339 9:134912166-134912188 GCAGATCAACAGCTGGAGATGGG + Intronic
1062477148 9:136733949-136733971 GGTTTTCGTCAGCTGGAGGTTGG + Intergenic
1187801064 X:23063406-23063428 GCATATCAACTGCTTAAGGTAGG - Intergenic
1189729973 X:44009625-44009647 GCCTATCAAAGGGTGGAGGTAGG - Intergenic
1190877381 X:54469779-54469801 ACTTCTCAACAGCTGGAGGAGGG - Intronic
1191624326 X:63253312-63253334 GGTTATCAAGAGCTGGGGGAAGG + Intergenic
1194335270 X:92639355-92639377 GCCTATCAAAAAGTGGAGGTTGG + Intergenic
1196125040 X:112088217-112088239 AGTTGTCAACAGCTGGAGGGGGG - Intergenic
1200643739 Y:5756389-5756411 GCCTATCAAAAAGTGGAGGTTGG + Intergenic
1201254180 Y:12090956-12090978 GTTTCTCTATAGCTGGAGGTGGG - Intergenic