ID: 1018360043

View in Genome Browser
Species Human (GRCh38)
Location 6:163058260-163058282
Sequence CCTGCAGCTCTTTGTCCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018360035_1018360043 27 Left 1018360035 6:163058210-163058232 CCTTCTAAGCAGGATTACGTACA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1018360043 6:163058260-163058282 CCTGCAGCTCTTTGTCCGTCAGG 0: 1
1: 0
2: 1
3: 21
4: 176
1018360038_1018360043 0 Left 1018360038 6:163058237-163058259 CCTTGGAACTGCCATCCACAAGC 0: 2
1: 11
2: 17
3: 42
4: 214
Right 1018360043 6:163058260-163058282 CCTGCAGCTCTTTGTCCGTCAGG 0: 1
1: 0
2: 1
3: 21
4: 176
1018360037_1018360043 3 Left 1018360037 6:163058234-163058256 CCACCTTGGAACTGCCATCCACA 0: 1
1: 0
2: 4
3: 19
4: 191
Right 1018360043 6:163058260-163058282 CCTGCAGCTCTTTGTCCGTCAGG 0: 1
1: 0
2: 1
3: 21
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018360043 Original CRISPR CCTGCAGCTCTTTGTCCGTC AGG Intronic
900347847 1:2219197-2219219 CCTGGAGCCCTGTGTCCTTCTGG + Intergenic
903266362 1:22160346-22160368 CCTGCCTCCCTTTGTCCGGCTGG - Intergenic
903879988 1:26501588-26501610 CCTGGAGCTCTTTCTCCATGTGG - Intergenic
904269922 1:29343280-29343302 CCTGCATCTCTTTCTCTCTCTGG + Intergenic
904352770 1:29919739-29919761 CCTGTTCCTCTTTGTCCTTCAGG + Intergenic
906839246 1:49118775-49118797 CCAGCACCTCTTTGTACCTCTGG + Intronic
906895224 1:49763722-49763744 CAGGCAGCTCTGTGTCCATCTGG - Intronic
909165186 1:72213779-72213801 CCAGCTCCTCTTTGTCCCTCTGG - Intronic
910231208 1:84988919-84988941 CCCCCAGCTCTTTGTGTGTCTGG + Intronic
911120336 1:94290069-94290091 CCTGCTCCTCTTTGTACCTCTGG + Intergenic
912474029 1:109924455-109924477 CCTCCAGCTCCCTGCCCGTCTGG - Intronic
914316184 1:146513974-146513996 CCCGCAGCTCTGTGTCTGACTGG - Intergenic
914498171 1:148219387-148219409 CCCGCAGCTCTGTGTCTGACTGG + Intergenic
914879102 1:151534028-151534050 CCAGTAGCTCTTTGTCCAGCCGG - Exonic
916283443 1:163078395-163078417 CCAGCTCCTCTTTGTACGTCTGG - Intergenic
916321258 1:163507124-163507146 ACTGGAGCTCTTTCTCCTTCAGG - Intergenic
916915697 1:169404225-169404247 CCTGCTCCTCTTTGTACCTCTGG - Intronic
916944567 1:169713035-169713057 CCAGCACCTCTTTGTACCTCTGG - Intronic
916973054 1:170044788-170044810 CAGGCAGCTCTTTGTCAGTCAGG - Intronic
917900459 1:179537770-179537792 CCTGCTCCTCTTTGTACCTCTGG + Intronic
918433307 1:184484560-184484582 CCTCCAGCTCCTTGGCCATCTGG - Intronic
918554054 1:185778166-185778188 CCAGCAGCTCTTAGTCAGTGAGG + Intronic
1062814373 10:488920-488942 CCTGCAGGTCTCTCTGCGTCAGG - Intronic
1063018428 10:2101543-2101565 GCTGCTGCTCTCTGTCCGTGGGG + Intergenic
1070843850 10:79506495-79506517 CCTGCAGCTCCTTGTCCTCCCGG - Intergenic
1071962018 10:90816178-90816200 CAAGCAGCTCTTTATCAGTCAGG - Intronic
1073010531 10:100355826-100355848 CCTGCAGCTCTCTGTCCCTCAGG - Intronic
1076380797 10:130023473-130023495 CCTGAAGCTCTTTGACCCTGAGG - Intergenic
1076394611 10:130129621-130129643 CCTGCACCTCTTTGTGTTTCTGG + Intergenic
1078273821 11:9823320-9823342 CCTTCACCTCTTTTTCAGTCAGG - Intronic
1078331161 11:10422689-10422711 CCAGCTCCTCTTTGTCCCTCTGG + Intronic
1078429446 11:11277089-11277111 CCAGCAACTCTTTGTGCCTCTGG + Intronic
1078697252 11:13646925-13646947 CAAGCAGCTCTTTGTCAGTCAGG + Intergenic
1078715357 11:13834315-13834337 CCTGCAGGTCTTTATCATTCTGG + Intergenic
1081683130 11:45022844-45022866 CCTGAAGCTCTTTGGGCGTCTGG - Intergenic
1082871811 11:57950114-57950136 CCTGCTCCTCTTTGTACCTCTGG + Intergenic
1083003358 11:59318045-59318067 CCAGCTCCTCTTTGTACGTCTGG + Intergenic
1083486709 11:62987640-62987662 CCTGCAGCTCTTTCCCCGCCTGG + Intergenic
1084035394 11:66506767-66506789 CCTCCAGATCTTTGCCTGTCTGG + Intronic
1086854594 11:91851053-91851075 CCAGCAGCTCTCTGCCAGTCTGG + Intergenic
1088193422 11:107251077-107251099 CAAGCAGCTCATTGTCAGTCAGG + Intergenic
1092703575 12:11259884-11259906 CCAGCAGCTCTTTGTACCTCTGG - Intergenic
1092706148 12:11287151-11287173 CCAGCAGCTCTTTGTACCTCTGG - Intergenic
1095845570 12:46740537-46740559 CCAGCTCCTCTTTGTACGTCTGG - Intergenic
1096430397 12:51538357-51538379 CCTGCAGCCCTGGGTTCGTCTGG + Intergenic
1097911980 12:64980347-64980369 CCAGCTGCTCTTTGTACTTCTGG + Intergenic
1099367484 12:81786131-81786153 CCAGCAGCTCTTTGTGCTGCAGG + Intergenic
1099880692 12:88463716-88463738 CCAGCTGCTCTTTGTACCTCTGG + Intergenic
1099950062 12:89291975-89291997 CCAGCAACTCCTTGTCCATCTGG - Intergenic
1100328080 12:93559770-93559792 CCAGCTCCTCTTTGTACGTCTGG - Intergenic
1105045378 12:132999073-132999095 CAAGCAGCTCTTTGTCAGTCAGG + Intronic
1107519164 13:41162035-41162057 CAAGCAGCTCTTTGTCAGTCAGG - Intergenic
1110836601 13:80090686-80090708 CCAGCTGCTCTTTGTACATCTGG + Intergenic
1118098512 14:62567685-62567707 CCTGCAGCACTTTATTAGTCAGG + Intergenic
1121459090 14:94060102-94060124 CCTGGAGCAGTTTGCCCGTCTGG - Exonic
1122036998 14:98956264-98956286 CCTGCTGCTCCTTGTGGGTCTGG - Intergenic
1123481146 15:20632638-20632660 CCAGCACCTCTTTGTACCTCTGG - Intergenic
1123636865 15:22367727-22367749 CCAGCACCTCTTTGTACCTCTGG + Intergenic
1126402656 15:48289239-48289261 TCAGCAGCTCTTAGTCCCTCAGG + Intronic
1127055782 15:55129722-55129744 CCTACAGCTCTTTGTTCATATGG + Intergenic
1128258097 15:66212883-66212905 CCTGCAGCTGTTTCTCCCTTTGG - Intronic
1128852180 15:70970562-70970584 CCTGCTCCTCTTTGTACCTCTGG + Intronic
1129817255 15:78565755-78565777 CCTGCTGCTCTTGGTCCAGCTGG + Exonic
1130571968 15:85054397-85054419 CCAGCTCCTCTTTGTACGTCTGG + Intronic
1131034175 15:89210428-89210450 CCTGCAGGTCTTTGTCCACGGGG - Exonic
1132482178 16:172284-172306 CCTGCAGCTCCCTTTCCCTCTGG - Intergenic
1132483026 16:176088-176110 CCTGCAGCTCCCTTTCCCTCTGG - Intergenic
1132716005 16:1290082-1290104 TCTGCAGCTCTGTGTCCAGCAGG - Intergenic
1133227256 16:4347530-4347552 CCTGCCGCTGTTTGTCCATGTGG - Intronic
1133409660 16:5557880-5557902 CCTTCAGCTGTTTGTCGGTGTGG - Intergenic
1133520539 16:6551885-6551907 CCTTCAGCTCAGTGTCCTTCAGG + Intronic
1136227655 16:28869733-28869755 TCTGCATCTCTGTGTCTGTCAGG + Intronic
1136749269 16:32618254-32618276 CCACCAGCTGTTTGTCCTTCAGG + Intergenic
1137412175 16:48238189-48238211 CCTAAAGCTCTTTGTCTGACAGG - Intronic
1137640525 16:50025055-50025077 CCGGCAGTTCTTGGTCCCTCCGG + Exonic
1138260680 16:55618994-55619016 CCAGCTGCTCTTTGTACCTCTGG - Intergenic
1203051403 16_KI270728v1_random:877468-877490 CCACCAGCTGTTTGTCCTTCAGG + Intergenic
1142852746 17:2711988-2712010 CCTGCTGCTCGCTGCCCGTCGGG + Exonic
1144108308 17:12007238-12007260 GCTGCAGCTCTTTTTCTGGCAGG - Intergenic
1146750252 17:35372857-35372879 CTTAGAGCTCTTTGTCCTTCTGG + Intronic
1147401322 17:40181659-40181681 CCTGCAGAAATTTCTCCGTCGGG - Exonic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151751860 17:76043672-76043694 CCTGCAGCTCCTGGGCAGTCAGG + Intronic
1152022871 17:77790268-77790290 CCTGCAGCTTTTTGCACGTCAGG - Intergenic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1156230414 18:35148749-35148771 CCAGCTCCTCTTTGTCCCTCTGG + Intergenic
1161638233 19:5402665-5402687 TCTCCAGCTCTTTCTCCTTCTGG - Intergenic
1164746895 19:30622974-30622996 ACAGCAGCTCTCTGTCCTTCTGG + Intronic
1164766290 19:30774463-30774485 CCAGCAGTTCTTTTTCCTTCTGG + Intergenic
1166104526 19:40590737-40590759 CCATCAGCTCTTGCTCCGTCAGG - Exonic
1166235953 19:41456749-41456771 CAAGCAGCTCTTTGTCGGCCAGG + Intergenic
1166270541 19:41710752-41710774 CCGGCAGCTCCTTGTCCACCAGG + Intronic
1167146157 19:47681642-47681664 CCTGCCCTTCTCTGTCCGTCGGG - Intronic
1167568622 19:50272696-50272718 CCTGCAGCTCCTCCTCCTTCCGG - Exonic
1168643569 19:58045672-58045694 CCTGCAGCTCCTTGACGTTCAGG - Intronic
924987026 2:281396-281418 CCTGCATCTCATCGTCAGTCAGG + Intronic
925640882 2:5985147-5985169 ACTGCAGCACTTTCTCCCTCGGG + Intergenic
926210346 2:10864566-10864588 CCGGGAGCTCTTTGTCTGTGTGG - Intergenic
926934588 2:18074212-18074234 CCTGCAGTTCTTTGCTTGTCAGG - Intronic
934761054 2:96857513-96857535 CCTGCAGCTCCATGCCCCTCAGG + Intronic
935663026 2:105486200-105486222 CCTGCAGCTCTTGGGCCCACAGG - Intergenic
940187933 2:151007478-151007500 CCTCCAGCTGTTAGTCCTTCAGG + Intronic
940256004 2:151729859-151729881 TCTGCATCTCTTTGTCCATTTGG - Intronic
940506358 2:154558999-154559021 CCTGCTCCTCTTTGTACCTCTGG + Intergenic
942611453 2:177746085-177746107 CCAGCAGCTCTATTTCTGTCTGG - Intronic
943153074 2:184138510-184138532 ACTGAAACTCTTTGTCAGTCAGG + Intergenic
943830364 2:192452980-192453002 CCTGGAGCTCTTTGATGGTCAGG - Intergenic
1171349377 20:24491001-24491023 CCTGGAGCTCCTCGTGCGTCTGG + Intronic
1171524780 20:25800132-25800154 ACAGCAGCTCATTGTCCGGCAGG - Intronic
1171552047 20:26055751-26055773 ACAGCAGCTCATTGTCCGGCAGG + Intergenic
1171793163 20:29547044-29547066 ACAGCAGCTCATTGTCCGGCAGG + Intergenic
1171855291 20:30337335-30337357 ACAGCAGCTCATTGTCCGGCAGG - Intergenic
1173487928 20:43455433-43455455 CCTGGAGCTATTTGGCAGTCTGG - Intergenic
1174065519 20:47862013-47862035 CCTGCAGCTCTTTGACCAGCCGG + Intergenic
1174168934 20:48604422-48604444 CCTCCAGGTATTTGTACGTCAGG - Intergenic
1175771079 20:61624742-61624764 CCTGCAGCTCTTTGTAAACCTGG - Intronic
1177723482 21:24937765-24937787 CCATCAGCTCTCTGTCCCTCAGG - Intergenic
1179709792 21:43206696-43206718 GCTGGAGCTCTTTGTCCTACTGG + Intergenic
1181052064 22:20242631-20242653 CCTGCAGCGCGTTGTCCTGCAGG + Exonic
1181452107 22:23030022-23030044 TAAGCAGCTCTTTGTCAGTCAGG - Intergenic
949361254 3:3234293-3234315 CAAGCAGCTCTTTGTCAGTCAGG - Intergenic
950093795 3:10316158-10316180 CCTGCAGATCCTTGTCCGCAGGG + Intronic
956862146 3:73335431-73335453 CCAGCAGCTCTTTGTACCTCTGG + Intergenic
957872196 3:86103553-86103575 CCAGCTGCTCTTTGTACTTCTGG + Intergenic
957992923 3:87650450-87650472 CCAGCTGCTCTTTGTACCTCTGG + Intergenic
959801319 3:110498593-110498615 CCAGCTGCTCTTTGTACGTCTGG - Intergenic
960242527 3:115362128-115362150 CCTGAAGCTCATTGCCAGTCAGG + Intergenic
963481172 3:145876613-145876635 CCAGCTCCTCTTTGTCCCTCTGG + Intergenic
963527914 3:146437354-146437376 CCAGCTCCTCTTTGTACGTCTGG + Intronic
964764168 3:160162484-160162506 CCTCCAGCTCTTTCTCTATCTGG - Intergenic
968567594 4:1322404-1322426 CCTCCACCTCTTTGGCCGTCAGG - Exonic
968666584 4:1825635-1825657 CCTGCAGCTCCTTGACATTCAGG + Exonic
968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG + Exonic
969123538 4:4928159-4928181 CCAGCTCCTCTTTGTACGTCTGG - Intergenic
972196487 4:36659592-36659614 CCAGCTTCTCTTTGTCCCTCTGG - Intergenic
972208337 4:36805074-36805096 CCAGCTCCTCTTTGTCCCTCTGG + Intergenic
972368847 4:38401733-38401755 CCAGCAGTTCTTTGTACGTCTGG + Intergenic
976669834 4:87639830-87639852 CCAGCTGCTCTTTGTACCTCTGG - Intergenic
977568872 4:98609835-98609857 CCTTCAACTCACTGTCCGTCAGG - Intronic
978601080 4:110428767-110428789 CCAGCAACTCTTTGTACCTCTGG + Intronic
979463652 4:121011352-121011374 CCTGCAGCTGTGTGACCTTCAGG + Intergenic
982223243 4:153142367-153142389 CCTGCCACTCTTTGTCTCTCAGG - Intergenic
982384885 4:154789752-154789774 CCTGCACCTCTTTGTACCTCTGG + Intronic
986536850 5:8797018-8797040 CCAGCAGCTCTCTGTCATTCTGG + Intergenic
986838509 5:11669340-11669362 CCTTCCGCTCTTTGTACCTCTGG + Intronic
987687916 5:21228838-21228860 CCAGCTCCTCTTTGTCCCTCTGG - Intergenic
988840464 5:35078621-35078643 CCAGCTCCTCTTTGTACGTCTGG - Intronic
993269185 5:85771459-85771481 CCTGTAGCTCTTTGTCAGACTGG - Intergenic
993546919 5:89223494-89223516 CCAGCACCTCTTTGTACCTCTGG - Intergenic
994897569 5:105725199-105725221 CCAGCCCTTCTTTGTCCGTCTGG - Intergenic
996648971 5:125850207-125850229 CCAGCACCTCTTTGTACCTCTGG + Intergenic
999557119 5:152755509-152755531 CCAGCTGCTCTTTGTACCTCTGG - Intergenic
1002851946 6:1004073-1004095 CCTGCTGCTCTTTGCCCTTCTGG + Intergenic
1005208192 6:23429254-23429276 CCAGCTGCTCTTTGTACCTCTGG + Intergenic
1005280643 6:24270180-24270202 CCAGCAGCTATGTGTCAGTCTGG + Intronic
1005375969 6:25182667-25182689 CCTGCTCCTCTTTGTACCTCTGG + Intergenic
1005397125 6:25394539-25394561 ACTGCAGCTCTTTGTGATTCAGG + Intronic
1006075976 6:31532800-31532822 CCGGAAGCTCTTTGACCTTCTGG - Exonic
1008656199 6:53616712-53616734 CCTGCTGCTCTTTGGCATTCTGG - Intronic
1010396098 6:75393919-75393941 GCTGCAGCTCTTGGTTCTTCAGG + Intronic
1011321423 6:86097792-86097814 CCAGCTGCTCTTTGTACTTCTGG - Intergenic
1013342015 6:109224288-109224310 CCTGCGGCTCTTTGTCAGCATGG - Intergenic
1016237533 6:141886754-141886776 CCTGGAGCTCTTTGATAGTCAGG - Intergenic
1017325268 6:153134812-153134834 CCTTCAGCTCTTAGTGTGTCCGG - Intergenic
1018360043 6:163058260-163058282 CCTGCAGCTCTTTGTCCGTCAGG + Intronic
1018507524 6:164487529-164487551 CCTGCTCCTCTTTGTACCTCTGG + Intergenic
1019210023 6:170397485-170397507 CCTGCAGCTCTGTGTGAATCTGG + Intronic
1019210948 6:170404166-170404188 CGTGCAGCTCTTTCTGCGGCTGG - Intronic
1019926688 7:4197666-4197688 CCTGCAGCTCTTTGCTGGCCTGG + Intronic
1022113283 7:27244101-27244123 CCTGCAGCTCCTTTTCCTTTGGG - Intronic
1024453412 7:49575803-49575825 CCTGCAGCTCTTCTTGCCTCGGG + Intergenic
1027863777 7:83620410-83620432 CCAGCTCCTCTTTGTACGTCTGG - Intronic
1028476129 7:91255302-91255324 CCAGCAACTCTTTGTACCTCTGG + Intergenic
1029006215 7:97212619-97212641 CCAGCTCCTCTTTGTACGTCTGG + Intergenic
1031661984 7:124436743-124436765 CAAGCAGCTGTTTGTCAGTCAGG - Intergenic
1032069383 7:128794487-128794509 CCTCCAGCTCTGTCTCCGTGAGG - Exonic
1033914412 7:146306309-146306331 CCAGCTCCTCTTTGTCCCTCTGG - Intronic
1035711221 8:1716389-1716411 CCTGCTCCTCTTTGTACCTCTGG - Intergenic
1036648475 8:10626445-10626467 CCTGCAGCTCTTGTTCTCTCCGG - Intronic
1037027940 8:14062564-14062586 CCAGCTGCTCTTTGTACATCTGG - Intergenic
1041332289 8:56739906-56739928 CCTGCAGCTCTGGGACCGTCAGG - Intergenic
1042485749 8:69343791-69343813 CCTGGAGCTCTGTGTTCGTGGGG + Intergenic
1042792112 8:72619559-72619581 CCTGCACCTCTTTCTCCTCCTGG + Intronic
1053272465 9:36759744-36759766 CCTGGGGCTCTGTGTCCTTCAGG + Intergenic
1053793118 9:41700624-41700646 ACAGCAGCTCATTGTCCGGCAGG - Intergenic
1054152057 9:61614200-61614222 TCAGCAGCTCATTGTCCGGCAGG + Intergenic
1054181527 9:61912645-61912667 ACAGCAGCTCATTGTCCGGCAGG - Intergenic
1054471831 9:65545344-65545366 ACAGCAGCTCATTGTCCGGCAGG + Intergenic
1057733696 9:97633581-97633603 CCTTCCGCTCTATGTCCTTCCGG - Intergenic
1058012327 9:99992080-99992102 CCAGCTGCTCTTTGTACCTCTGG - Intronic
1060053922 9:120397076-120397098 ACTGCAGCTCTGTGGCCCTCAGG - Intronic
1186526356 X:10252296-10252318 CCAGCTCCTCTTTGTACGTCTGG + Intergenic
1187693795 X:21898031-21898053 CCTGCATCTCTTTGTCTTGCAGG + Intergenic
1192997195 X:76524395-76524417 CCAGCCGCTCTTTGTACCTCTGG + Intergenic
1193470100 X:81890415-81890437 CCTGCAGCTCTTCGTTTTTCAGG - Intergenic
1193510344 X:82391646-82391668 CCAGCTGCTCTTTGTACCTCTGG - Intergenic
1195947763 X:110233395-110233417 CCAGCTCCTCTTTGTACGTCTGG - Intronic
1197490063 X:127105450-127105472 CCTGCTCCTCTTTGTACCTCTGG - Intergenic
1199966953 X:152828536-152828558 CCTGCAGCTCCTCATCAGTCAGG + Exonic