ID: 1018360636

View in Genome Browser
Species Human (GRCh38)
Location 6:163063817-163063839
Sequence CCTCATCCACAGCTGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018360636 Original CRISPR CCTCATCCACAGCTGCAGGA AGG Intronic
900352683 1:2243382-2243404 CTGCACCCACAGCTGCAGAAAGG - Intronic
900676032 1:3886893-3886915 CTTCCTCCTGAGCTGCAGGAGGG - Intergenic
900811309 1:4803356-4803378 CAGCATCCCCAGCTGCAGGCAGG - Intergenic
901203017 1:7477246-7477268 GCCCCTCCCCAGCTGCAGGAGGG - Intronic
902359306 1:15933545-15933567 CCTCATCCACCGGTGCTGGCTGG - Exonic
902375870 1:16029720-16029742 CAGCATCCAGAACTGCAGGAAGG - Exonic
902877111 1:19347404-19347426 TCTCAGCCACAGGTGCAGGATGG - Intronic
903383225 1:22910666-22910688 CCCCATCCCAAGCTGCAGTAAGG - Intronic
903679983 1:25090000-25090022 CATCAGCTCCAGCTGCAGGAGGG + Intergenic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
903998823 1:27325720-27325742 GCTAATCCACATCTGCTGGAAGG - Intronic
904263006 1:29301175-29301197 CCTCACCCAGAGCAGGAGGAGGG + Intronic
904318436 1:29681162-29681184 CTGCACGCACAGCTGCAGGAAGG + Intergenic
904439050 1:30517820-30517842 CTGCACGCACAGCTGCAGGAAGG - Intergenic
904659273 1:32072788-32072810 CTTCACCAGCAGCTGCAGGAAGG + Intronic
904869916 1:33610419-33610441 CCACATCCACAGGTGATGGATGG + Intronic
905338853 1:37264558-37264580 CCTAACCCAGAGCAGCAGGAAGG + Intergenic
905442865 1:38005752-38005774 CCCCATCCCCAGCTGCCAGAGGG + Intergenic
907332698 1:53681613-53681635 CAGCTTCCACAGCTCCAGGATGG + Intronic
907476142 1:54706855-54706877 CCCCATTGACAGCAGCAGGAGGG + Intronic
908153653 1:61329926-61329948 CCTGAGCCACAGTCGCAGGAGGG + Intronic
909631515 1:77773928-77773950 GCTGATCCACATCTGCTGGAAGG + Intergenic
911906160 1:103570598-103570620 GCTAATCCACATCTGCTGGAAGG - Intronic
913164021 1:116168694-116168716 CCTCAACCACAGCTCCAGGAAGG - Intergenic
915494519 1:156272218-156272240 TCTCAGCCACAGCTAGAGGAAGG + Intronic
915535645 1:156533864-156533886 CTCCAGCAACAGCTGCAGGACGG + Exonic
915603568 1:156937361-156937383 CCTCAGCCTCAGCTGCAGGGAGG - Exonic
916084917 1:161261464-161261486 CTGCATTCACAGCTGCAGGCGGG + Intronic
917727651 1:177842617-177842639 CCTCTTGAACACCTGCAGGAAGG - Intergenic
918362192 1:183770940-183770962 CCTCATCCACAGGGGAGGGAGGG - Intronic
919086633 1:192928587-192928609 CCTCATCCAGCGCAACAGGAAGG + Intergenic
920792957 1:209110210-209110232 CATGATCCTCAGCTGCAGTAAGG + Intergenic
922656506 1:227389116-227389138 CCTCATCCACAAAAGCAGGATGG + Intergenic
923217903 1:231866883-231866905 GCTCATCCTCTGCCGCAGGAGGG + Intronic
923540135 1:234882871-234882893 CCCCATCCGCAGGTGCAGGCAGG + Intergenic
924483899 1:244461449-244461471 GCTCAGCCACAGCAGCAGCACGG - Exonic
1063881333 10:10535782-10535804 CCTTATCCACAGGAGCAGAATGG + Intergenic
1064340866 10:14484109-14484131 CCACGTCCCCAGCTGCAGGTGGG + Intergenic
1067349278 10:45461306-45461328 CTTGATCCACTGCTGCAGGCAGG + Exonic
1067542964 10:47169791-47169813 CCTCTCCAACAGCTACAGGATGG + Intergenic
1067811271 10:49428944-49428966 CATCAGCCCCAGCTGCACGAAGG - Intergenic
1069508688 10:69023796-69023818 GCTCATCCATAACTGCTGGAAGG - Intergenic
1070787339 10:79169498-79169520 CCACAGCCACAGCTCCAGAAGGG + Intronic
1071789046 10:88935277-88935299 GCTGATCCACATCTGCTGGAAGG + Exonic
1073576572 10:104631052-104631074 CCACTTCAGCAGCTGCAGGATGG - Intergenic
1073900747 10:108217417-108217439 CCTCACCTACAGGTGCAGGAAGG + Intergenic
1074523239 10:114243558-114243580 CCTCCTCCAAATCAGCAGGATGG - Intronic
1075783772 10:125034177-125034199 CCTGATTCACAGCTGCAGAACGG + Intronic
1076677588 10:132155438-132155460 TCACATCCACAAGTGCAGGAAGG - Intronic
1076835648 10:133019770-133019792 CCTCAGACACAGCTGCATGTTGG + Intergenic
1077068413 11:655531-655553 GATCATCCGCAGCTGCGGGAGGG + Intronic
1077284025 11:1757999-1758021 CCTCATCCAGGGCTGGGGGAGGG - Intronic
1077292187 11:1802943-1802965 GCTGATCCACATCTGCTGGAAGG + Intergenic
1077497089 11:2891616-2891638 CCTCCTCCACTGCAGGAGGAGGG + Intronic
1078432426 11:11298230-11298252 ACTCTGCCACAGCTTCAGGAAGG + Intronic
1079294592 11:19221669-19221691 CCTCAGCAACAGTTGCAGCAGGG + Intergenic
1083417966 11:62537551-62537573 TCTCAACCACAGCTTCAAGAGGG + Intronic
1083488573 11:62998695-62998717 CCTCTTCTTCAGCTGCAGGCAGG + Intronic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1084769341 11:71332409-71332431 CCCCAGCCACAGCGGCAGGTGGG + Intergenic
1085174321 11:74473322-74473344 CCTAATCCACAGTTAGAGGATGG - Intergenic
1087131945 11:94676252-94676274 GCCCAGCCACACCTGCAGGATGG + Intergenic
1087281471 11:96215696-96215718 CCTCCTCCACACCTGCAGCTGGG + Intronic
1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG + Intronic
1089300791 11:117497632-117497654 CCACCTCCACCGCTGCTGGAGGG - Intronic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1090598586 11:128346031-128346053 CATCATCCTCAGCTTCAGTAAGG + Intergenic
1091086641 11:132727567-132727589 CCTCAACCTCAACTGCAGGCTGG + Intronic
1091546772 12:1506318-1506340 CCTCATTCACAGCAGCCAGAAGG + Intergenic
1101764114 12:107682684-107682706 CCAGATCCACAGCTGCAGTTTGG + Intergenic
1102730941 12:115108983-115109005 CCTCATTCTCAGTTGCAGGCTGG + Intergenic
1103450912 12:121028303-121028325 CCCCACCCGCAGCTCCAGGATGG + Intronic
1103976009 12:124703227-124703249 CCTCCTCCCCAGCTCAAGGATGG - Intergenic
1104899563 12:132181667-132181689 CGTCAGCCTCAGCTGCTGGAGGG + Intergenic
1105202551 13:18192551-18192573 CCTCACCAACATCTGCAGAATGG - Intergenic
1105326188 13:19372374-19372396 CATCATCCACAGTCACAGGATGG + Intergenic
1105867319 13:24472694-24472716 CATCATCCACAGTCACAGGATGG - Intronic
1105923099 13:24983308-24983330 CCTGAGCCACACCTGCAGGTTGG + Intergenic
1106735587 13:32585742-32585764 CCCACTCTACAGCTGCAGGAGGG + Intergenic
1107135394 13:36938680-36938702 CTTCATCAACACCTGAAGGAAGG - Intergenic
1107822812 13:44301538-44301560 ACTCAGCCACAGTTGAAGGAGGG + Intergenic
1107996000 13:45861683-45861705 CCTCTTACACAGCTGCAAAAGGG - Intergenic
1110620319 13:77587237-77587259 GCTCATTCACAGCAGCAAGAGGG - Intronic
1111146709 13:84191368-84191390 CCTCCTCCACTGCTGCAGTCTGG + Intergenic
1111195648 13:84871747-84871769 CCTCCTCCACAGCTAAAGGCAGG + Intergenic
1113482903 13:110634704-110634726 CCTCATCCATGGCTACCGGAAGG + Exonic
1113639117 13:111944513-111944535 CCTCATCCACAGTTGCAGGGTGG + Intergenic
1114058738 14:18999919-18999941 GCTGATCCACATCTGCTGGAAGG - Intergenic
1114103806 14:19401835-19401857 GCTGATCCACATCTGCTGGAAGG + Intergenic
1114536671 14:23427296-23427318 CCTTCTCAATAGCTGCAGGAAGG + Exonic
1115360806 14:32499472-32499494 CATCATCCAAAACTGAAGGAGGG - Intronic
1116296442 14:43118063-43118085 CCTGACCCACAGCTGTAGGTGGG - Intergenic
1117456174 14:55899021-55899043 CCTAATCCAGAGGTCCAGGATGG + Intergenic
1117752565 14:58939049-58939071 CCTGCTCCACAGGAGCAGGATGG - Intergenic
1120991842 14:90383878-90383900 CCTTATCCCCTGCGGCAGGAGGG + Intergenic
1121618514 14:95330246-95330268 CCAGCTCCTCAGCTGCAGGAAGG + Intergenic
1121730823 14:96185848-96185870 TCTCCTCCAAAGATGCAGGAAGG + Intergenic
1122066508 14:99177434-99177456 CTTCACCCCCAGGTGCAGGAGGG - Intronic
1123845799 15:24300808-24300830 CCTCAGCCACCCCTGCAGGTGGG + Intergenic
1124338419 15:28874323-28874345 CCACATTCACAGCTACTGGAGGG + Intergenic
1124441157 15:29687467-29687489 ACTCACCCACAGGTGCAGGGTGG - Intergenic
1124958147 15:34373599-34373621 GCTGATCCACATCTGCTGGAAGG + Intergenic
1125007679 15:34836692-34836714 CAACATATACAGCTGCAGGACGG + Intergenic
1125979677 15:43989115-43989137 GCTGATCCACATCTGCTGGACGG + Intronic
1126698185 15:51342805-51342827 CCTCATCCACATGGGCAGGAGGG - Intronic
1127572108 15:60253671-60253693 CCAAATACACTGCTGCAGGAGGG + Intergenic
1128527034 15:68419498-68419520 CCTCATCCACAGGTTCATGAGGG - Intronic
1128681752 15:69657535-69657557 CATCTTCCACAGCTGCCAGATGG + Intergenic
1128682340 15:69661175-69661197 CTTCATCCACAGGAGCAGGAGGG + Intergenic
1128921314 15:71612566-71612588 CTCCATCAACAGCTGCAGCACGG - Intronic
1131530768 15:93189893-93189915 CCTGATTCACAGCTGGAAGATGG + Intergenic
1132534780 16:472771-472793 CCACATCCACAGCTGCTGGGTGG - Intronic
1132579164 16:677299-677321 CCCGATCATCAGCTGCAGGAGGG - Exonic
1133138625 16:3729172-3729194 CCGCTTCCACCGCTGCAGGAGGG + Exonic
1133818117 16:9213609-9213631 ACTGACCCACAGCTGCAAGAGGG - Intergenic
1133895844 16:9928165-9928187 GCTCATTCACACCTGCAGGCAGG + Intronic
1134557174 16:15175329-15175351 CCTCAGGCACAGCTGATGGAGGG + Intergenic
1134917753 16:18087040-18087062 CCTCAGGCACAGCTGGTGGAGGG + Intergenic
1136081048 16:27852849-27852871 CCTCATCCTCACCTGCGGGGAGG - Intronic
1136510609 16:30736328-30736350 CCTCATCCTCAGCCCCAGGCCGG - Exonic
1137643908 16:50058204-50058226 GCTAATCCACATCTGCTGGAAGG + Intergenic
1137723160 16:50639596-50639618 CCTCATCCTCTGCTGCAGCATGG - Exonic
1139352289 16:66344427-66344449 CCTCTGCCAGAGCTGGAGGAAGG - Intergenic
1139590102 16:67928631-67928653 CCTCCTCTGCAGCTGCACGAAGG + Exonic
1139670777 16:68491387-68491409 CCCCATCCTCAGGGGCAGGAGGG + Intergenic
1141432728 16:83979213-83979235 CCTCAACCCCACCTTCAGGAGGG + Intronic
1141640039 16:85335627-85335649 CCACAGCCACTGCTGCAGGGTGG + Intergenic
1141765875 16:86059831-86059853 CCTCAGCTAACGCTGCAGGAAGG - Intergenic
1141998723 16:87651324-87651346 CTTGATCCACAGCTGCATGCTGG - Intronic
1144688478 17:17242815-17242837 GCTGATCCACATCTGCTGGAAGG - Intergenic
1144713287 17:17417181-17417203 CCTACTCCCCAGGTGCAGGAAGG + Intergenic
1145292909 17:21563934-21563956 CCCTATCCACAGCTCCAGGGTGG - Intronic
1146122117 17:30204850-30204872 CCACATCCAAAGCTGCACGTGGG + Intronic
1146263263 17:31435313-31435335 CCTGATACAGAGCTTCAGGATGG - Intronic
1146457179 17:33017260-33017282 CCTCCAGCCCAGCTGCAGGAGGG + Intronic
1147213545 17:38886198-38886220 CCTCATCTTCAGCTCCAGGCAGG - Intronic
1147327588 17:39676990-39677012 CCACCTCCACAGCTCCAGGCTGG + Intronic
1147443567 17:40461857-40461879 CCTCACACACAGCCACAGGAGGG - Intergenic
1148721146 17:49754211-49754233 CCTGCCCCACAGCTGCAGGCTGG - Intronic
1148794771 17:50191712-50191734 CGCCATCCCCTGCTGCAGGAGGG + Intronic
1149518323 17:57298217-57298239 CCTGATCCACGGTTGCAGAATGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1150961795 17:69921506-69921528 CAGCTTCCACACCTGCAGGAAGG - Intergenic
1151939397 17:77283022-77283044 CCTCCTGCACAGATGCCGGAAGG + Intronic
1152117728 17:78398980-78399002 CCTCACCCCCAGCTCCATGAGGG - Intronic
1152372860 17:79901332-79901354 GCTTATCCTCAGCTGCAGGAGGG - Intergenic
1152653837 17:81510744-81510766 GCTAATCCACATCTGCTGGAAGG + Exonic
1152819573 17:82429916-82429938 CCTCATCCCCAGCTGCCTGCTGG + Intronic
1153424381 18:4945920-4945942 CTTTATCCACACCTGCAGCAAGG + Intergenic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1153580597 18:6569835-6569857 CCTAATCTGCAGTTGCAGGAAGG + Intronic
1156629055 18:38944622-38944644 CCCCCTCCACAGCTGCTGGCTGG + Intergenic
1156957608 18:42987434-42987456 ACTCATCTACAGCTGTATGAGGG + Intronic
1157118240 18:44882641-44882663 CCTCAGCAACAGCTGGGGGAAGG - Intronic
1157452886 18:47801321-47801343 CCTCAACCACAGCTCCAGGCTGG - Intergenic
1157543611 18:48531613-48531635 CCTCATCCTCATCTTCAGCAGGG - Intergenic
1158484622 18:57854896-57854918 TATCAACCACACCTGCAGGATGG - Intergenic
1159291768 18:66432594-66432616 CCTCAACCTCAGCTGGAAGATGG - Intergenic
1160298835 18:77660528-77660550 GCTCAGCCACTGCTGGAGGATGG - Intergenic
1160437003 18:78859344-78859366 CCCCACCCTCATCTGCAGGACGG - Intergenic
1160730064 19:637832-637854 GCCCATCCACAGAGGCAGGAAGG + Intergenic
1160805185 19:989519-989541 CCTCGTCCCCACCTGCATGATGG - Intronic
1161096898 19:2397267-2397289 CCTCATGCACAGCTGGGGGAAGG + Intronic
1161455349 19:4367081-4367103 TCGCATCCACAGCTGGAGGCAGG + Intronic
1161534113 19:4808336-4808358 GCTCATCCACAGAAACAGGAAGG + Intergenic
1161554030 19:4930456-4930478 CTTCAGCCACAGCTGCTGGGAGG - Intronic
1162011687 19:7820177-7820199 CCTCACTCACAGCTGGAGGTTGG + Intergenic
1162128103 19:8510395-8510417 CCTCAACCACAGCTGGAGGTGGG + Exonic
1162259289 19:9519260-9519282 GCTGATCCACATCTGCTGGAAGG - Intergenic
1163443431 19:17333287-17333309 CACCATCCTCAGCTCCAGGATGG - Intronic
1164180774 19:22816565-22816587 TCACAATCACAGCTGCAGGAAGG - Intergenic
1165097292 19:33416596-33416618 CCTCCTCCCCAGCAGCAGGGAGG + Intronic
1167116630 19:47492576-47492598 CCTCATCCACAGTGGGAGGGAGG - Intronic
1167551997 19:50167732-50167754 TCTCATGCACAGCTGTGGGAGGG + Intergenic
1167719860 19:51171951-51171973 CCACATCCAAGGATGCAGGAAGG + Intergenic
1168125460 19:54280185-54280207 CCCCATCCCCAGCTGCACGGAGG + Intronic
1168169019 19:54574168-54574190 CCCCATCCCCAGCTGCACGGGGG - Intronic
1168171794 19:54594533-54594555 CCCCATCCCCAGCTGCACGGGGG - Intronic
924963551 2:56695-56717 TCACACCCACCGCTGCAGGAAGG + Intergenic
927000984 2:18793914-18793936 CCTCATCTACCACTGCAGGAAGG + Intergenic
927245773 2:20956144-20956166 CCTCATTCATAGCTGCTGAATGG + Intergenic
928235064 2:29532052-29532074 CCTCATCCACGGACTCAGGATGG + Exonic
928949980 2:36805851-36805873 GCTCCTCCACAGCTGCTGGTGGG - Intronic
929555929 2:42925652-42925674 CCTCACCCTCACCAGCAGGAGGG + Intergenic
931872925 2:66481106-66481128 CCTGATCCCCTGCAGCAGGAGGG + Intronic
932054894 2:68433552-68433574 CCTCATCCACTGCTGCTACAGGG - Intergenic
932335217 2:70927277-70927299 CCTCCAGCCCAGCTGCAGGAGGG - Intronic
932691764 2:73919499-73919521 GCTGATCCACATCTGCTGGAAGG - Exonic
934646799 2:96063655-96063677 CAACATTCACAGCTGCAGGATGG - Intergenic
934840201 2:97619737-97619759 CAACATTCACAGCTGCAGGATGG - Intergenic
934911159 2:98255592-98255614 GCTCACCCACAGCTGCTGGCTGG - Intronic
938016201 2:127869342-127869364 CCTCATTCTCAGCTGCAGTTGGG + Intronic
938123046 2:128647042-128647064 CCTCATCCCCACCTGCTGTAGGG - Intergenic
938195029 2:129319399-129319421 TCATATCCACAGCTGCAGGTTGG + Intergenic
938282457 2:130074298-130074320 GCTGATCCACATCTGCTGGAAGG + Exonic
938333086 2:130462870-130462892 GCTGATCCACATCTGCTGGAAGG + Exonic
938356725 2:130657801-130657823 GCTGATCCACATCTGCTGGAAGG - Exonic
938433161 2:131264607-131264629 GCTGATCCACATCTGCTGGAAGG - Exonic
938477207 2:131627190-131627212 GCTGATCCACATCTGCTGGAAGG - Intergenic
939533448 2:143393983-143394005 CCTAAACCACAGAAGCAGGATGG - Intronic
940508004 2:154580208-154580230 CCTTATCCACTGCTGCAGAAGGG + Intergenic
941376918 2:164742518-164742540 GGCCATCCACAGCTGCAGGTGGG + Intronic
942453517 2:176122909-176122931 CATCAGCCACACCTGCAGGCCGG - Exonic
942504446 2:176626820-176626842 GCTGATCCACATCTGCTGGAAGG + Intergenic
943905817 2:193500454-193500476 CTTGATCCATAGCTGCAGAATGG - Intergenic
944399554 2:199309545-199309567 CAACAGCCACACCTGCAGGAAGG + Intronic
944757696 2:202781007-202781029 ACTCTTCAACAGCTGCATGAAGG - Intronic
945163747 2:206920457-206920479 CCTCATCCTCAGCTGAGGTAGGG - Intergenic
948460352 2:238127351-238127373 GCTCCTCCCCTGCTGCAGGAGGG + Intronic
948708010 2:239807141-239807163 CCGCTCCCACTGCTGCAGGATGG + Intergenic
948831511 2:240600614-240600636 CCACAGCCACTGCTGCTGGAGGG - Intronic
1168874518 20:1161622-1161644 GCTAATCCACATCTGCTGGAAGG - Intronic
1168920773 20:1533816-1533838 CCTCATCCCCAGCTGGAGCTTGG - Intergenic
1170027461 20:11905589-11905611 CCTCACCCACACCTGAATGATGG - Intronic
1171492141 20:25527752-25527774 TCTCGTCCACTGCTGGAGGAAGG + Intronic
1172441787 20:34971314-34971336 CCTCAGCCACAGCAAGAGGAGGG - Intergenic
1175881915 20:62264268-62264290 CCACATGCTGAGCTGCAGGAGGG + Intronic
1175922850 20:62458199-62458221 CCTCCTCCACAGCAGCAGGAGGG - Intergenic
1175966698 20:62663373-62663395 CATCACCCCCACCTGCAGGAGGG - Intronic
1175972657 20:62694573-62694595 GCTCCTGCACAGCTTCAGGATGG - Intergenic
1176715401 21:10345460-10345482 CCTCACCAACATCTGCAGAATGG + Intergenic
1177887780 21:26766564-26766586 CCACTTCCACGGCTCCAGGATGG - Intergenic
1178940690 21:36902540-36902562 CCTGCTCCACAGCTGCAGGGAGG + Intronic
1179881326 21:44294383-44294405 CCTCATCCTCTGCTGCAGGACGG + Exonic
1180477223 22:15722538-15722560 GCTGATCCACATCTGCTGGAAGG - Intergenic
1180602950 22:17034492-17034514 CCTCACCAACATCTGCAGAATGG - Intergenic
1181324266 22:22032666-22032688 CCTCACCCTGAGCTGCTGGAGGG + Intergenic
1181433942 22:22899542-22899564 CCTCCTTCACAGCTGCAGTGGGG + Intergenic
1181434878 22:22904911-22904933 CCTCCTTCACAGCTGCAGTGGGG + Intergenic
1181765071 22:25085530-25085552 CCTCCTACAGAGCCGCAGGACGG - Intronic
1181839554 22:25644925-25644947 GCTCATCCAGAGCTGCACCAAGG + Intronic
1182524507 22:30907008-30907030 TCCCATCCACAGATGCAGGAGGG + Exonic
1182688190 22:32136910-32136932 CCTGCACCACAGCTGCAGGTGGG - Intergenic
1183275377 22:36893368-36893390 TCTCATACACAGTTGCTGGATGG - Intergenic
1183322244 22:37172267-37172289 CCCCAACCAAACCTGCAGGAAGG + Intronic
1183747006 22:39697852-39697874 CCTCATTCGCAGAAGCAGGAAGG - Intergenic
1183828163 22:40404546-40404568 CCGCATCCACAGCTGAGGGAAGG - Exonic
1183910292 22:41074215-41074237 GCTGATCCACATCTGCTGGAAGG + Intergenic
1183989464 22:41588686-41588708 CCGGATCCACCCCTGCAGGAAGG + Intronic
1184100151 22:42337833-42337855 CCTCTTCCACAGCTGCATTTAGG - Intronic
1184555431 22:45230154-45230176 CCTCAGCCACAGCTGGCTGAGGG + Intronic
1184893102 22:47391481-47391503 CTGCATCCACCCCTGCAGGACGG + Intergenic
949948438 3:9208688-9208710 ACTCATCCAATGCTTCAGGAAGG + Intronic
950001784 3:9662303-9662325 CCTCATCCACCGCAGCAAGATGG + Exonic
950090090 3:10289132-10289154 CCTGAACCACAGCCACAGGAAGG + Intronic
950138625 3:10600438-10600460 CCTCACCCTCAGCTCCAGGCTGG - Intronic
950409685 3:12827429-12827451 CCCCATCTCCACCTGCAGGAGGG - Exonic
953968882 3:47331925-47331947 CCATATCCACAGTAGCAGGAGGG + Intronic
954385657 3:50242522-50242544 CCTCAGCTACAGGTGCAGGGTGG + Intronic
954424834 3:50437855-50437877 CCTCAACCACCACAGCAGGATGG + Intronic
954759388 3:52863000-52863022 CCTCTCCCAGAGCTGCTGGAGGG + Intronic
956865353 3:73363709-73363731 CCTCATGGAAAGCTGGAGGAAGG + Intergenic
957050124 3:75405209-75405231 GCTTATCCACAGATGCGGGACGG + Intergenic
957154409 3:76529366-76529388 ACTTAACCACAGCTGCAGGCAGG - Intronic
959017505 3:101152436-101152458 GCTCTTCCACAGCTTCTGGAGGG - Intergenic
959979877 3:112504122-112504144 CTTCACCCACTGCTGCAGCAGGG - Intergenic
960070647 3:113426242-113426264 CTTCTTCCACAGCTGGAGCAGGG + Exonic
960735981 3:120781251-120781273 GCACAGCCACAGCTGCCGGACGG - Exonic
960943136 3:122947476-122947498 CCCCACCCACTCCTGCAGGATGG + Intronic
961002555 3:123383759-123383781 CCACATCCACACATGCAGGCAGG + Intronic
961415498 3:126753704-126753726 CTTCACCCACTGCTGCAGAAAGG - Intronic
961551605 3:127673040-127673062 CCTGTTCGCCAGCTGCAGGAAGG + Exonic
961571003 3:127798779-127798801 CATCCTCCTCACCTGCAGGAAGG + Intronic
961612747 3:128153549-128153571 CCACATCGACAGCGGCAAGACGG + Exonic
961882441 3:130071646-130071668 GCTTATCCACAGATGCAGGACGG + Intergenic
962393155 3:134991275-134991297 CCTCCTCCACAGTTACAGAAAGG - Intronic
962871273 3:139494868-139494890 GCTAATCCACATCTGCTGGAAGG - Intergenic
963271078 3:143286369-143286391 CCTTCTCCAAATCTGCAGGAAGG - Intronic
966079036 3:175977547-175977569 GCTGATCCACATCTGCTGGAAGG + Intergenic
967303382 3:188038358-188038380 CCTCTGCCACACCTGCTGGATGG - Intergenic
967641778 3:191874159-191874181 CCTCATCTACACCTGGAGGTTGG + Intergenic
968180625 3:196592496-196592518 CCTCAGCAACAGCCCCAGGAAGG - Intergenic
968456112 4:700857-700879 CCACAGCCAGAGCTCCAGGATGG - Intergenic
968836523 4:2968933-2968955 CCTTAGCCACGGATGCAGGAAGG - Intronic
969136472 4:5033253-5033275 CGGCGTCCACAGCTGCAGCACGG + Intergenic
969718994 4:8882735-8882757 GCTCCTCCAGAGCTGCTGGAAGG + Intergenic
974050602 4:56938180-56938202 ACTCATCCTCAGCTTCATGAAGG + Intergenic
974683639 4:65195722-65195744 CCTCACCCACTGCTGCTGCAGGG - Intergenic
977066013 4:92316345-92316367 CTTCATCCACAGATGTAAGAGGG + Intronic
977173624 4:93792907-93792929 CCACATCCACTGCTCCAGGTAGG + Intergenic
978275978 4:106950445-106950467 CCTTTTCCACAGGTGCAGTAGGG - Intronic
981529336 4:145736519-145736541 CCTGCTCCACAGCTGATGGACGG - Intronic
981578373 4:146228265-146228287 CCTCCTCTGCAGCTCCAGGAAGG - Exonic
981693922 4:147540146-147540168 CCTTATGCACAGCCTCAGGAGGG - Intronic
985278298 4:188260471-188260493 TCTCCTACACTGCTGCAGGAGGG - Intergenic
985680312 5:1252700-1252722 CCGGATCCACGGCTGCAGGTGGG + Intergenic
985732596 5:1557629-1557651 TCTCATCCACAGCTGGACGCAGG - Intergenic
985886692 5:2685724-2685746 ACTCATTCAAAGCTGCAGGAGGG - Intergenic
986456908 5:7928646-7928668 CTTCATCCACAGCTGTGAGAGGG - Intergenic
986978080 5:13415602-13415624 CCACATCTGGAGCTGCAGGAAGG - Intergenic
987147606 5:15007620-15007642 AATCATCCACAGTTGCAGAAAGG - Intergenic
987188778 5:15451751-15451773 GCTAATCCACATCTGCTGGAAGG - Intergenic
990435437 5:55785751-55785773 CCTCATCCTCAGGTGGAGGAGGG - Exonic
991294723 5:65068588-65068610 CCTCATTGACAGCTGTAGGCAGG + Intergenic
991985608 5:72283454-72283476 CCTCATCCACAGCTGGAGCTTGG + Intronic
992543390 5:77785933-77785955 GCTGATCCACATCTGCTGGAAGG - Intronic
992707934 5:79416682-79416704 CCTCAGCCACAGCTACATTAGGG - Intronic
992801443 5:80299732-80299754 GCTGATCCACATCTGCTGGAAGG + Intergenic
994316567 5:98339760-98339782 GCTGATCCACATCTGCTGGAAGG - Intergenic
996045734 5:118871498-118871520 CTTGATCCACGGCTGCAGAAAGG + Intronic
997286362 5:132681549-132681571 ACTGACCCACAGCTGCAGGGTGG + Intronic
998139645 5:139692715-139692737 CCTTATCCCCACCTCCAGGAAGG - Intergenic
998522043 5:142809965-142809987 TCTTATCCACAGCTGTAGAAAGG - Intronic
999671740 5:153964592-153964614 CCTCATCCACAGCTGGGCAAGGG + Intergenic
1001523589 5:172413169-172413191 CATCATGCGCAGCTGCAGGCTGG + Intronic
1003923444 6:10855459-10855481 TCTGATCCACAGCTGCAGTTTGG - Intronic
1004152681 6:13135169-13135191 CCTGATTCACAGCTGGAAGATGG - Intronic
1006066676 6:31467209-31467231 CCTTACCCACAACTGCAGGCAGG + Intergenic
1006368810 6:33632214-33632236 TCTCATCCACAGCTGAATGGGGG + Intronic
1007391672 6:41553007-41553029 CCCAACCCACAGCTTCAGGATGG - Intronic
1007684965 6:43660920-43660942 CTTGATCCATGGCTGCAGGATGG + Intronic
1007985835 6:46206025-46206047 GCTAATCCACATCTGCTGGAAGG - Intergenic
1011526929 6:88275936-88275958 GCTGATCCACATCTGCTGGAAGG + Intergenic
1012831554 6:104209900-104209922 CCTGAACCACAGCCTCAGGAAGG + Intergenic
1016046207 6:139483332-139483354 CCTCAGCAAAAGCTACAGGATGG + Intergenic
1018360636 6:163063817-163063839 CCTCATCCACAGCTGCAGGAAGG + Intronic
1018714963 6:166525038-166525060 TCTCATCCTCAGCTGCAAGCTGG - Intronic
1019463337 7:1172914-1172936 CCTCACCCACAGCACCAGGCTGG + Intergenic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1019720816 7:2569489-2569511 CCTCACCCTCAGCAGGAGGAGGG + Intronic
1019727327 7:2610373-2610395 CCTCATCTCCAGCTGCAGCTCGG + Exonic
1020008097 7:4792847-4792869 CCACACCCACTGCTGCAGGCGGG - Intronic
1020124842 7:5527802-5527824 GCTGATCCACATCTGCTGGAAGG + Exonic
1023581999 7:41693291-41693313 TCTCATCCACACCTGCCAGAAGG + Intronic
1024461969 7:49668622-49668644 CCTAAGCCACAGCTCCAGGCTGG + Intergenic
1026317241 7:69237855-69237877 GCTCATGCACAGCATCAGGATGG - Intergenic
1027552131 7:79612282-79612304 ACTGATCCACAGATGCAAGAGGG + Intergenic
1027888780 7:83943852-83943874 TTTCAGCCACAGCTGCAGAACGG + Intergenic
1028414314 7:90563972-90563994 CCTCATCCACAGAAGAATGATGG - Intronic
1029332124 7:99867189-99867211 TTTTATCCACAGCTGCAGAATGG + Intergenic
1029421576 7:100474583-100474605 CCTTCTCCAGAGCTGGAGGAGGG - Intronic
1032492435 7:132333569-132333591 CCTGCTCCTCAGCTGCTGGAGGG + Intronic
1033463883 7:141573018-141573040 CTTCATCCACAGCTGAAGGTAGG + Intronic
1034292494 7:149944157-149944179 CCTGATCCACAGCTAGAGGATGG - Intergenic
1034306658 7:150049107-150049129 CCTCCTGCCCAGCCGCAGGAAGG + Intergenic
1034329125 7:150267835-150267857 CCTCAGCCCCTGCTCCAGGAAGG - Intronic
1034668931 7:152842025-152842047 CCTCAGCCCCTGCTCCAGGAAGG + Intronic
1034800187 7:154051536-154051558 CCTCCTGCCCAGCCGCAGGAAGG - Intronic
1034813573 7:154152735-154152757 CCTGATCCACAGCTAGAGGATGG + Intronic
1034819075 7:154200013-154200035 CCTCAACCCCAGCTGCACAATGG + Intronic
1036656964 8:10683065-10683087 ACTCATCCAGGGGTGCAGGAAGG + Intronic
1036663382 8:10722633-10722655 TCTCATCCACAGCCCCAGGTGGG - Intergenic
1037906390 8:22718278-22718300 CCCCAACCCCAGCTGCAGAAGGG - Intronic
1039460031 8:37736404-37736426 CCTCATCCCCAGCCCCAGGACGG + Exonic
1041381827 8:57259859-57259881 TCTGTTCCGCAGCTGCAGGAGGG + Intergenic
1042343079 8:67700648-67700670 CCTCAACCAAAGTTGCTGGAAGG - Intronic
1043889750 8:85642797-85642819 CCACATCACCAGCTGCAGGCAGG + Intergenic
1043891286 8:85654705-85654727 CCACATCACCAGCTGCAGGCAGG + Intergenic
1043892360 8:85661542-85661564 CCACATCACCAGCTGCAGGCAGG + Intergenic
1043893197 8:85715793-85715815 CCACATCACCAGCTGCAGGCAGG - Intergenic
1043895884 8:85737247-85737269 CCACATCACCAGCTGCAGGCAGG - Intergenic
1043896795 8:85744561-85744583 CCACATCACCAGCTGCAGGCAGG + Intergenic
1043898674 8:85759449-85759471 CCCCATCAACAAGTGCAGGAAGG - Intergenic
1043899118 8:85762927-85762949 CCACATCACCAGCTGCAGGCAGG + Intergenic
1043900729 8:85775122-85775144 CCACATCACCAGCTGCAGGCAGG + Intergenic
1043902249 8:85786918-85786940 CCCCATCAACAAGTGCAGGAAGG - Intergenic
1043902693 8:85790397-85790419 CCACATCACCAGCTGCAGGCAGG + Intergenic
1043904303 8:85802590-85802612 CCACATCACCAGCTGCAGGCAGG + Intergenic
1043905915 8:85814784-85814806 CCACATCACCAGCTGCAGGCAGG + Intergenic
1043907079 8:85823492-85823514 CCCCATCAACAAGTGCAGGAAGG - Intergenic
1043907523 8:85826971-85826993 CCACATCACCAGCTGCAGGCAGG + Intergenic
1044669506 8:94664685-94664707 CTTCATCCACAGCAGCAAGATGG + Exonic
1046583202 8:116119217-116119239 CCTCAGACACAGCTGCTGGGAGG - Intergenic
1048878525 8:138855343-138855365 CCTCATCCAAAGTCACAGGACGG + Intronic
1049064783 8:140304534-140304556 CCTCATCTCCACCTGAAGGAAGG - Intronic
1049220333 8:141426029-141426051 CCCCTTCCACAGCAGCGGGAGGG + Intronic
1049300578 8:141867377-141867399 CATCATCAACAGAGGCAGGACGG - Intergenic
1049378420 8:142300480-142300502 CCTCACCTCCATCTGCAGGATGG + Exonic
1050561185 9:6835502-6835524 GCTGATCCACATCTGCTGGAAGG - Intronic
1051061721 9:13053075-13053097 CCTCCTGCATAGCTTCAGGAGGG - Intergenic
1051798603 9:20905216-20905238 CTTCAACCACAGCTGAAGGTGGG - Intronic
1055130258 9:72766664-72766686 CCTCATTCACAGCTGCTTGAGGG + Intronic
1055493020 9:76825513-76825535 CCCCATCCCCAGGGGCAGGAGGG - Intronic
1056663277 9:88560199-88560221 CCACATCCAGAGGTCCAGGAAGG - Intronic
1057104485 9:92399163-92399185 ACTCATACACGGCAGCAGGAAGG - Intronic
1057957978 9:99426643-99426665 CCTCAGCCACAGCTGCCAGCAGG + Intergenic
1060819369 9:126652428-126652450 CCGCACCCCCACCTGCAGGAAGG - Intronic
1061056611 9:128226017-128226039 CCTCCTCCCCGGGTGCAGGACGG + Intronic
1061251875 9:129431229-129431251 CCTCCCCCACAGCTGCAGAGGGG - Intergenic
1061440436 9:130599621-130599643 CCTGATCCAAAGCTGGAGGGCGG - Intronic
1062064513 9:134518994-134519016 CCTTGTCCACAGCTACAGGTGGG - Intergenic
1062207344 9:135344489-135344511 CCTCAGCCACAGCCACAGCATGG + Intronic
1062250794 9:135592575-135592597 CCTCACCCCCAGCTTCAGGCCGG - Intergenic
1185777831 X:2819899-2819921 CTTCATACAAAGCTGCAGGGAGG + Intergenic
1187450051 X:19388027-19388049 CCTAATCACCAGCTGCAGGAAGG - Intronic
1189260935 X:39678389-39678411 TCTCATCCTAAACTGCAGGACGG - Intergenic
1190463685 X:50704754-50704776 CTTCGTCCACATCTGCTGGAGGG - Intronic
1190720357 X:53142869-53142891 GCTAATCCACATCTGCTGGAAGG + Intergenic
1190905368 X:54722021-54722043 TCTCTTCCACTGCAGCAGGATGG - Intergenic
1190928403 X:54928665-54928687 CCACAGCCACAGCTGCAGCTTGG - Exonic
1192397856 X:70801424-70801446 CAGCATCCAGAGCTCCAGGAAGG - Intronic
1192733137 X:73821085-73821107 CCCCATCCCCAGCTGAAGAAAGG + Intergenic
1195243805 X:102978767-102978789 CGTCATCGGCAGCTGCCGGAGGG - Intergenic
1195681050 X:107546974-107546996 CCTCATGCAGAGATGGAGGAGGG - Intronic
1196099380 X:111831630-111831652 ACTGAGCCACAGCTGCTGGATGG - Intronic
1196282682 X:113841218-113841240 CCTAATCCACAGGTGCAATATGG - Intergenic
1199894448 X:152117474-152117496 CCACATCCAGGGCTGAAGGAGGG - Intergenic