ID: 1018362104

View in Genome Browser
Species Human (GRCh38)
Location 6:163081327-163081349
Sequence CAGGGACTACAGCAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 447}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018362104 Original CRISPR CAGGGACTACAGCAGGGGCA TGG Intronic
900126357 1:1070586-1070608 CAGGGACCCTAGCAGGGCCATGG + Intergenic
900151435 1:1180871-1180893 CAGGGACGGGGGCAGGGGCAGGG - Intronic
900151496 1:1181012-1181034 CAGGGGCAAGGGCAGGGGCAGGG - Intronic
900404223 1:2485461-2485483 CAGGGAGGAGAGCAGGGACAGGG + Intronic
900543370 1:3215380-3215402 CAGGGCCTCCAGGAGGGTCATGG + Intronic
900551622 1:3259278-3259300 CAGGGGCTGCAGCTGGGGCTGGG + Intronic
900971162 1:5993059-5993081 GAGGGACGGCGGCAGGGGCAGGG - Intronic
901018383 1:6244178-6244200 CATGGACTGCAACATGGGCACGG + Exonic
901529040 1:9842288-9842310 CAGGAACCACAGCAGGGCCTGGG + Intergenic
901635031 1:10666514-10666536 CAGGAGCTCCAGCAGGTGCAGGG + Intronic
901950873 1:12745172-12745194 CAGAGACCACAGTTGGGGCAGGG - Intergenic
902745438 1:18470654-18470676 CAGGGACTCAAGCCGAGGCAAGG - Intergenic
903034895 1:20486780-20486802 CAGGGCCTCCAGGAGGGGGAGGG + Intergenic
903675609 1:25062818-25062840 CTGAGTCTCCAGCAGGGGCAGGG - Intergenic
903791374 1:25895488-25895510 CTGGGCCTCCAGCAGGGGCAGGG + Intronic
903838161 1:26219364-26219386 GAGGGAGCACAGCAGGGGCGGGG - Intergenic
904033517 1:27547510-27547532 CAGCGGCTGCAGCAGGGCCACGG + Exonic
904621301 1:31776902-31776924 GAGGGACAACAGCATGGGGAAGG + Intergenic
905167432 1:36091277-36091299 CAGGGACTGCACCAGGGCCCTGG - Exonic
905704286 1:40042455-40042477 CAGAGACTACTACAGGTGCAAGG + Intronic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
907284498 1:53371149-53371171 CAGGGACCACAGCCGTGGCTGGG - Intergenic
909005079 1:70266145-70266167 CAGGGACTACAGAAGGGGTGAGG - Intronic
911549837 1:99264944-99264966 CAGGCACTACAGGAGGGCCAAGG - Intronic
912192947 1:107361979-107362001 CAGAGACAACAACAGGGGAAGGG + Intronic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912420704 1:109540506-109540528 CTGGGCCTCTAGCAGGGGCATGG - Intronic
915356007 1:155255457-155255479 CGGGGACTAGAGAAGGGGGATGG + Intronic
916187358 1:162146089-162146111 CTGGGAGTGCAGCAGAGGCAGGG + Intronic
919606306 1:199688763-199688785 AAGGGACTACAGCTGGGAGAGGG - Intergenic
920431510 1:205921905-205921927 CTGTGACTGAAGCAGGGGCATGG + Intronic
922915371 1:229253015-229253037 CAGGGACAGCAGCCGGGGCAGGG - Intergenic
923861786 1:237898930-237898952 CACAGACCACAGCAGGGGGAAGG - Intergenic
924643756 1:245857971-245857993 CAGGGAGGACAGCAGGGAGACGG - Intronic
1063132664 10:3192125-3192147 CAGGGAGTAAACCAGGAGCAGGG + Intergenic
1063185576 10:3647816-3647838 CAGGACTTGCAGCAGGGGCAGGG - Intergenic
1063807429 10:9661621-9661643 CAGGGCTTCCAGCAGGGGCCAGG - Intergenic
1063922058 10:10943092-10943114 GAAGGACAACAGGAGGGGCAAGG - Intergenic
1064815800 10:19260551-19260573 CAGGGAGCTCAGCAGGGGTAGGG + Intronic
1065605361 10:27413267-27413289 CAGGTAGTACAGCAGCCGCATGG + Exonic
1065808768 10:29421584-29421606 CAGGCAGTACAGCAGCTGCATGG + Intergenic
1066962132 10:42233766-42233788 CAAGGACAAGGGCAGGGGCAGGG + Intergenic
1067067739 10:43113167-43113189 CTGGGACCTCAGCAGGGGCCTGG - Intronic
1067145599 10:43691612-43691634 CAGGGCTGCCAGCAGGGGCATGG - Intergenic
1067686395 10:48468452-48468474 CAGGGGCTACAGCAAGGCCTTGG - Intronic
1068898252 10:62232446-62232468 TTGGGACTACAGCTGGGGCTGGG + Intronic
1069010730 10:63368818-63368840 CTGGGACTACAGTAGAGACAGGG + Intronic
1069569870 10:69487849-69487871 CACGGACTACAGCATCTGCAGGG - Intronic
1069631503 10:69899818-69899840 CAGGGACGCTAGCAGTGGCAGGG + Intronic
1070587728 10:77779345-77779367 CAGTGACTGCAGTAGGGTCACGG + Intergenic
1070676195 10:78413225-78413247 CAGGGAATAGGGCAGGGGGAAGG + Intergenic
1071619812 10:87108981-87109003 CAGGGGCTACAGTAGTAGCAGGG - Intronic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073118689 10:101108200-101108222 GAGGGGTCACAGCAGGGGCAGGG + Intronic
1073512019 10:104048502-104048524 CAGGGATGACAGCACGAGCAGGG - Intronic
1074464721 10:113671136-113671158 CTGGGACCTCAGCAGGGGCCAGG + Intergenic
1074948506 10:118304554-118304576 CAAGGACTTTAGCAGGGGCCAGG - Exonic
1075162038 10:120032847-120032869 GAAGGAAAACAGCAGGGGCAAGG + Intergenic
1075164387 10:120053924-120053946 CAGGCACTATAGCAGGTGCTAGG + Intergenic
1075340614 10:121644536-121644558 CAGGGACTAAAGCAGAGTAAAGG + Intergenic
1075426022 10:122342290-122342312 TGGGGACTTGAGCAGGGGCAAGG + Intergenic
1076002013 10:126919830-126919852 CAGGGACCACAGCAGGTGCTGGG - Intronic
1076028908 10:127141329-127141351 CAGCAACTATAGCAGGGGCTGGG + Intronic
1076319045 10:129564753-129564775 GAAGGAATACAGCAGGGGAAAGG - Intronic
1076443667 10:130497455-130497477 CTGGGGTTACAGCAGAGGCATGG + Intergenic
1076891081 10:133283729-133283751 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1076891089 10:133283766-133283788 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077335749 11:2003201-2003223 CAGGGCCTCCAGCAGGAACAGGG - Intergenic
1078143883 11:8710178-8710200 CTGGGAGTGCAGCAGGGGCCAGG + Intronic
1078366319 11:10709371-10709393 CAGTGACTACAGCATGCCCAAGG + Intergenic
1078672451 11:13377146-13377168 CAGCGTGGACAGCAGGGGCAGGG - Intronic
1079100407 11:17538189-17538211 CAGGGCTGGCAGCAGGGGCAGGG - Intronic
1079152789 11:17915931-17915953 GAGGGACAGCAGCAGGTGCAGGG + Intronic
1081993654 11:47350565-47350587 CAGTGGCCTCAGCAGGGGCAGGG + Exonic
1082629847 11:55529103-55529125 CAAGGACAACAGCATGAGCAAGG - Intergenic
1082727307 11:56751537-56751559 CCGGGAATAAAGCAGGGGCTTGG + Intergenic
1083071899 11:59993401-59993423 CAGGTACTACATCAAGGGCCTGG - Intergenic
1083814029 11:65121974-65121996 TAGGGACTGGAGCAGGGCCACGG + Intronic
1083879412 11:65540707-65540729 CGGGGCCTACAGGAGGGGCGGGG + Intronic
1084215367 11:67644561-67644583 CAGGGAAGGCAGCAGGGCCAGGG + Intronic
1084301348 11:68254602-68254624 CAGGGCCCACGGCAGGGGCCTGG - Intergenic
1084697005 11:70761738-70761760 CATGGAGCACAGCATGGGCATGG - Intronic
1085001341 11:73038699-73038721 CAGGGAGTGAGGCAGGGGCAAGG + Intronic
1085449013 11:76620574-76620596 CTGGAACCCCAGCAGGGGCATGG + Intergenic
1085521369 11:77140684-77140706 CAGGGAGTGCAGCTGGGGCTTGG + Intronic
1086869835 11:92024264-92024286 CAGAGACTACCACAGGGGCCTGG - Intergenic
1087036113 11:93758283-93758305 CAGGGACTACAGCCATGGCTTGG - Intronic
1088145610 11:106672594-106672616 TAGGGACTCCAGCTAGGGCAGGG + Intergenic
1088474169 11:110218101-110218123 CAGTGACTTGAGCAGGGGTATGG + Intronic
1089070761 11:115697774-115697796 CAGGGACTACACATGGGGCTTGG + Intergenic
1089692037 11:120193059-120193081 CCGGAACTACAGCTGGGGAAGGG - Intergenic
1091021722 11:132105946-132105968 CTGGGATTACAGCAGGGACTTGG - Intronic
1091268602 11:134289943-134289965 CAGGCACTGCTGCAGAGGCAAGG - Intronic
1091329975 11:134724759-134724781 CAGGGCCCCCAGCAGAGGCAGGG - Intergenic
1202818733 11_KI270721v1_random:58383-58405 CAGGGCCTCCAGCAGGAACAGGG - Intergenic
1091777255 12:3192566-3192588 CAGGGAGCACATCCGGGGCAAGG + Intronic
1092261798 12:6956829-6956851 CAGGGAGGACAGGAGGGGCCTGG - Intronic
1094147782 12:27248522-27248544 CAGGGAATACAGCAGGTGAGCGG + Intronic
1094400009 12:30052507-30052529 GAGGGACAAGAGCTGGGGCAGGG + Intergenic
1094647495 12:32340046-32340068 CAAAGACTACAGGAGGGGCCAGG - Intronic
1095960034 12:47828742-47828764 CAGGGACTGCAGAAAGGGCCTGG + Intronic
1096387423 12:51204107-51204129 CAGGGACCACAGGAGGGACTTGG + Intronic
1096594252 12:52684556-52684578 GAGGGACTCCACCAGGGACATGG + Intergenic
1097456724 12:59807619-59807641 CAGGGACTACAGGTGGGGTGTGG - Intergenic
1097802227 12:63927313-63927335 CAGGGACTGCAGCAGGCACCAGG - Intronic
1099968415 12:89475412-89475434 CAGTGACCAGAGCAGGGGGAAGG - Intronic
1100194307 12:92226949-92226971 CAGGGACAACACCAGGGAGATGG - Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103701741 12:122851711-122851733 CAGGGACCCCAGGAGGGGCAGGG - Intronic
1103937825 12:124485919-124485941 GAGGGACTACAGCAAGGGGAGGG - Intronic
1104592786 12:130098163-130098185 CAGGCACTGCAGCAGGCACAAGG - Intergenic
1104640018 12:130461329-130461351 CAGGGGTGCCAGCAGGGGCAGGG + Intronic
1104980331 12:132570625-132570647 CAGAGACCACAGCAGGTGGAGGG - Intronic
1104981474 12:132574814-132574836 CGGGGAGCAGAGCAGGGGCACGG + Intronic
1105497856 13:20946244-20946266 CAGGTCCTACCGCAGCGGCACGG - Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1110925473 13:81145616-81145638 CATGGACAACATCAAGGGCAAGG + Intergenic
1112235151 13:97629292-97629314 CAGGGACTACAGTATGGAAAAGG + Intergenic
1113566739 13:111323827-111323849 CAGGGATCACAGCAGGTTCAGGG - Intronic
1113750938 13:112776029-112776051 CAGGGACTCCAGCCGGGCCAGGG - Intronic
1114265703 14:21071406-21071428 CAGGGAGTGGAGGAGGGGCAGGG + Intronic
1114407538 14:22470771-22470793 CAGGGACAAGAGCAGAAGCAAGG - Intergenic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1114840662 14:26259245-26259267 CTGATACTACAACAGGGGCAGGG + Intergenic
1117665465 14:58052046-58052068 CAGGGCCTAGAGTAAGGGCAGGG - Intronic
1118166818 14:63344819-63344841 CAGGGAATAAAGCAGGGTAAGGG - Intergenic
1118438853 14:65794773-65794795 CAGGGACTATAACAGCGGGAAGG + Intergenic
1121346270 14:93137977-93137999 CAGGCACCACACCAGGGGCTGGG - Intergenic
1121781088 14:96623074-96623096 CAGGGATGATAGCGGGGGCATGG - Intergenic
1123053930 14:105560450-105560472 CAGGGACTGCGGATGGGGCAAGG - Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1125181226 15:36882616-36882638 CAGGGAGGACAGCAAGGGAAAGG - Intergenic
1127279184 15:57474398-57474420 CAAGGACTAAACCAAGGGCATGG - Intronic
1127315499 15:57790678-57790700 CAGGGTCAAGAGCAGGGGAATGG - Intergenic
1127546519 15:59998399-59998421 AAGGGACAAAAGCAGGGTCAGGG - Intergenic
1127916906 15:63462125-63462147 CAGGCAATCAAGCAGGGGCAAGG + Intergenic
1128568744 15:68718333-68718355 CACAGAGCACAGCAGGGGCAGGG - Intronic
1129077507 15:73009656-73009678 AGGGGACCACAGCTGGGGCATGG - Intergenic
1129870070 15:78934379-78934401 CCGGGAGAACAGCGGGGGCAGGG + Intronic
1130990830 15:88874763-88874785 CAGGGACCAGTGCAGGGACAGGG + Exonic
1131112988 15:89776895-89776917 CAGGGGCAAGGGCAGGGGCAGGG + Exonic
1131112998 15:89776919-89776941 CAGGGGCAAGGGCAGGGGCAAGG + Exonic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132497551 16:270951-270973 CTGGGACTGGAGCAGGGGCTGGG + Intronic
1132648483 16:1009933-1009955 CAGGGACACCAGGAGGGGCTGGG + Intergenic
1132861575 16:2074363-2074385 CAGGAACTCCAGCAGTGGGACGG - Exonic
1133284445 16:4684066-4684088 CACGGTCAATAGCAGGGGCATGG - Intronic
1133394625 16:5436339-5436361 CAGGGGCTACAGAAGAGACAGGG + Intergenic
1133916957 16:10117710-10117732 CAGGGGCTACAGCTGGGGAGAGG + Intronic
1134020254 16:10916426-10916448 CAAGGACTTCAGCTGGGGGAAGG - Exonic
1135223860 16:20638522-20638544 CAAGGACCACAGCAGCTGCAAGG + Intronic
1136038642 16:27560603-27560625 CAGGGAACACAGCACAGGCAAGG - Intronic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136235474 16:28911055-28911077 CTGGGGCTGCAGCAGCGGCAGGG + Intronic
1136281428 16:29213688-29213710 CAGAAACTCCAGCAGGGGCCTGG + Intergenic
1136577074 16:31131264-31131286 CAGGTCCGACAGCAGGGGCCAGG - Exonic
1136723297 16:32340168-32340190 CAAGGACAAGGGCAGGGGCAGGG + Intergenic
1137399651 16:48142958-48142980 CAGGGAGTAGAGCAGGAGCATGG + Intronic
1137504715 16:49044029-49044051 CAGGTACTACAGCAGCTACATGG - Intergenic
1138811178 16:60152610-60152632 ATGGGACTATATCAGGGGCACGG - Intergenic
1139312408 16:66038827-66038849 GAGGAACTACTGCTGGGGCAAGG - Intergenic
1139343545 16:66287675-66287697 CTGGGAGCACAGCAGAGGCATGG - Intergenic
1139400238 16:66675538-66675560 CAGGGAGCCCAGCAGGGCCAGGG - Intronic
1139415035 16:66801327-66801349 TGGGGACTACAGCCGGGGCCTGG + Intronic
1139728265 16:68920115-68920137 CTGGGAATACAGCAGGGGACAGG + Intronic
1140350464 16:74257579-74257601 CAGAGACAACAGCATGAGCAAGG + Intergenic
1140465950 16:75182883-75182905 CTGGGATTACAGGAGGTGCAGGG - Intergenic
1141156008 16:81597626-81597648 CTGGGACTAGAGCAGGGGGCGGG + Intronic
1141991189 16:87611275-87611297 CAGGGACCTGAGGAGGGGCAGGG + Intronic
1142085798 16:88179616-88179638 CAGAAACTCCAGCAGGGGCCTGG + Intergenic
1142115672 16:88354918-88354940 CAGGGTCTCCAGTGGGGGCAGGG + Intergenic
1142253627 16:89003494-89003516 CACGAGCTACAGCAGGAGCAAGG + Intergenic
1203003135 16_KI270728v1_random:177597-177619 CAAGGACAAGGGCAGGGGCAGGG - Intergenic
1203134740 16_KI270728v1_random:1714003-1714025 CAAGGACAAGGGCAGGGGCAGGG - Intergenic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1142879839 17:2875751-2875773 CAGGCACGACAGCAGGTGGAAGG - Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1143617840 17:8064226-8064248 CCGGGGCTGCAGGAGGGGCATGG + Intergenic
1144854077 17:18258499-18258521 CAGGGACTGCGGCCGGGGCGGGG - Intronic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1145041661 17:19581944-19581966 CAGGGATGACAGCAGAGGCGGGG - Intergenic
1145296277 17:21594472-21594494 CAGGGACTACAGAGAGGTCAGGG - Intergenic
1145781399 17:27566230-27566252 CAGGCCCTGCAGCAGGGGCTGGG - Intronic
1146258858 17:31408786-31408808 CAAGGAGAACAGCTGGGGCAGGG + Intronic
1147188366 17:38725053-38725075 CAGGTACCTCAGCAGGGGGAAGG + Intronic
1147245547 17:39117887-39117909 AAGAGACTTCAGCTGGGGCAGGG + Intronic
1147544956 17:41394035-41394057 CAGGGCCCACAGCGGGGGCGTGG + Exonic
1147586626 17:41656877-41656899 CAGGGCCACCAGCAGGGCCAGGG - Intergenic
1147661868 17:42121142-42121164 CTGGGGCTGCAGCTGGGGCAGGG + Exonic
1148032107 17:44628535-44628557 CAGGGGCAGCGGCAGGGGCAGGG + Intergenic
1148542572 17:48492374-48492396 AAGGGTCTACTGCAAGGGCAAGG - Intergenic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1151942885 17:77303855-77303877 CAGGGCCCACAGCAAGGGCCTGG + Intronic
1151978085 17:77493461-77493483 CAGGAACTTCAGCAGGGTAAGGG - Intronic
1152094837 17:78266984-78267006 CAGGTCCTTGAGCAGGGGCATGG + Intergenic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1152211066 17:79003686-79003708 CAGGGACTACAGCAAAGTCATGG + Intronic
1152215183 17:79027871-79027893 GATGGTCTCCAGCAGGGGCACGG + Intronic
1152554365 17:81045699-81045721 CAGGGACTCCTGCAGGGCCCTGG - Intronic
1152559223 17:81069579-81069601 AAGGGGCTACTGCAGAGGCAGGG - Intronic
1152899588 17:82932663-82932685 CAGCGTCTTCAGCAGCGGCACGG - Exonic
1153741799 18:8137687-8137709 CAGGGTCTGGAGCAGGGGCTGGG - Intronic
1153947338 18:10029470-10029492 CAGGGACATCAGCTGGGCCATGG + Intergenic
1154176168 18:12088141-12088163 CAGGGTCCAGAACAGGGGCAGGG - Intergenic
1154300279 18:13186001-13186023 CAGAGCCCACAGCAAGGGCAGGG - Intergenic
1154330047 18:13421914-13421936 CAGTGACTGCAGCATAGGCACGG - Intronic
1156454964 18:37287663-37287685 CAGGGAATCCAGGAGGGCCATGG - Intronic
1157762088 18:50272775-50272797 TTGGGGCTACAGCAGGGTCAGGG + Intronic
1158438042 18:57447906-57447928 CAGGGACAGAAGCAGTGGCAAGG - Intronic
1158763093 18:60413980-60414002 CATGGACGAGGGCAGGGGCATGG + Intergenic
1160954582 19:1684643-1684665 CAGGGTCTCAAGCAGGGGGAGGG + Intergenic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161547595 19:4891160-4891182 CAGGGACCAGGGCAGGTGCACGG + Exonic
1163062583 19:14771173-14771195 CAGGGAGAACAGGAGGGACAGGG + Intronic
1163550739 19:17965367-17965389 CAGGGACTCCTGCAAGGGCTGGG + Intronic
1163828126 19:19535179-19535201 CAGTGATTTCTGCAGGGGCAGGG - Intronic
1164611427 19:29635098-29635120 CAGGGACTCCACAGGGGGCAGGG - Intergenic
1164823592 19:31268114-31268136 CAGGCAAGACAGCATGGGCAGGG - Intergenic
1165133999 19:33653934-33653956 CAGGGACTAAAACAAAGGCAGGG - Intronic
1166026481 19:40090538-40090560 CGGGGACTGCAGCAGAGGAATGG - Intronic
1166043491 19:40216613-40216635 GAGGGATTACAACAGGTGCAGGG - Intronic
1166060153 19:40320916-40320938 CAGGGCTTGCAGCAGGGACATGG + Exonic
1166144680 19:40826003-40826025 CAGGGACCCCAGATGGGGCAGGG - Intronic
1166183063 19:41122204-41122226 CAGGGACCCCAGATGGGGCAGGG + Intronic
1166369628 19:42293684-42293706 CAGGGGCTACAGCTGGAGCTGGG - Exonic
1167586260 19:50377349-50377371 CGGGGCCTACAGCAGGGGCGGGG + Intronic
1168391300 19:56010182-56010204 CATGGACTAAAGCACTGGCACGG - Intronic
925444997 2:3920004-3920026 CAGGGAGGACATCAGGGGCAAGG + Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926078731 2:9965997-9966019 CAGGGAAGAAGGCAGGGGCAAGG - Intronic
926225258 2:10962379-10962401 CAGCGTCTACAGCAGGGGCCGGG - Intergenic
926305800 2:11636753-11636775 CAGGGGCAAGGGCAGGGGCAGGG + Intronic
926305820 2:11636807-11636829 CAGGGACAGAGGCAGGGGCAGGG + Intronic
926305859 2:11636945-11636967 CAGGGACAGAGGCAGGGGCAGGG + Intronic
926305864 2:11636963-11636985 CAGGGACAGAGGCAGGGGCATGG + Intronic
926305879 2:11637011-11637033 CAGGGACAGAGGCAGGGGCATGG + Intronic
926305895 2:11637059-11637081 CAGGGACAGAGGCAGGGGCAGGG + Intronic
926636136 2:15181848-15181870 CAGGGCCTACAGCAGGAACTAGG + Intronic
926754004 2:16221569-16221591 CATGGACCACAGGATGGGCAAGG - Intergenic
927938568 2:27089291-27089313 CAGGGACTGGGGAAGGGGCACGG + Intronic
928158078 2:28894731-28894753 AAGGGACCCCAGCAGGGGCCAGG - Exonic
929314342 2:40459458-40459480 CAGGGTCAGCAGCAGAGGCATGG + Intronic
930309071 2:49714703-49714725 CAGGGAGTACAACAGGGGTGTGG - Intergenic
931184895 2:59940226-59940248 CAGAGACTACAGCAGAATCAGGG - Intergenic
931199026 2:60079191-60079213 TAGGGACTACAGTACAGGCAAGG + Intergenic
932459758 2:71874657-71874679 CCAGGACTGCAGCAGGGGCCTGG + Intergenic
933277934 2:80302965-80302987 CAGGGACTGCAGGTGCGGCACGG + Exonic
934322805 2:91983346-91983368 CAAGGACAAGGGCAGGGGCAGGG - Intergenic
935266986 2:101403193-101403215 CAGGGTCTGCAAGAGGGGCAAGG - Intronic
937245287 2:120488607-120488629 CAGGGACTTGAGCAGAGGAAAGG - Intergenic
937448003 2:121975080-121975102 CAGGGACTGGAGCCGGGCCAAGG + Intergenic
937914451 2:127092131-127092153 CAGGGCCTGGGGCAGGGGCAGGG - Intronic
938064332 2:128272938-128272960 CAGGGGCAACGGCAGGGGAAAGG + Intronic
939488850 2:142852349-142852371 CAGGGACTCTAGTAGGGGCACGG - Intergenic
939940390 2:148342930-148342952 CAGGGACTACTAGAGGGGAAAGG - Intronic
941071206 2:160956495-160956517 CAGGGGGTGGAGCAGGGGCAGGG - Intergenic
941812366 2:169767816-169767838 CAGGTAGTACAGCAGCTGCATGG + Intronic
941873830 2:170413309-170413331 CAGGGCCTACAGCACTGGAAAGG + Intronic
942057588 2:172199016-172199038 CAGGCACAACAGCAGCAGCAAGG - Intergenic
942720927 2:178951692-178951714 CAGGGGCAACACCAGGGGTACGG + Intronic
945250568 2:207763017-207763039 CAGTGACTACAGCATGGGATAGG + Exonic
946327543 2:218992591-218992613 CTGGGACCTCAGCTGGGGCAGGG + Intronic
946689116 2:222297760-222297782 CAGAGACCACAGCAGCGGCAGGG + Intronic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
948170199 2:235895313-235895335 CTGGGGCAAGAGCAGGGGCACGG - Intronic
1168914609 20:1475887-1475909 AAAGGGCTGCAGCAGGGGCAAGG + Exonic
1168972960 20:1943400-1943422 CAAGGAGTCCAGCAGGGGCTGGG - Intergenic
1169267241 20:4174214-4174236 CAGAGACAAGAGAAGGGGCAAGG + Intronic
1169398609 20:5259784-5259806 CAGGGATTAAAGCGGGGGTAAGG + Intergenic
1171245831 20:23608767-23608789 AAAGGAAGACAGCAGGGGCAGGG + Intergenic
1172104513 20:32508702-32508724 CTGGGAGTCCAGCTGGGGCAGGG - Intronic
1172181730 20:33007868-33007890 CAGGTCCTACAGCAAGGCCAGGG - Intronic
1172192263 20:33069142-33069164 CAGGAACTGAAGCAGGGGCTTGG - Intronic
1172869432 20:38126606-38126628 CCGGCTATACAGCAGGGGCAGGG - Intronic
1173163746 20:40671640-40671662 CAGGGACACCAGGAAGGGCATGG + Intergenic
1173843632 20:46174730-46174752 CAGGGACTTCATCAGCCGCAAGG - Exonic
1173863117 20:46297185-46297207 CAAGGGCTCCAGGAGGGGCAGGG + Intronic
1174180316 20:48670304-48670326 CAGGGTTCTCAGCAGGGGCAGGG - Intronic
1174569517 20:51491921-51491943 CAGGGAGTAGGGCTGGGGCAAGG - Intronic
1175138457 20:56842406-56842428 CAGGGGCGAAGGCAGGGGCATGG - Intergenic
1175324532 20:58113691-58113713 CACCTACTTCAGCAGGGGCAGGG + Intergenic
1175777901 20:61664391-61664413 CAGAAACCACAGCTGGGGCATGG + Intronic
1175781312 20:61684024-61684046 CAGGGACTACAGCCAGAGCTGGG + Intronic
1175858369 20:62134903-62134925 CAGGGACCACAGAAGGGCCAAGG - Exonic
1176113963 20:63423005-63423027 CAGGGCCAGCAGCAGGGGCGGGG + Intronic
1176312305 21:5158614-5158636 CAGTGCCTGCAGCCGGGGCATGG + Intergenic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1177861161 21:26455972-26455994 CAGAGAATACAGCAGGCCCATGG - Intergenic
1178895518 21:36554063-36554085 CATGGACTTGGGCAGGGGCAAGG - Intronic
1179204282 21:39259564-39259586 CTGGGATTACAGCCGGGGCGTGG + Intronic
1179226725 21:39460284-39460306 CAGAGACTACTGGAGGGGAAGGG - Intronic
1179354174 21:40643020-40643042 CAGAGACTGCAGCAGGTGCCAGG - Intronic
1179539360 21:42074161-42074183 CAGAGACTCCTGCAGGGGCTCGG - Intronic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1179844743 21:44103416-44103438 CAGTGCCTGCAGCCGGGGCATGG - Exonic
1180968959 22:19805049-19805071 CAGGGACTGCAGCAGAGCCTGGG - Intronic
1181466444 22:23113083-23113105 CAGGGTCAGCCGCAGGGGCAGGG - Intronic
1181553309 22:23653245-23653267 CAGAGCCTACAGCCGGGGCATGG - Intergenic
1183086735 22:35491550-35491572 CAGGGAGCACATCTGGGGCAGGG - Intergenic
1183086740 22:35491568-35491590 CAGGGAGCACATCTGGGGCAGGG - Intergenic
1183086761 22:35491622-35491644 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086767 22:35491640-35491662 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086780 22:35491676-35491698 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086793 22:35491712-35491734 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086799 22:35491730-35491752 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086812 22:35491766-35491788 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086825 22:35491802-35491824 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086838 22:35491838-35491860 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086844 22:35491856-35491878 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086870 22:35491928-35491950 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086876 22:35491946-35491968 CAGGGAACACATCCGGGGCAGGG - Intergenic
1183086882 22:35491964-35491986 CAGGGAGCACATCCGGGGCAGGG - Intergenic
1183086898 22:35492035-35492057 CAGGGAGCACACCTGGGGCAGGG - Intergenic
1183086916 22:35492123-35492145 CAGGGAGCACACCTGGGGCAGGG - Intergenic
1184677635 22:46052423-46052445 CTGGGGCCTCAGCAGGGGCAGGG + Intronic
1185141778 22:49106643-49106665 CAGGGACTGCAGCTGGCTCAAGG - Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
949856247 3:8463979-8464001 CAGGTACAACAGCATGTGCAAGG - Intergenic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
952646697 3:35668405-35668427 CAGAGACTCCAGCAGGAGCAAGG - Intronic
952773845 3:37025900-37025922 CAGCCACTTCAGCAGGGGCTGGG - Exonic
952991944 3:38837765-38837787 GAGAGACTACTGCAGGGGTAGGG + Intergenic
955126306 3:56115886-56115908 GAGGGATTACAGCAGGGGGAGGG - Intronic
955833227 3:63026600-63026622 GAGGGTCTGCTGCAGGGGCATGG - Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
961347443 3:126273384-126273406 CAGGGGCTTGAGCTGGGGCAGGG + Intergenic
961454631 3:127017929-127017951 CAGGGTCCACAGGTGGGGCATGG - Intronic
961468211 3:127094339-127094361 CAGGGGCTAGGGCAGGGGGATGG - Intergenic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
964612265 3:158627193-158627215 CTGGTTCTACAGTAGGGGCAGGG + Intergenic
966862749 3:184239661-184239683 GAGGCAAGACAGCAGGGGCATGG - Intronic
968400388 4:290450-290472 CAGGGACCACAGCTGAGGCCAGG - Intronic
968400396 4:290489-290511 CAGGGACCACAGCTGAGGCCAGG - Intronic
968665003 4:1816172-1816194 CAGGGACGAGAGCATGAGCAGGG + Intronic
969046324 4:4339253-4339275 GAGGGACTTGAGCAGAGGCATGG - Intergenic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969153710 4:5191921-5191943 GGGGGAATACAACAGGGGCATGG + Intronic
969215811 4:5721490-5721512 CAGGGGCTGCAGCAGAGGAAAGG + Intronic
969587607 4:8103572-8103594 CATGGACTCCAGCAGTAGCAGGG - Intronic
969966389 4:11001099-11001121 CAGGGCCTACAGCAGGGCCCAGG + Intergenic
972247745 4:37263117-37263139 CAGGGACAACAGGAGCTGCATGG + Intronic
972602243 4:40582868-40582890 AAGAGAGTACAGCATGGGCAAGG - Intronic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975499242 4:75066967-75066989 CAGGGACTACTGGAGGGGGAGGG + Intergenic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
979885486 4:126022899-126022921 CAGGAACTAGAGGAGAGGCATGG - Intergenic
981877121 4:149560024-149560046 CATGGACCAGAGCAGGGGCAGGG - Intergenic
983765227 4:171472356-171472378 CAGGGACTGTAGAAGGTGCAGGG + Intergenic
984680886 4:182608390-182608412 CATGGACTACAGGTGTGGCATGG + Intronic
984897841 4:184557746-184557768 CAGGGACTACTAGAGGGGAAGGG + Intergenic
985123156 4:186664045-186664067 CAGGGACAACACCAGAGCCATGG + Intronic
985627707 5:998493-998515 GAGGCACTTCAGCAGGGGCTGGG - Intergenic
985790920 5:1926471-1926493 CTGGGACAAGAGCAGGGGAAGGG - Intergenic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986044320 5:4022800-4022822 CAGGGAGTCCAGCAGGGAGAAGG - Intergenic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
986703915 5:10439844-10439866 CAGGGAGGACGGCAGGAGCAGGG - Exonic
987731962 5:21785276-21785298 CAGGGACTAGAGAAGGCCCAAGG - Intronic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
990042221 5:51389091-51389113 CAGGGACTTCTGCAAGGGGAAGG - Intronic
990767591 5:59203830-59203852 CAGGGACTGGAGCAGGGCCTGGG + Intronic
992447346 5:76845949-76845971 CAGCCACTACAGCAGGAGCCTGG + Intergenic
992811109 5:80389622-80389644 CAGGGACGACAGGACGGCCAGGG + Intergenic
993307403 5:86289767-86289789 CAGGGCCTACAGCAGGTGCAAGG - Intergenic
994745988 5:103678875-103678897 CATGGACTAAGGCAGGGGCTAGG - Intergenic
995903335 5:117094353-117094375 CAGGTAGTGCAGCAGGGTCAAGG - Intergenic
996421653 5:123269457-123269479 GAGGGACTACAGCAAGCCCAAGG - Intergenic
996713748 5:126569257-126569279 CATGGACCACGGCAGGGGGATGG - Intronic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
997475635 5:134140850-134140872 CAGGGGCTGCAGTGGGGGCAGGG - Intronic
997716883 5:136049169-136049191 CAGAGAGGACAGCAGGGACAAGG + Intronic
999378166 5:151101344-151101366 CAGAGACTAAGGAAGGGGCAGGG - Exonic
999716383 5:154364213-154364235 CAGAGAATGCACCAGGGGCAGGG + Intronic
1000273369 5:159709191-159709213 CTGTGAATACAGCATGGGCAAGG + Intergenic
1001920612 5:175596694-175596716 GAGGTACTCCAGCAGGGGCGAGG + Intergenic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002296418 5:178233513-178233535 CTGGGACTGCAGCAGGTGCAGGG + Intergenic
1002321081 5:178376417-178376439 CAGGGACCACAGCTGGGACAGGG + Intronic
1002334277 5:178467308-178467330 AAGGGTCTCCACCAGGGGCAGGG - Intronic
1002345271 5:178544301-178544323 CAGGAGCTCCAGCAGGGGCTGGG - Intronic
1002942855 6:1733322-1733344 CAGGGACTCAAGCAGGGCCCTGG + Intronic
1005076732 6:21915811-21915833 CAGTAACTACATCAGGGACAGGG + Intergenic
1005752558 6:28896890-28896912 CAGGGACCACCACATGGGCAAGG + Intergenic
1007249002 6:40482945-40482967 CAGTGGCTGCAGCAGGGACAGGG - Intronic
1007394534 6:41570018-41570040 GAGGGATGACAGCAGGGGAAGGG + Intronic
1007753371 6:44083344-44083366 CCAGGACTCCAGCAGGGGCTGGG - Intergenic
1007777331 6:44231010-44231032 GAAGGACTACAGCAGGGAGAGGG + Intronic
1008964937 6:57305389-57305411 CAGGGACTATGGTAGAGGCAGGG + Intergenic
1009358392 6:62782903-62782925 CAGAGACCACAGTAAGGGCAAGG - Intergenic
1010774595 6:79870469-79870491 TAGTGTCTACAGCAGTGGCATGG + Intergenic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1016507856 6:144804576-144804598 GAGGGACTTGAGCAGAGGCAAGG + Intronic
1016929646 6:149391546-149391568 CAGGGACAGGGGCAGGGGCAGGG + Intronic
1017096754 6:150811714-150811736 CAGGGACTGAGGCAGGGGCTGGG + Intronic
1018362104 6:163081327-163081349 CAGGGACTACAGCAGGGGCATGG + Intronic
1018573313 6:165233235-165233257 CAGGGGCTGCAGCTGGGGCAGGG + Intergenic
1018626336 6:165782403-165782425 CAGAGTCCACAGCAGGGCCAAGG + Intronic
1018631627 6:165826964-165826986 GAGGGACATCAGGAGGGGCACGG + Intronic
1018716065 6:166533514-166533536 CAGTGACACCAGCAAGGGCAGGG + Intronic
1019147990 6:169986995-169987017 CAGGGATTGCAGCACGGGCCCGG + Intergenic
1019306779 7:339249-339271 CAGGGCCCACAGTAGCGGCAAGG - Intergenic
1019342880 7:516916-516938 CAGGGATTACAGAGGGGGCCGGG + Intronic
1019479790 7:1261235-1261257 CAGGGAGGATGGCAGGGGCAGGG + Intergenic
1019574162 7:1728245-1728267 CAGGGGCTACTGCAGTGGCAGGG - Intronic
1019938810 7:4273420-4273442 CTGGGACTCCACCAGGGGAATGG - Intergenic
1020112495 7:5455515-5455537 CAGGGAGGACAGGAGGGGCTGGG - Intronic
1020224585 7:6270641-6270663 CAACGCCAACAGCAGGGGCATGG - Intronic
1020771335 7:12398880-12398902 TAGGGACTACTGAAGGGGGAAGG + Intronic
1021901653 7:25291420-25291442 CAGGCACAACAGCATGTGCAGGG - Intergenic
1022249042 7:28588770-28588792 AAGAAAATACAGCAGGGGCAAGG - Intronic
1022456620 7:30563773-30563795 CAGCGGCTTCAGCAGGAGCATGG - Intergenic
1022971101 7:35518144-35518166 CAAAGACTACAGAAGGGGAAGGG + Intergenic
1024234098 7:47384863-47384885 CATGCACATCAGCAGGGGCATGG - Intronic
1024500500 7:50100271-50100293 CTGGTACTGCACCAGGGGCAGGG + Intronic
1025082270 7:55994127-55994149 CAGGGACCACCCCTGGGGCAGGG - Intronic
1025942020 7:66081916-66081938 CAAAGCCTACAGCAGGGGCCTGG + Exonic
1026035130 7:66825157-66825179 CAGGGACAAGGGCAGGGACAAGG - Intergenic
1026775335 7:73227522-73227544 CAGGGAATGGAGCAGGGGCTGGG + Intergenic
1027016192 7:74780893-74780915 CAGGGAATGGAGCAGGGGCTGGG + Intronic
1027071836 7:75165044-75165066 CAGGGAATGGAGCAGGGGCTGGG - Intergenic
1028506074 7:91571597-91571619 CAGGGACTGCACCTGAGGCAAGG + Intergenic
1029049592 7:97670564-97670586 CAGAGAAGACAGCAGGTGCAAGG - Intergenic
1029433030 7:100544535-100544557 ATGGGACTAAAACAGGGGCAAGG - Intronic
1029728758 7:102425715-102425737 CAGGGACTTCACCAGGGGCTGGG + Exonic
1031221954 7:118977838-118977860 CAGGGACTACCTCAGTGCCAAGG + Intergenic
1032649669 7:133864054-133864076 CAGAGATTACAGCAGAGACATGG - Intronic
1034222425 7:149456839-149456861 CAGCCTCTACAGCAGGGGCCGGG - Intronic
1034225433 7:149477505-149477527 CAGGGATCACAGGAGGGACAGGG - Intronic
1034358530 7:150473650-150473672 CAGGGGCTAAGGCAGGAGCAGGG - Intronic
1034749669 7:153557071-153557093 CAGAGACTTCAGCAGACGCATGG + Intergenic
1035106624 7:156446525-156446547 CAGAGGCCCCAGCAGGGGCAAGG - Intergenic
1035234781 7:157489178-157489200 CAGCGACTCCAGCAGGGACCTGG + Intergenic
1035911808 8:3575193-3575215 CATGGACTCCAACTGGGGCATGG + Intronic
1037441055 8:18916569-18916591 CAGGGGCTACAGCAGGGAGGAGG + Intronic
1038220131 8:25599566-25599588 GAGGGACAACGGCAGGGGCAGGG - Intergenic
1040555181 8:48471915-48471937 CAGGGACTCCTGCAGGGGACAGG - Intergenic
1040892998 8:52336895-52336917 CAGAAACTACAGAAGGGGCATGG - Intronic
1041642556 8:60218836-60218858 CAGGGACTGCAACACGAGCAGGG - Intronic
1042438769 8:68799930-68799952 CAAGAACCACAGCATGGGCAAGG + Intronic
1045109518 8:98926932-98926954 CAGTGAGAACTGCAGGGGCATGG + Intronic
1045291712 8:100839070-100839092 GAGGGACTTCAGCAGGGGTGAGG - Intergenic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048829124 8:138458999-138459021 CAGGGAATACAGCAGAGGTTGGG + Intronic
1048933801 8:139338860-139338882 CAGAGAGTAAAGAAGGGGCAGGG + Intergenic
1049229808 8:141476054-141476076 CAGGGCATCCAGCAGTGGCAGGG + Intergenic
1049285473 8:141772769-141772791 CGGGGATCACAGCAGGGACAGGG - Intergenic
1049354196 8:142179583-142179605 CAGGGGCGACAGCAGGGAAATGG - Intergenic
1049431369 8:142566830-142566852 CAGGCTCTTCAGCAGGGCCAAGG - Intergenic
1049671132 8:143870353-143870375 CTGGGCCTCCAGCAGGGCCAGGG + Exonic
1049682905 8:143927663-143927685 GAGCGACTGCAGCAGCGGCACGG - Exonic
1049687163 8:143943604-143943626 CTGGGACTGCAGCAGGGTCAGGG + Intronic
1049725503 8:144143827-144143849 CTGGGACTGCGGCAGAGGCAGGG + Intergenic
1053445165 9:38147016-38147038 CAGGCACTCCAGCTGCGGCAGGG - Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057082167 9:92181229-92181251 AAGGAACTAGAGGAGGGGCAGGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057420167 9:94905869-94905891 CAGGGAGTGCAGAAGGGGCTGGG + Intronic
1057854668 9:98593422-98593444 CAGGGACAATGGCAGGAGCAGGG + Intronic
1061245936 9:129401383-129401405 CAGGGCCCAGAGCAGGGGCTGGG - Intergenic
1061938859 9:133873441-133873463 CAGTGTCTTCAGCAGGGGCATGG - Intronic
1061990358 9:134155352-134155374 CTGGGACTACAGCAAGGGGAAGG + Exonic
1062205730 9:135335849-135335871 CAGGGGCCAGAGCAGGTGCAGGG + Intergenic
1062386069 9:136311991-136312013 TCGGGAGCACAGCAGGGGCATGG - Intergenic
1062472945 9:136714135-136714157 CAGGATCCACAGCAGGGTCAGGG + Intronic
1062506991 9:136882615-136882637 CCAGGCCTCCAGCAGGGGCAGGG - Intronic
1185623313 X:1466463-1466485 CAGCGAGTACACCACGGGCAGGG + Exonic
1186285316 X:8037617-8037639 CAGGTTCTACTGCAGGGGCAAGG - Intergenic
1186477114 X:9866060-9866082 CTGGGACCACAGCAGGGGCCAGG + Intronic
1187064808 X:15823083-15823105 CAGGGACCGCAGCCGGGGCCGGG + Exonic
1189693083 X:43637126-43637148 CAAGGACTAGGGCAAGGGCAAGG - Intergenic
1192079384 X:68032657-68032679 CAGTGACAGCAGCAGGGGAAGGG - Intergenic
1192508314 X:71704807-71704829 CAGGGAAGACAGCATGTGCAGGG - Intergenic
1192518382 X:71776746-71776768 CAGGGAAGACAGCATGTGCAGGG + Intergenic
1192527037 X:71855926-71855948 CAGGGAAGACAGCATGTGCACGG - Intergenic
1192724294 X:73731510-73731532 TAGGGACTCCAAAAGGGGCAAGG - Intergenic
1193242452 X:79187029-79187051 CAGGGCATATAGCAGGGCCAGGG - Intergenic
1199140012 X:144299588-144299610 CAGGAGCTACAGCAGAGGAAGGG + Intergenic
1199350377 X:146793964-146793986 CAGGCAAAAGAGCAGGGGCAGGG - Intergenic
1199594273 X:149494191-149494213 AAGGTACTGCAGGAGGGGCAAGG + Intronic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200140657 X:153901240-153901262 CAGGGTCTCCAGCAGGTGCTGGG - Intronic
1201190301 Y:11438522-11438544 CAAGGACAAGGGCAGGGGCAGGG - Intergenic
1201343799 Y:12960669-12960691 CAGAGACCCCCGCAGGGGCAAGG - Intergenic
1202583322 Y:26403393-26403415 CAAGGACAAGGGCAGGGGCAGGG + Intergenic