ID: 1018363192

View in Genome Browser
Species Human (GRCh38)
Location 6:163093546-163093568
Sequence AAGCTTTTACAGCTGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018363190_1018363192 -7 Left 1018363190 6:163093530-163093552 CCAATAAATGGCATTAAAGCTTT 0: 1
1: 0
2: 1
3: 25
4: 255
Right 1018363192 6:163093546-163093568 AAGCTTTTACAGCTGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018363192 Original CRISPR AAGCTTTTACAGCTGGAATA TGG Intronic
No off target data available for this crispr