ID: 1018363502

View in Genome Browser
Species Human (GRCh38)
Location 6:163096239-163096261
Sequence GCACCCTGGGGTGCTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018363502_1018363511 8 Left 1018363502 6:163096239-163096261 CCCATAGCAGCACCCCAGGGTGC 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1018363511 6:163096270-163096292 CAGCCCAGTCTCGAGGGACCTGG No data
1018363502_1018363515 19 Left 1018363502 6:163096239-163096261 CCCATAGCAGCACCCCAGGGTGC 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1018363515 6:163096281-163096303 CGAGGGACCTGGCCACGGTGAGG 0: 1
1: 0
2: 1
3: 14
4: 147
1018363502_1018363516 23 Left 1018363502 6:163096239-163096261 CCCATAGCAGCACCCCAGGGTGC 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1018363516 6:163096285-163096307 GGACCTGGCCACGGTGAGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 262
1018363502_1018363514 14 Left 1018363502 6:163096239-163096261 CCCATAGCAGCACCCCAGGGTGC 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1018363514 6:163096276-163096298 AGTCTCGAGGGACCTGGCCACGG 0: 1
1: 0
2: 0
3: 12
4: 131
1018363502_1018363507 1 Left 1018363502 6:163096239-163096261 CCCATAGCAGCACCCCAGGGTGC 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1018363507 6:163096263-163096285 GCCGCACCAGCCCAGTCTCGAGG No data
1018363502_1018363509 2 Left 1018363502 6:163096239-163096261 CCCATAGCAGCACCCCAGGGTGC 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1018363509 6:163096264-163096286 CCGCACCAGCCCAGTCTCGAGGG 0: 1
1: 0
2: 1
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018363502 Original CRISPR GCACCCTGGGGTGCTGCTAT GGG (reversed) Intronic
902978963 1:20109515-20109537 TCACCCCTGGGTGCTCCTATCGG - Intergenic
905016605 1:34782321-34782343 GCACCCTGGTGGGCAGCCATGGG + Intronic
905035701 1:34917050-34917072 GCACACTGGGGTCCACCTATTGG - Intronic
905803017 1:40857771-40857793 GCCCCCAGGAGTGCTGCTGTTGG + Intergenic
909026496 1:70487575-70487597 GCCCCCTTGGGATCTGCTATGGG - Intergenic
918049666 1:180963246-180963268 GCACTCTGGGGGGCTGAGATGGG + Intergenic
921201039 1:212806625-212806647 GCACTCTGGGATGCTGAGATGGG - Intronic
921353656 1:214263917-214263939 GCACCCTAGAGTCATGCTATGGG + Intergenic
923033500 1:230267917-230267939 GCGCCGTGCGGTGCTGCTGTGGG + Intronic
1064317438 10:14271343-14271365 GCACCCTGAGCTGCTGGGATGGG - Intronic
1064622342 10:17229009-17229031 TCACCCTGGGGTGCTGAAAAAGG - Intronic
1065078472 10:22104127-22104149 GCATTCTGGTGTGCTGCTATTGG - Intergenic
1067442483 10:46317010-46317032 GCACCCTGAGCTGCTGGGATAGG + Intronic
1067451419 10:46384329-46384351 GCTCCCTGGGGTGGAGCTGTTGG - Intronic
1067585823 10:47475427-47475449 GCTCCCTGGGGTGGAGCTGTTGG + Intronic
1070579686 10:77710267-77710289 GCATCCTGGGGTGCTGTTGTGGG + Intergenic
1070820645 10:79352154-79352176 ATACCCTGGGGGGCTGGTATCGG + Intronic
1073660345 10:105468998-105469020 GCCACCTGGTGTGCTGCTTTAGG + Intergenic
1074164437 10:110862516-110862538 TCACCCTGGGCTACTGCTCTGGG + Intergenic
1076057061 10:127384445-127384467 GAGCCCTGGGGTGCCGCTCTTGG + Intronic
1076564827 10:131391095-131391117 GCAACCTGTTGTGCTGCGATAGG - Intergenic
1082814581 11:57499667-57499689 GCCCCCTGGGCCGCTGCTCTTGG - Intronic
1087659984 11:100976063-100976085 GCTGTCTGGGCTGCTGCTATAGG - Exonic
1088460730 11:110080006-110080028 GCACCCTGGGTGGCTGAGATGGG + Intergenic
1092575792 12:9781712-9781734 GCACTCTGGGAGGCTGGTATAGG + Intergenic
1096549183 12:52360982-52361004 GCGCCCTGGGGTGGTGCTGTAGG + Exonic
1099573028 12:84348903-84348925 GGACCTTGGGGTGCAGGTATTGG + Intergenic
1100853984 12:98741903-98741925 GCTCCCTGGGGAGCAGCTGTTGG + Intronic
1101700346 12:107168189-107168211 GCACCCTGGTGCTCTGCTATAGG - Intergenic
1101838673 12:108312446-108312468 GGGTCCTGGGGTGCAGCTATGGG + Intronic
1107631276 13:42344854-42344876 GGACCTTGGGGTGATGCTGTTGG + Intergenic
1116887093 14:50231862-50231884 GCACTCTGCGCTGCTGCTAAAGG - Intergenic
1117158288 14:52962127-52962149 GCTACCTGGGATGCTGCAATGGG + Intergenic
1121505239 14:94472204-94472226 GGACCCTGGGCTGTTGCTATTGG - Intronic
1124579582 15:30941677-30941699 GCCCCCTGGAGGCCTGCTATGGG - Exonic
1125608714 15:40956905-40956927 GAACCCTGGTGTCCTGCTAAAGG + Intergenic
1126855601 15:52836049-52836071 GCACCCTAAGGTTCTGCTCTTGG - Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1137599530 16:49746849-49746871 GCACCGTGAGGTGCTGCTTCGGG - Intronic
1138185950 16:54977827-54977849 GCACCCTGAGCTGCTGGGATAGG - Intergenic
1138419064 16:56887451-56887473 GCACTCTGGGGGGCTGAGATAGG - Intronic
1140789787 16:78380399-78380421 GCACCCTGCGAAGATGCTATAGG + Intronic
1141064453 16:80902633-80902655 CCATCCTGGGGTGCTCCAATAGG - Intergenic
1143261036 17:5598337-5598359 GGACCTTGGGGAGCTGCTTTGGG + Intronic
1143475078 17:7197966-7197988 GCATCCTGTGGTGATGCTGTAGG - Intronic
1144703386 17:17352609-17352631 GCACCCTGGGGTGGCACTAATGG + Intergenic
1144783718 17:17820400-17820422 GCTGCCTGGGGAGCTGGTATCGG + Exonic
1145950890 17:28816026-28816048 GCACCTTGGGATGCTGAAATAGG + Intronic
1147619059 17:41851657-41851679 GCACCCTGGGAGGCTGATACGGG + Intergenic
1147767616 17:42847290-42847312 GCAGCATGGGCTGCTGCTGTGGG + Intronic
1151440333 17:74124634-74124656 GCACTCTGGGGGGCTGAGATGGG - Intergenic
1151815024 17:76467575-76467597 GCAGCCTGTGGTGCTGTTAGAGG - Intronic
1152274713 17:79349529-79349551 GCATCCTGGGGTGCTTCAATGGG - Intronic
1154349724 18:13572875-13572897 GCCCTCTGCGCTGCTGCTATCGG - Intronic
1157205185 18:45691940-45691962 GCACCCTGCGGCGCTGCCACAGG + Intergenic
1161156822 19:2736113-2736135 ACACTCTGGGCTGCTGATATGGG + Intronic
1162042168 19:7977617-7977639 GCTGCCTGGGCTGCTACTATGGG + Intronic
1163284495 19:16338044-16338066 GCAGGCTGGGGTGCTTCTATGGG - Intergenic
1163847176 19:19644142-19644164 GCTCCCTGGTGTGCTGTAATTGG - Intergenic
1165789675 19:38483827-38483849 GCCCCCTGGGGTGTTGATGTGGG - Intronic
1166130046 19:40740577-40740599 GAACCCTGGGGTGTGGCTAACGG + Exonic
1166517694 19:43459850-43459872 GGACCCGGGGGTGCTGCTGTTGG - Intergenic
1167000776 19:46745101-46745123 TTACCCTGGGGTGATGCTTTAGG - Intronic
1167383904 19:49153185-49153207 GGGCCCTGGGGTGGTGCTGTGGG - Intronic
1168107034 19:54172003-54172025 AGACCCTGGGGTGCTGCCTTGGG - Exonic
925184738 2:1839295-1839317 GCACCCGGAGGCGCTGCGATGGG + Exonic
925337643 2:3109474-3109496 GCCCACTGGGGTCTTGCTATGGG - Intergenic
925861058 2:8175496-8175518 TCACCCTGGGATGTTGATATTGG - Intergenic
930353307 2:50285338-50285360 GCACCCTGAGCTGCTGGGATAGG - Intronic
935111980 2:100103624-100103646 TCACACTGGGGAGCTGCTGTAGG - Intronic
935261847 2:101362587-101362609 GCACCCTGGGGTGTCCCTTTGGG + Intronic
936122991 2:109761526-109761548 TCACACTGGGGAGCTGCTGTAGG + Intergenic
936221695 2:110609938-110609960 TCACACTGGGGAGCTGCTGTAGG - Intergenic
936485025 2:112918108-112918130 GGACCCTGGCGTGCTGCTGTAGG + Intronic
937153124 2:119699615-119699637 GCACCCTGGGGTGGAGCCTTGGG - Intergenic
938440626 2:131328910-131328932 GCTGTCTGGGCTGCTGCTATAGG + Intronic
938761368 2:134429317-134429339 GCAGCCCTGGGTGCTGCTGTTGG + Intronic
938762789 2:134440551-134440573 GCACCCTGAGCTGCTGGGATAGG + Intronic
938978582 2:136504007-136504029 GCACCCTGAGCTGCTGGGATAGG + Intergenic
940272146 2:151902896-151902918 GAACCCTGGGTTGCTACTATCGG + Intronic
940893044 2:159054008-159054030 GCAGCATGGGATGCTGCTCTAGG + Intronic
1175620918 20:60446879-60446901 GCAGCGTGGGGTGCTGACATAGG + Intergenic
1178305370 21:31486537-31486559 GTGCCCTGAGGTGCTGCTCTGGG + Intronic
1178307822 21:31505091-31505113 ACACCATGGGATGCTGCTTTAGG - Intronic
1179980732 21:44894465-44894487 GCACCCTGGGCTGCTCCCCTGGG - Intronic
1182364082 22:29766349-29766371 GCACCCTGGGTAGCTGCTCTGGG - Intronic
1183457883 22:37932633-37932655 GCACCGTGGGGTGCTGCTGGAGG + Exonic
1184684536 22:46090181-46090203 GCACCCTGGAGAGCCGCCATGGG + Intronic
1184915298 22:47564765-47564787 GGCCCCTGGGGTGCTGCTGATGG + Intergenic
1185400227 22:50611687-50611709 GGTCCCTGCGGTGCTGCTCTGGG + Intronic
950544885 3:13632358-13632380 GTTCCCTGGGGTGCAGCTTTCGG + Intronic
950767011 3:15280390-15280412 GTACCCTGGGGTGCTGTTGTGGG - Intronic
954391255 3:50269223-50269245 GCACCCTGAGCTGCTGAGATGGG + Exonic
962592740 3:136907256-136907278 GGACCCTGTGGAGCAGCTATAGG + Intronic
964091961 3:152888120-152888142 GGGCCCTGGGGTGCGGCTACAGG - Intergenic
968678077 4:1896280-1896302 AAACCCTGGGGTCCTGCCATGGG + Intronic
969037453 4:4266159-4266181 GCTCCCTGGAGTGCTGGCATAGG + Intergenic
970353586 4:15230522-15230544 GCATCTTAGGGTTCTGCTATGGG - Intergenic
977276235 4:94980670-94980692 GCACCCTGAGCTGCTGAGATAGG + Intronic
978927018 4:114258999-114259021 CCACCCTGGGGTGATGCAGTGGG + Intergenic
980994616 4:139768720-139768742 GCACCATGGGGTGCTGCAGCAGG - Intronic
981300581 4:143181640-143181662 GCACCTTGGGATGCTGAGATGGG + Intergenic
982199968 4:152950596-152950618 GCACCGTGGGCTGCTCCTGTAGG + Intronic
985587130 5:746287-746309 GCACCCTGGGGAGCTGCCTGTGG + Intronic
986199457 5:5568237-5568259 GCACCCTGAGCTGCTGGAATAGG + Intergenic
986317655 5:6601409-6601431 GCACCCTGGGGACCTGCTGGAGG - Intronic
988658131 5:33234997-33235019 TCCTCATGGGGTGCTGCTATAGG + Intergenic
993489054 5:88523898-88523920 GCACTTTGGGGTGCTGAGATGGG - Intergenic
998206411 5:140159783-140159805 GCACCCTAGGGTGCAGCCAAGGG + Intergenic
999393998 5:151214980-151215002 ACACCCTGGGAAGCTGATATGGG - Intronic
1000226096 5:159263376-159263398 GCACCCTGGCGCGCTGCCCTTGG + Intronic
1001306129 5:170574697-170574719 GCACCCTGAGCTGCTGGGATGGG - Intronic
1006515220 6:34541836-34541858 TCCCCCTGGGGTGCTGCTCTGGG + Intronic
1009265615 6:61551018-61551040 GCAACCTGGGGAGCCGCAATAGG - Intergenic
1010447419 6:75963769-75963791 GCTCCCTGGAGTACTGCTACTGG - Intronic
1015257179 6:131191736-131191758 GCTCACTGGGGTGCTGGTACTGG + Intronic
1017518959 6:155184912-155184934 CTACCCTGGGCTGCTGTTATGGG + Intronic
1018363502 6:163096239-163096261 GCACCCTGGGGTGCTGCTATGGG - Intronic
1018713627 6:166515015-166515037 GCACCCTTGGCTGCTGCTGTGGG - Intronic
1023601632 7:41886624-41886646 GCACCCTGGGCTGCTTCCAGAGG + Intergenic
1024207378 7:47175531-47175553 GCTCCCTGGGATGCTGCTCTGGG - Intergenic
1030223983 7:107128396-107128418 TCACCCTGGGGTGATGGTAAAGG + Intronic
1032539873 7:132694164-132694186 GCACCCTGGGGTGATGCCTGTGG - Intronic
1035289407 7:157827995-157828017 GCAGCTTGGGGTGCAGCTCTGGG + Intronic
1036202918 8:6784353-6784375 GCAACCTGAGTGGCTGCTATGGG - Intergenic
1036640320 8:10579574-10579596 GAAGGCTGGGTTGCTGCTATGGG - Intergenic
1037684584 8:21128002-21128024 GCACCCTGAGCTGCTGGGATAGG + Intergenic
1040829527 8:51661700-51661722 GCTCCCTGGTGTGCAGCTGTTGG + Intronic
1043076463 8:75707623-75707645 TTACCCTGGGGTGGAGCTATTGG - Intergenic
1043317740 8:78942161-78942183 GCACCCTGAGCTGCTGAGATAGG + Intergenic
1048004985 8:130411891-130411913 GGACACTGGGGTGCTGCTCCTGG - Intronic
1048555306 8:135470197-135470219 GCATCCTGGCGTGCTGATAAAGG + Intronic
1049304508 8:141893774-141893796 GCACCCTGTGGGGCTGGTGTTGG - Intergenic
1055118657 9:72633385-72633407 TCACCCTGAGCTTCTGCTATAGG + Intronic
1055266424 9:74499331-74499353 GCCTCCTGGGGTGCTCCTCTAGG - Intronic
1058699461 9:107588603-107588625 GCACCCCAGGGTGCTGCTTCGGG - Intergenic
1060212052 9:121716610-121716632 GCACACTGGGGTGCTGGGACGGG - Intronic
1061267256 9:129514083-129514105 GCTCCCTGGGCTCCTGCTAGGGG + Intergenic
1187275282 X:17811344-17811366 GCACCCTCAGGTGCTGCTGCTGG + Intronic
1188729697 X:33631268-33631290 GCACCCTTGGGTGCTGGTGGAGG - Intergenic
1198708629 X:139477117-139477139 GCACCCTCAGTTCCTGCTATGGG + Intergenic
1200789886 Y:7290052-7290074 GCAACCTGGGAGGCTGCTGTGGG + Intergenic