ID: 1018364673

View in Genome Browser
Species Human (GRCh38)
Location 6:163107490-163107512
Sequence CAGTGTGCGCCGTGTGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018364673 Original CRISPR CAGTGTGCGCCGTGTGACTC AGG (reversed) Intronic
900618971 1:3578272-3578294 CAATGTGCGCCGCTTGACTTTGG - Intronic
902388274 1:16088437-16088459 CTGTGAGCGCTGTGTGACCCAGG - Intergenic
903474111 1:23607599-23607621 CAGTCTGAGCTGGGTGACTCTGG + Intronic
904237408 1:29124052-29124074 CTGTGCGCGCCTGGTGACTCCGG + Intergenic
908401051 1:63773662-63773684 CACTGTTAGCTGTGTGACTCTGG - Intergenic
912273602 1:108234002-108234024 CAGTGGGCGCAGGGTGACACAGG + Intronic
912294618 1:108460320-108460342 CAGTGGGCGCAGGGTGACACAGG - Intronic
917656370 1:177130273-177130295 CAGGGTGGTCCGTGTGACCCTGG + Intronic
1065357625 10:24857703-24857725 CTGTGTGCGCCATGTGCATCTGG - Intronic
1067223439 10:44360381-44360403 CAGTGTGCGCTGTGGGAGTCAGG - Intergenic
1076783426 10:132736949-132736971 CAGTGGGCGCCGTGAGGCTGTGG + Intronic
1077219431 11:1409102-1409124 CTGTGTGTGCCGTCTGACCCTGG + Intronic
1077369315 11:2174115-2174137 CAGTGTGGGCCATGAGCCTCCGG - Intergenic
1081782987 11:45726400-45726422 CTGTGTGCTCCATGTGGCTCAGG + Intergenic
1084570899 11:69959364-69959386 CCTTGTGAGCCGTGTGATTCTGG - Intergenic
1089169526 11:116502501-116502523 CAGTGTTTGCAGTCTGACTCTGG + Intergenic
1092237125 12:6817279-6817301 CAGTGTCTGCTGAGTGACTCGGG + Exonic
1097185895 12:57196124-57196146 CAGTGGGCGCTGTGTGGCTGAGG + Exonic
1099318702 12:81117851-81117873 CAGTTTGTGCCGTGAGATTCTGG + Intronic
1104940867 12:132394119-132394141 CAGTGGGCGCCGAGTCACCCGGG + Intergenic
1104940874 12:132394144-132394166 CAGTGGGCGCCGAGTCACCCCGG + Intergenic
1104940891 12:132394195-132394217 CAGTGGGCGCCGAGTCACCCCGG + Intergenic
1104940901 12:132394221-132394243 CAGTGGGCGCCGAGTCACCCGGG + Intergenic
1105892940 13:24695114-24695136 CACTGGGTGCTGTGTGACTCTGG - Intronic
1112431455 13:99354237-99354259 CAGTGTGAGCCGGGTGACATGGG + Intronic
1113743039 13:112724341-112724363 CAGGGAGGGCCCTGTGACTCAGG + Intronic
1116844479 14:49852621-49852643 CTGTTTGCGCCATGGGACTCCGG + Intronic
1117391952 14:55271282-55271304 CAGGGGGCGCCGTGAAACTCTGG + Exonic
1118642384 14:67804792-67804814 CATTGTGAGCTGTGTGACTTTGG + Intronic
1122205963 14:100148085-100148107 CACTGTGGCCCGTGTGACTCTGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124370049 15:29099386-29099408 CAGTGTGTCCTGTGTGACTGCGG - Intronic
1132650938 16:1021206-1021228 CCCTGTCCGCCGTGTGACTCGGG - Intergenic
1142302350 16:89266020-89266042 CAGCGTGCTCTGTGTGACACAGG + Intergenic
1143119375 17:4597511-4597533 CACTGAGTGCTGTGTGACTCTGG - Intronic
1144307982 17:13986668-13986690 CAGTGTGCAGCTTGTGCCTCAGG - Intergenic
1144839716 17:18178506-18178528 CCGTGTGAGCTGTGTGACCCAGG - Intronic
1149461938 17:56835288-56835310 CAGAATGCGCCGTGGGAATCAGG + Intronic
1151179379 17:72315273-72315295 CAGTGTGCTCATTGTGACTAGGG + Intergenic
1151927662 17:77210808-77210830 CAGTGTGTTTCGTGTGAATCGGG + Intronic
1163290733 19:16377533-16377555 CAGTGTGCCTCGTGTGACTGGGG - Intronic
1163625509 19:18387080-18387102 CCATCTGTGCCGTGTGACTCCGG + Intronic
1163747636 19:19057655-19057677 CTGGGTGAGTCGTGTGACTCAGG + Exonic
1165500247 19:36183500-36183522 CAGTGTGAGACGTGTGATGCTGG + Exonic
1167753292 19:51394073-51394095 CAGTGAGCGCCATCTGCCTCTGG - Intergenic
944225593 2:197346041-197346063 CAGTGAGGTGCGTGTGACTCAGG - Intergenic
948721584 2:239904186-239904208 CAGTGTGCCCCGGGGGACACTGG + Intronic
1171265841 20:23771845-23771867 CAGGGTGGGCTGTGTGACTTAGG + Intergenic
1172011292 20:31847396-31847418 CAGTGTCCAGTGTGTGACTCTGG - Intergenic
1175943327 20:62547791-62547813 CAGTGGGAGCCGTGTGAGACAGG + Intergenic
1184230323 22:43155227-43155249 CCGAGTGGGCCGTGTGGCTCAGG + Intronic
950236139 3:11321918-11321940 CAGAGTTGGCTGTGTGACTCGGG - Intronic
950409404 3:12825504-12825526 GAACGTGCGCCGTGCGACTCTGG + Exonic
951602757 3:24394706-24394728 CAGTGTGTGACCTGTGAGTCAGG - Intronic
953694575 3:45147325-45147347 CAGGTTGCTCCGGGTGACTCTGG - Intergenic
953774073 3:45800763-45800785 CACTGTGCCCCATGTCACTCAGG + Intergenic
961047832 3:123721624-123721646 CAGTGTGCACGCTGTGACCCAGG + Intronic
961270125 3:125681940-125681962 CAGTGTGCACTCTGTGACCCAGG - Intergenic
968608724 4:1547307-1547329 CAGTGTGGGCCCTGAGCCTCGGG + Intergenic
969247377 4:5944516-5944538 AAGAGTGGGCCATGTGACTCTGG - Intronic
972382264 4:38530023-38530045 CAGTGGGCGCAGAGTCACTCAGG - Intergenic
982141043 4:152318344-152318366 CAGTGTGCAACGTGTATCTCAGG + Intergenic
984022199 4:174499162-174499184 AAGTGTGCACGGTATGACTCTGG + Intronic
988829171 5:34970884-34970906 CAGTGTTCCCCAAGTGACTCAGG - Intergenic
998327869 5:141298130-141298152 CAGGGTGCCCCGTGTGAGGCTGG + Intergenic
998385597 5:141755434-141755456 CAGTGTGGGCCATCTCACTCAGG - Intergenic
1002940150 6:1708710-1708732 CAGTGAGCGCCGGGGGCCTCTGG + Intronic
1005375778 6:25181110-25181132 GAGTGGCCGCCGTGTCACTCTGG - Intergenic
1011640463 6:89412280-89412302 CAGTGTGTGTCAGGTGACTCGGG - Intergenic
1011921967 6:92589173-92589195 CAGCCTGCTCCGTGTGACACTGG + Intergenic
1018364673 6:163107490-163107512 CAGTGTGCGCCGTGTGACTCAGG - Intronic
1018975462 6:168561900-168561922 CAGTGAGAGCCTTGTGTCTCAGG - Intronic
1018975474 6:168562004-168562026 CAGTGAGAGCCTTGTGTCTCAGG - Intronic
1018975481 6:168562056-168562078 CAGTGAGAGCCTTGTGTCTCAGG - Intronic
1018975494 6:168562160-168562182 CAGTGAGAGCCTTGTGTCTCAGG - Intronic
1018975507 6:168562264-168562286 CAGTGAGAGCCTTGTGTCTCAGG - Intronic
1018975521 6:168562368-168562390 CAGTGAGAGCCTTGTGTCTCAGG - Intronic
1019559691 7:1649860-1649882 CAGTGTCCGCAGGGTGACACCGG + Intergenic
1025641194 7:63371458-63371480 CAGTCTTCCCAGTGTGACTCTGG - Intergenic
1036180425 8:6579873-6579895 CTGTGTGGGCAGTGTGACTGTGG - Intronic
1037987163 8:23297247-23297269 CAGTGAGCGCCCTGTCACCCAGG + Exonic
1038553779 8:28492137-28492159 CAGTGTGGATGGTGTGACTCAGG - Intergenic
1049606049 8:143529693-143529715 CAGAGAGCGCCGTGTGCCTGAGG + Intronic
1052562077 9:30097478-30097500 CACTGAGAGCTGTGTGACTCTGG + Intergenic
1062677970 9:137759472-137759494 CAGTGTGCGCCTGCTGTCTCTGG + Intronic