ID: 1018367756

View in Genome Browser
Species Human (GRCh38)
Location 6:163138768-163138790
Sequence CAGTGTTGCAATGAACAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018367756 Original CRISPR CAGTGTTGCAATGAACAGGT AGG (reversed) Intronic
902114216 1:14107575-14107597 CAGTGTTGCAGTTCTCAGGTGGG + Intergenic
905784843 1:40746646-40746668 CAGAGCTGCAATGAAGAGGAAGG - Intronic
909128799 1:71709039-71709061 CAGTGCTGCAATGAACATACAGG + Intronic
911412764 1:97530570-97530592 TAATGTTGCAGTGAACATGTGGG + Intronic
912545540 1:110448480-110448502 CAGTGTCACAGTGTACAGGTGGG + Intergenic
914398062 1:147289706-147289728 AAGTGTTGTAATGAGCAGTTGGG - Intronic
914988690 1:152480196-152480218 CAGCGCTTCAATGAACAGGAAGG + Intergenic
916897397 1:169179506-169179528 TAGTGTTGCAATGAACATACAGG - Intronic
917825190 1:178812471-178812493 CAATGGTGAAATGAACAGCTAGG - Intronic
921468036 1:215514917-215514939 TAGTATTGCAATAAACAGGAGGG - Intergenic
922050849 1:221989406-221989428 CACTGTGACAATGAACAGGTGGG + Intergenic
923426915 1:233879752-233879774 TAGTGCTGCAATGAACATATGGG + Intergenic
924576092 1:245282488-245282510 CCATGTTGCTAGGAACAGGTGGG - Intronic
924793501 1:247274856-247274878 CACTGTTGCAATGGAAAGGAGGG + Intergenic
1064476194 10:15691389-15691411 CAGTGCTGCCATGAACATGGGGG - Intronic
1065118843 10:22508499-22508521 CAGTGCTGCAATAAACATGCGGG + Intergenic
1069101299 10:64324335-64324357 TAGTGATGCAATGAACATGAAGG - Intergenic
1073983661 10:109183469-109183491 CAGTGTTGCAATAAAAATGGGGG + Intergenic
1075255491 10:120923278-120923300 CAGTCAGACAATGAACAGGTGGG - Intergenic
1078182208 11:9021437-9021459 CAGTGTTGCATTCATCTGGTTGG - Intronic
1079842658 11:25423840-25423862 TAGTGTTGCAATAAACATGGGGG - Intergenic
1080706483 11:34700061-34700083 CAGTGTTGCAACAAACATGGTGG + Intergenic
1081371083 11:42304460-42304482 TAATGTTGCAATGAACATATAGG - Intergenic
1082713468 11:56583967-56583989 TACTATTGCAATGGACAGGTAGG - Intergenic
1083598391 11:63931235-63931257 CAGTGTTTCAAGGAAGAGGGAGG + Intergenic
1084299756 11:68240407-68240429 TAGTGCTGCAATGAACATGTAGG + Intergenic
1086603797 11:88669086-88669108 CAATGCTGCAATGAACATGAGGG - Intronic
1087892866 11:103554766-103554788 TAGTGCTGCAATGAACATATGGG + Intergenic
1089205166 11:116755053-116755075 CAATGTTGCAATTAACAGACAGG + Intronic
1092110190 12:5955195-5955217 CAGTATTGCAATTAGCAGGCAGG + Intronic
1094095608 12:26700759-26700781 CAGTGGTCCAAGGAAGAGGTGGG + Intronic
1095408788 12:41899083-41899105 TAGTGTTGCAATAAACATGGAGG - Intergenic
1095691738 12:45097070-45097092 CAGTGTGCCAATAAACATGTTGG - Intergenic
1096052263 12:48620965-48620987 TAATGTTGCCATGAACAGGAGGG - Intergenic
1096750972 12:53758642-53758664 CAGGGTTGCAGTGAAAAGGGGGG - Intergenic
1098312735 12:69163826-69163848 CTGTGTTGCTATTAAGAGGTGGG - Intergenic
1100429106 12:94514546-94514568 CAGTGTTGAAAAGAAGAGCTTGG - Intergenic
1100945156 12:99774678-99774700 GAATGTTGCAATGAACAGAAGGG - Intronic
1103604511 12:122077214-122077236 CAGTGGTGCAATCACCATGTTGG - Intergenic
1104299341 12:127550079-127550101 CAGCATTGCAATGAACATATGGG + Intergenic
1104876785 12:132040412-132040434 CAGTGCTGCGATGAACACGAGGG - Intronic
1104956708 12:132470289-132470311 CAGTGCTGCGATGAACACGAGGG - Intergenic
1105958518 13:25306747-25306769 CAGATTTGCTATGAAAAGGTGGG - Intronic
1106281587 13:28278223-28278245 CAGTGTAACAAAGAACAGGTGGG - Intronic
1108263720 13:48683172-48683194 TAGTGCTGCAATGAACATATGGG + Intronic
1108728771 13:53210090-53210112 TAATGTTGCAATGAACATGGGGG - Intergenic
1110580817 13:77122770-77122792 CAGAATTGCAATTTACAGGTAGG - Intronic
1111335512 13:86816229-86816251 CAGTGCTGCAATAAACAAGAGGG - Intergenic
1111759230 13:92440544-92440566 CAGTGTGGCAATGAACATACAGG + Intronic
1112248858 13:97759965-97759987 TAGTGTTGCAATGAACCTGAGGG + Intergenic
1112782348 13:102914833-102914855 CAGTGATGGAGTGAACAGGCAGG - Intergenic
1112971045 13:105263128-105263150 GAGAGTTGCAATGTACAGCTAGG - Intergenic
1115054648 14:29108587-29108609 CAGTCTTGCAATGAACACCATGG + Intergenic
1116399195 14:44484381-44484403 CAGTGCTGCAATAAACATGGGGG + Intergenic
1116528567 14:45937053-45937075 TAGTGCTGCAATGAACATGAAGG - Intergenic
1116553926 14:46279053-46279075 TAGTGCTGCAATGAACACGGAGG + Intergenic
1117724755 14:58661747-58661769 CACAGTAGCACTGAACAGGTAGG - Intergenic
1117992764 14:61450995-61451017 TAGTGTTCCCATGAAGAGGTGGG - Intronic
1119512410 14:75221996-75222018 CAGTGATTCAATGAACAGACAGG - Intergenic
1119770561 14:77218409-77218431 CAGTGTGGAAATGTTCAGGTTGG - Intronic
1119927205 14:78506366-78506388 CAGTGCTGCAATAAACATGGGGG + Intronic
1120604475 14:86556995-86557017 TAATGTTGCAATGAACATGAGGG - Intergenic
1120626353 14:86831690-86831712 CAGTGGTGGAATGCTCAGGTGGG - Intergenic
1121546120 14:94764950-94764972 CAGTCTAGCAAAGAACAGTTAGG - Intergenic
1121628236 14:95402635-95402657 CAGTGCTGCAATAAACATGAAGG - Intergenic
1122255818 14:100475325-100475347 CAGTGCTGCAATGAATACGGGGG - Intronic
1202934720 14_KI270725v1_random:76487-76509 CACTGTTGCAATAAACATGGGGG - Intergenic
1125209317 15:37194564-37194586 TAGTGTAGCAATAAACATGTAGG - Intergenic
1129018941 15:72496822-72496844 CAGTGATGCAAAGGACAGGCGGG + Intronic
1130051562 15:80487799-80487821 CGGTCTTGCAATGCCCAGGTTGG - Intronic
1130966153 15:88699460-88699482 CAGTTTTACAATGGACAGCTGGG + Intergenic
1131460427 15:92613981-92614003 CCTTGTTACAATGACCAGGTGGG - Intergenic
1133484043 16:6201250-6201272 CAGTGCTGCAATGAACATAGAGG + Intronic
1134081490 16:11327970-11327992 CAGTGATGCAGTCAAGAGGTCGG - Intronic
1135090596 16:19512011-19512033 TAGTGTTGCAATAAACATGGGGG + Intronic
1135356791 16:21775576-21775598 TAGTGCTGCAATGAACATATGGG + Intergenic
1135455293 16:22591703-22591725 TAGTGCTGCAATGAACATATGGG + Intergenic
1137772813 16:51030662-51030684 GAGTGTTGCCATGAAAAGGTGGG + Intergenic
1138698266 16:58835849-58835871 TAGTGCTGCAATGAACATATGGG + Intergenic
1138783675 16:59820208-59820230 CAGTGCTGCAGTGAACATGGGGG - Intergenic
1141326546 16:83065277-83065299 CAGTGTAGTATTGCACAGGTAGG + Intronic
1141400353 16:83741960-83741982 CAATTTTTCCATGAACAGGTGGG - Intronic
1141924440 16:87158586-87158608 CAGTGCTGCAATAAACATGGGGG - Intronic
1142026857 16:87819089-87819111 CAGTGGTGAAATGAATAGATTGG - Intergenic
1143352840 17:6301575-6301597 GAGGGCTGCCATGAACAGGTCGG - Intergenic
1143975802 17:10828727-10828749 GAGGGTTGGAATGAACAGGTTGG - Intronic
1144031325 17:11325786-11325808 CAGTGGTACAATGAAGAGGTTGG + Intronic
1145271832 17:21408983-21409005 CAGTGATTGAATCAACAGGTGGG - Intronic
1147208878 17:38859326-38859348 CAGAGTTTTAAAGAACAGGTTGG - Intergenic
1150867652 17:68870787-68870809 TAGTGCTGCAATGAAAATGTGGG + Intronic
1150946141 17:69747882-69747904 CAGTGCTGCAATAAACATGGGGG - Intergenic
1152656709 17:81523278-81523300 CAGGGTTGGAATGAAGAGCTTGG - Intronic
1153512478 18:5870492-5870514 CAGTGTTGATCTGAAAAGGTAGG - Intergenic
1153641153 18:7158305-7158327 CTGGGTTGGAATGAACACGTTGG + Intergenic
1153827913 18:8893767-8893789 AAGTGTTTAAATGAAGAGGTTGG + Intergenic
1154935600 18:21052806-21052828 CAGTGTTTCTATGGACAGGATGG - Intronic
1155662382 18:28264855-28264877 TAGTGGTGCAATGAACACATGGG + Intergenic
1156424832 18:36998407-36998429 CAGTGGTGTACTGGACAGGTAGG - Intronic
1157016780 18:43724708-43724730 TAGTGCTGCAATGAACATATGGG - Intergenic
1157960781 18:52151317-52151339 TAGTGCTGCAAGGAACATGTGGG + Intergenic
1159444041 18:68518070-68518092 CAGTGCTGCAATGAAAATGAGGG + Intergenic
1159686324 18:71425041-71425063 TAGTGCTGCAATGAACATATAGG + Intergenic
1159957387 18:74529540-74529562 CAGTGGTGAAAGGAACAGGAGGG - Intergenic
1160311163 18:77791601-77791623 CTGTGTTTCAATGAACAAGGAGG - Intergenic
1161917467 19:7239641-7239663 CAATGCTGCAATGAACATCTTGG - Intronic
1162609088 19:11735553-11735575 CATGTTTGGAATGAACAGGTTGG + Intronic
1164443355 19:28297034-28297056 CAGTGCTGCAATGAACATAAGGG - Intergenic
1164877543 19:31702077-31702099 TATTGTTAGAATGAACAGGTAGG - Intergenic
1167593089 19:50414948-50414970 CAGTGAGGCAGTGACCAGGTTGG - Exonic
1167744852 19:51344704-51344726 TAGCGTTGCAATGAACAGCCTGG - Intergenic
1167753568 19:51395487-51395509 CATTGTGGCAATGAACAGCTAGG - Intergenic
1168318892 19:55497021-55497043 CAGTGCTGGAATTAACAGGTGGG + Intronic
1168696489 19:58406771-58406793 CTGTGGGGGAATGAACAGGTTGG + Intronic
925016594 2:531798-531820 CAGTGTTGCAAACAAGAGGATGG + Intergenic
926623154 2:15066901-15066923 CAATGCTGCAATGAACATGGGGG - Intergenic
927349388 2:22090519-22090541 CAGTGCTGCAATGAACATATGGG + Intergenic
927907223 2:26867782-26867804 CAGTGCTGCAGTGGACAGCTTGG + Intronic
928279978 2:29937423-29937445 CAGTGCTTCAATGAAGTGGTTGG - Intergenic
928332566 2:30368830-30368852 CATTGTTAAAATGAAGAGGTTGG + Intergenic
928896768 2:36274840-36274862 TAATGTTGCAATGAACATGGGGG - Intergenic
929438338 2:41946142-41946164 CAGACTTGCAATGAAAAGGAAGG + Intronic
929761849 2:44813737-44813759 CACTGTTGCTTTGACCAGGTTGG + Intergenic
931505991 2:62926886-62926908 CAGTGCTGCAATAAACACGGGGG - Intronic
931798433 2:65734548-65734570 TAGTGCTGCGATGAACATGTGGG + Intergenic
931901052 2:66788511-66788533 TAGTGTTGCAATAAACATATGGG + Intergenic
931917516 2:66973933-66973955 TAGTGCTGCAATAAACATGTGGG + Intergenic
932896110 2:75641728-75641750 CAATGCTGCAATCAAGAGGTTGG + Intergenic
932905408 2:75744627-75744649 CAGTGTTGCAATAAACATGGGGG - Intergenic
932914401 2:75839696-75839718 CAGTGCTGCAATAAACATATGGG - Intergenic
934043925 2:88155255-88155277 TAATGTTGCAATGAACATGGAGG - Intergenic
934323969 2:91992749-91992771 TAGTGTTGTAATGAACATGCGGG - Intergenic
935338545 2:102038812-102038834 TAGTGTTGCAATGAACATAATGG + Intergenic
935483824 2:103627748-103627770 TAGTGCTGCAATGAACATGGAGG - Intergenic
935683951 2:105667293-105667315 CAGTGCTGCAATGAACATTGTGG - Intergenic
936261656 2:110965268-110965290 TAGTGCTGCAATAAACATGTGGG + Intronic
937069508 2:119052445-119052467 CAGTGTTGTGATGAACATATTGG + Intergenic
939151867 2:138482868-138482890 TAGTGCTGCAATGAACATGCAGG - Intergenic
939827646 2:147034250-147034272 CAGGGTTGTAATACACAGGTAGG + Intergenic
939883285 2:147654206-147654228 CAGTGTTCCGATGGACTGGTTGG - Intergenic
940570254 2:155423172-155423194 TAGTGTTGCAATAAACATGGAGG + Intergenic
940866645 2:158824013-158824035 TAGTGTTGCAATGAATATTTTGG - Intronic
941416594 2:165228997-165229019 GAGATTTACAATGAACAGGTTGG - Intergenic
942547465 2:177079866-177079888 CTGTGGTGGAATGAAGAGGTTGG - Intergenic
942852138 2:180500125-180500147 TAGTGTTGCAATGAACATACGGG + Intergenic
943332299 2:186574263-186574285 CAGTGTTGCAGTGAACTGGTTGG + Intergenic
943955696 2:194186558-194186580 TAGTGCTGCAATAAACAAGTGGG + Intergenic
946967321 2:225050810-225050832 CAGTGTTGCAATAAACATGGGGG + Intergenic
947035268 2:225846274-225846296 CAGTGGGGCTGTGAACAGGTTGG + Intergenic
948280465 2:236743357-236743379 CAGTGTTGGAAAGAGCTGGTGGG - Intergenic
1168797114 20:618434-618456 CAGAGTTGCCAAGAACAAGTTGG + Intergenic
1169606668 20:7328581-7328603 CAGAGCTGCAATGAAGAGGGTGG + Intergenic
1170126017 20:12965134-12965156 TTGTGATGCAATTAACAGGTGGG - Intergenic
1172579003 20:36031822-36031844 CAGTGGTGAAATGAGCAAGTTGG + Intergenic
1172601838 20:36189412-36189434 CAGTGTGGCAAGGGATAGGTGGG - Intronic
1173310474 20:41892360-41892382 CAGTGTTCCACAGGACAGGTGGG - Intergenic
1173885461 20:46453868-46453890 GAGAGTTACAATGGACAGGTAGG + Intergenic
1174056919 20:47804382-47804404 CCATGTTGCCAGGAACAGGTCGG - Intergenic
1174339433 20:49886739-49886761 CAGTGTTGCCCTGAGCAGGGAGG - Exonic
1174806024 20:53605135-53605157 CAGTGTTTCAAAGAACAGCAAGG + Intronic
1174921839 20:54711617-54711639 CAGTGTTGCACTCAACTGGCAGG - Intergenic
1176358960 21:5976789-5976811 CAGTGCTGCAATAAACATGGGGG + Intergenic
1176596134 21:8698700-8698722 CACTGTTGCAATAAACATGGGGG - Intergenic
1176975895 21:15321489-15321511 TAGTGCTGCAATAAACATGTGGG + Intergenic
1179764558 21:43561761-43561783 CAGTGCTGCAATAAACATGGGGG - Intronic
1181963567 22:26640615-26640637 TAGTGCTGCAATGAACATGGGGG + Intergenic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
951476125 3:23108193-23108215 GAGTGTTCCAATGAACAAGGTGG - Intergenic
952677153 3:36046601-36046623 CAGTGTTGCAATAAACATGTGGG + Intergenic
953041632 3:39260356-39260378 TAGTGCTGCAATGAACATGGGGG + Intergenic
954584816 3:51724104-51724126 TAATGTTGCAATGAACATGGAGG + Intergenic
956298435 3:67740260-67740282 TAGTGTTGCAATAAACATGGGGG + Intergenic
958674213 3:97245728-97245750 CAGTGTGGCTATGAAGTGGTAGG + Intronic
959170218 3:102835425-102835447 TAGTGCTGCAATGAACATATAGG - Intergenic
959321412 3:104879951-104879973 CAGTATTGAAATGAAAAGGAGGG + Intergenic
964274391 3:154993616-154993638 TAGTGTTGCAATAAACATGGGGG - Intergenic
965516180 3:169623933-169623955 CATTGTTGGAATGAGCAGCTTGG - Intronic
965957149 3:174384756-174384778 TAGTGTTCCACTGAACAGGATGG + Intergenic
966077002 3:175948669-175948691 TAGTACTGCAATGAACATGTGGG - Intergenic
967755511 3:193164231-193164253 TTGTGCTGCAATGAACATGTGGG - Intergenic
967978591 3:195050072-195050094 TAGTGCTGCAATGAACAGTCAGG + Intergenic
969639759 4:8389723-8389745 CTTTGTTGCAGTGAACCGGTTGG - Exonic
970413032 4:15828761-15828783 TAGTGCTGCAATGAACATGGGGG + Intronic
971587629 4:28424661-28424683 CAGTGCTGCAATGCACATATGGG - Intergenic
971627822 4:28945960-28945982 CAGTGCTGCAATGAACATATGGG - Intergenic
971685776 4:29765183-29765205 TAGTGCTGCAATGAACATGTGGG - Intergenic
972123326 4:35732755-35732777 CAGTTTTGGATTGAACAGGTAGG - Intergenic
972415682 4:38838292-38838314 TAGTGCTGCAATGAACATGGAGG - Intronic
972830712 4:42810697-42810719 CAGTTTTGGAATGAGCAGATAGG + Intergenic
973091275 4:46140099-46140121 CAGTATTGCATTGTACAGATGGG + Intergenic
977009449 4:91618280-91618302 TAGTGATGCAATAAACATGTGGG - Intergenic
977101831 4:92825824-92825846 CAGTGTTGCTAAGAACATGAAGG - Intronic
980399802 4:132267483-132267505 CAGTGTTGCTTCGAAGAGGTTGG + Intergenic
980661713 4:135868781-135868803 TAGTGCTGCAATGAACATGCAGG + Intergenic
982699457 4:158643370-158643392 CAGTGCTGCAATAAACATGGGGG + Intronic
982990305 4:162265287-162265309 TAGTGCTGCAATGAACATGTAGG - Intergenic
983799801 4:171912988-171913010 TAGTGCTGCAATAAACATGTGGG + Intronic
983864433 4:172747713-172747735 TAATGTTGCAATGAACATGGGGG - Intronic
984106645 4:175556150-175556172 TAGTGTTGCAATAAACATGGGGG + Intergenic
985746162 5:1649255-1649277 CAGTGCTGCAGTAAACAGGGGGG - Intergenic
985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG + Intergenic
986060463 5:4185208-4185230 CAGTGCTACAATGAACATATCGG - Intergenic
986141802 5:5037874-5037896 CAGTGTTTCTCTGAGCAGGTAGG + Intergenic
986226522 5:5820355-5820377 AAGAGTTGCTAAGAACAGGTGGG - Intergenic
986268291 5:6209532-6209554 TAGTATTGCAATGAACATATGGG - Intergenic
986469321 5:8058645-8058667 CCGTCTTGCAATAAACAGGGAGG - Intergenic
986540957 5:8843373-8843395 CAGTCTTGCAATAAACAGGGAGG + Intergenic
986967258 5:13288858-13288880 AAGTGCTGCAATGAACATATGGG + Intergenic
987151955 5:15050990-15051012 CAGTGCTGCAATAAACACGGGGG + Intergenic
987584059 5:19831801-19831823 TAGTGCTGCAATGAACATATGGG - Intronic
988279893 5:29131329-29131351 GAGTGCTGCAATGAACATGCAGG - Intergenic
988734884 5:34010478-34010500 TAGTGCTGCAATAAACATGTGGG - Intronic
989983968 5:50674363-50674385 CAGTGTTTCAAAGTAGAGGTTGG - Intronic
990945692 5:61247026-61247048 CAATGTTGCAATGAACTTCTTGG - Intergenic
991287881 5:64999781-64999803 TAGTGCTGCAATGAACATGTGGG + Intronic
991570362 5:68047413-68047435 TAGTGCTGCAATGAACATGTGGG - Intergenic
992642907 5:78784367-78784389 TAGTGTTGCAATAAACATGGAGG - Intronic
993471978 5:88317373-88317395 TAGTGTTGCAATAAACATGAGGG + Intergenic
993918811 5:93774222-93774244 CTGTGTTTCAAGGAACAGGGAGG - Intronic
996083409 5:119279505-119279527 CAGAATTGCAATGAACAGTCGGG - Intronic
996313245 5:122131023-122131045 CATTATTGCACTCAACAGGTAGG + Intronic
997196200 5:131981701-131981723 CAGTGTTGCTATGAACATGATGG + Intronic
998673609 5:144381923-144381945 TAGTGCTGCAATGAACATATGGG - Intronic
999467972 5:151825056-151825078 CACTTTTGCAATGAAGATGTTGG - Intronic
1000589227 5:163137985-163138007 TAGTGCTGCAATGAACATGCAGG + Intergenic
1001547887 5:172581699-172581721 CAGTGTGGCATTGAGCAGGGTGG + Intergenic
1001667868 5:173448395-173448417 CAGTGCTGCAGTGAACATGGGGG + Intergenic
1003013308 6:2447006-2447028 TAGTGCTGCAATGAACATGGGGG + Intergenic
1005773625 6:29103921-29103943 TAGTGCTGCAATGAACATGGGGG + Intergenic
1005855092 6:29854492-29854514 CACTGCTGCAATGAACATGCTGG - Intergenic
1005927328 6:30454116-30454138 GAGTGTTGCCATGAAAAGGCTGG - Intergenic
1005930856 6:30482496-30482518 GAGTGTTGCCATGAAAAGGCTGG - Intergenic
1006285047 6:33086296-33086318 CAGTGTTACAATGCACAGAAAGG - Intronic
1007288857 6:40769085-40769107 CAGTATTGGAAAGACCAGGTAGG + Intergenic
1007815677 6:44523490-44523512 TAATGTTGCAATGAACATGGGGG + Intergenic
1008687337 6:53940276-53940298 CAGTGTGAAAATGGACAGGTGGG + Intronic
1009674066 6:66793975-66793997 TAGTGCTGCAATGAACATGCAGG - Intergenic
1010123592 6:72408043-72408065 TAGTGCTGCAATGAACATATGGG + Intergenic
1012486814 6:99730957-99730979 CAGTGTTGCATTGAATAGAAGGG + Intergenic
1012615536 6:101274369-101274391 CAGTGCTGCAATAAACATGGGGG - Intergenic
1012812071 6:103971762-103971784 CAGTGCTGCAATGAACATATAGG - Intergenic
1012890866 6:104895731-104895753 CAGTCTTGCATTGTACAGATGGG + Intergenic
1013496872 6:110706355-110706377 CATTGTTGTAAACAACAGGTTGG - Intronic
1013568418 6:111394075-111394097 CAGTGCTGCAATAAACATGGGGG + Intronic
1013679433 6:112507742-112507764 CAGTGATGCAAGGAACAGAAAGG - Intergenic
1013906793 6:115229957-115229979 CAGTGCTGCAATAAACATGGGGG + Intergenic
1014093631 6:117434963-117434985 TAGTGCTGCAATAAACATGTGGG + Intronic
1015327848 6:131944297-131944319 TAGTGCTGCAATGAACAGGAAGG - Intergenic
1015987707 6:138901055-138901077 CACTGATGCAATGAACTGGTAGG - Exonic
1016983141 6:149871485-149871507 CAGTGCTGCAATAAACATGGGGG + Intergenic
1017199964 6:151742201-151742223 TAGTGCTGCAATGAACACGGGGG + Intronic
1017342076 6:153335799-153335821 TAGTGCTGCAATGAACATATGGG + Intergenic
1017384239 6:153864452-153864474 CAGTGCTGCAATAAACATGCAGG - Intergenic
1018367756 6:163138768-163138790 CAGTGTTGCAATGAACAGGTAGG - Intronic
1018801003 6:167222122-167222144 CGGTGTGGGAAGGAACAGGTTGG + Intergenic
1018809131 6:167285049-167285071 CGGTGTGGGAAGGAACAGGTTGG - Intronic
1018946566 6:168350727-168350749 CAGTGCTGCAATAAACATGCAGG + Intergenic
1019031074 6:169012742-169012764 TAGTGCTGCAATGAACATATGGG + Intergenic
1019052819 6:169196643-169196665 CAGTGCTGCAATGAACACATGGG - Intergenic
1020761613 7:12274010-12274032 CAGTGCTGCAATGAACATGAGGG + Intergenic
1022869925 7:34466197-34466219 TAGTGCTGCAATGAACATGGGGG + Intergenic
1023548103 7:41340145-41340167 CAGTGCTGTAAGGAAGAGGTAGG + Intergenic
1025702993 7:63837036-63837058 TAGTGCTGCAATGAACATATGGG + Intergenic
1026161895 7:67876789-67876811 TAGTGCTGCAATGAACATATGGG + Intergenic
1027587237 7:80074082-80074104 TAGTGTTGCAATAAACATGGGGG - Intergenic
1028434316 7:90783971-90783993 CAGTGCTGCAATAAACATGGGGG - Intronic
1029054455 7:97726655-97726677 CAGTGCTGCAATGAACCTCTTGG + Intergenic
1030504578 7:110404370-110404392 TAGTGCTTCAATGAACATGTAGG - Intergenic
1030876776 7:114823189-114823211 CAGTTATAAAATGAACAGGTTGG + Intergenic
1031807331 7:126324072-126324094 CAGTGTTACTAAGAACAGGGTGG + Intergenic
1032627705 7:133610469-133610491 CAGTATTAAAATAAACAGGTTGG - Intronic
1033005839 7:137561123-137561145 CAGTGCTGCAATAAACATGGGGG - Intronic
1034874770 7:154715476-154715498 AAGTGTTCCAATGATAAGGTCGG - Intronic
1036444037 8:8806253-8806275 CAGTGTTGTAATGGACACTTGGG - Intronic
1037387052 8:18354216-18354238 TAGTGATGCAATGAACACGGTGG - Intergenic
1037500450 8:19480560-19480582 TAGTGCTGCAATGAACATATGGG + Intronic
1037568234 8:20135854-20135876 CATTGTTGGAATGAAAATGTTGG + Intergenic
1037676297 8:21053681-21053703 CATTGTAGGAATGAACAGGCAGG - Intergenic
1038107866 8:24456418-24456440 TAGTGTTGCAATGAATATGGGGG + Intronic
1038602237 8:28957112-28957134 TAGTGCTGCAATGAACACATGGG - Intronic
1038641081 8:29329048-29329070 GAGTGTTCCAGTGAACAGGATGG - Intergenic
1039244965 8:35598595-35598617 CAGTGCTGCAATGAACATGGGGG - Intronic
1039806350 8:41003141-41003163 CAGTGCTGCAATAAACATATGGG + Intergenic
1041602272 8:59733513-59733535 CAGTGTTTCATTGAACAACTAGG - Intergenic
1042352386 8:67790468-67790490 AAGTGCTGCAATGAATATGTGGG - Intergenic
1042359582 8:67867550-67867572 CAGGGTTCCAATGAAAGGGTGGG - Intergenic
1042783671 8:72522519-72522541 TAGTGTTGCAATAAACATGGGGG - Intergenic
1042903743 8:73752576-73752598 TAGTGCTGCAATGAACATGGGGG - Intronic
1045433004 8:102131392-102131414 TAGTGCTGCAATGAACATGGGGG + Intergenic
1046133845 8:110001101-110001123 TAGTGTTGCAATGAACATGGGGG + Intergenic
1046317883 8:112530963-112530985 CAGTGCTGCAATGACCTGGAAGG + Intronic
1046362856 8:113185037-113185059 AAGTGTTGGAATGAACTGCTGGG - Intronic
1050137501 9:2482198-2482220 CAGTGTGACAATGATCAGATAGG + Intergenic
1050399308 9:5234448-5234470 CAGTGAAGGAATGAACTGGTGGG + Exonic
1051131654 9:13868411-13868433 CAGTGCTGCAATAAACATGGAGG + Intergenic
1051429423 9:16966689-16966711 CAGTGCTGCAATGAACATGAGGG + Intergenic
1051567478 9:18516920-18516942 CTGTTTTGCAATGAACATCTGGG + Intronic
1051932755 9:22406446-22406468 CAGGGTTGCAGTGCACAGCTTGG + Intergenic
1052521974 9:29560461-29560483 CTGTACTGCAATGAACAGTTTGG + Intergenic
1052629073 9:31013827-31013849 TAGTGCTGCAATGAACATATGGG - Intergenic
1052760453 9:32585123-32585145 TAGTGCTGCAATGAACATGGGGG + Intergenic
1053031351 9:34781828-34781850 CACTCTTGCAATCAATAGGTTGG + Intergenic
1056165267 9:83935050-83935072 CAGAGTTGCAAGGAAAAGGAAGG + Intergenic
1056665092 9:88575300-88575322 CAGTGCTGCAATAAACATGGGGG - Intronic
1058327897 9:103721043-103721065 CAGTGTAGAAATGAACATGGGGG + Intergenic
1058413563 9:104762366-104762388 CAGTGCTGCAATAAACATGGGGG - Intergenic
1059330705 9:113533764-113533786 CAGTGTTCCCATGTAAAGGTGGG - Intronic
1059512017 9:114857376-114857398 AAGTGCTGCAATGAACATATGGG - Intergenic
1062257144 9:135632026-135632048 CAGTGTTGAAATGCAAAGGGAGG - Intronic
1185982858 X:4798770-4798792 CAGTGTTGCAATGATCTTTTAGG + Intergenic
1188146515 X:26620530-26620552 TAGTGTTGCAATAAACATGGGGG - Intergenic
1188148720 X:26646327-26646349 TAGTGGTGCAATGAACATATGGG + Intergenic
1188238517 X:27757193-27757215 CATTGTTGTAATGAACATGAAGG + Intergenic
1189956949 X:46285852-46285874 CAGTGCTGCAATCAACATGGGGG + Intergenic
1193868337 X:86764673-86764695 TAGTGCTGCAATGAACAAATGGG + Intronic
1193908507 X:87272666-87272688 CTGTGTTGCCATTAACAGGGAGG - Intergenic
1195090719 X:101456109-101456131 TAGTGCTGCAATGAACATATGGG + Intronic
1197841616 X:130753802-130753824 TAGTGTTGCAATGAACATGGTGG + Intronic
1198896834 X:141464715-141464737 CAATGTTGCAAAGGACAGGATGG - Intergenic
1199408855 X:147495638-147495660 TAGTGTTGTAATAATCAGGTAGG + Intergenic
1199409283 X:147501660-147501682 TAGTGTTGCAATAAACATGGAGG - Intergenic
1201960384 Y:19674656-19674678 TAATGTTGCAATGAACATGGAGG + Intergenic