ID: 1018370770

View in Genome Browser
Species Human (GRCh38)
Location 6:163165722-163165744
Sequence CCAGTTAGCTTCCCGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018370770_1018370777 0 Left 1018370770 6:163165722-163165744 CCAGGCTTCGGGAAGCTAACTGG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1018370777 6:163165745-163165767 AGGGAGGGAGCCTGGCAGAAAGG 0: 1
1: 1
2: 5
3: 103
4: 1257
1018370770_1018370782 11 Left 1018370770 6:163165722-163165744 CCAGGCTTCGGGAAGCTAACTGG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1018370782 6:163165756-163165778 CTGGCAGAAAGGGGAAAGCTGGG 0: 1
1: 0
2: 1
3: 26
4: 321
1018370770_1018370783 14 Left 1018370770 6:163165722-163165744 CCAGGCTTCGGGAAGCTAACTGG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1018370783 6:163165759-163165781 GCAGAAAGGGGAAAGCTGGGAGG 0: 1
1: 0
2: 6
3: 52
4: 727
1018370770_1018370778 1 Left 1018370770 6:163165722-163165744 CCAGGCTTCGGGAAGCTAACTGG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1018370778 6:163165746-163165768 GGGAGGGAGCCTGGCAGAAAGGG 0: 1
1: 0
2: 2
3: 80
4: 833
1018370770_1018370781 10 Left 1018370770 6:163165722-163165744 CCAGGCTTCGGGAAGCTAACTGG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1018370781 6:163165755-163165777 CCTGGCAGAAAGGGGAAAGCTGG No data
1018370770_1018370776 -8 Left 1018370770 6:163165722-163165744 CCAGGCTTCGGGAAGCTAACTGG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1018370776 6:163165737-163165759 CTAACTGGAGGGAGGGAGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 303
1018370770_1018370779 2 Left 1018370770 6:163165722-163165744 CCAGGCTTCGGGAAGCTAACTGG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1018370779 6:163165747-163165769 GGAGGGAGCCTGGCAGAAAGGGG 0: 1
1: 0
2: 3
3: 57
4: 581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018370770 Original CRISPR CCAGTTAGCTTCCCGAAGCC TGG (reversed) Intronic
901020252 1:6251696-6251718 CCAGGTAGCTCCCGGAAGGCGGG - Intronic
903548451 1:24141582-24141604 GCAGTTAGCTTCCTGAAGTGGGG + Intronic
904848454 1:33438764-33438786 CCAGATTGCTTCCCTAACCCGGG + Intergenic
905506010 1:38480347-38480369 CCAGTTAGGCTCCCAAGGCCTGG - Intergenic
911193741 1:94973214-94973236 CCAGTTAGCTTCCACACGCATGG + Intergenic
911219559 1:95233426-95233448 CCAGTCAACATCCTGAAGCCAGG + Intronic
914792393 1:150889702-150889724 CCAGTTATCTTCCTGAAGTATGG + Intergenic
916704069 1:167328659-167328681 CCAGTTAGGTCCAAGAAGCCAGG + Intronic
918433294 1:184484506-184484528 CTGGTTAGCTCCCCGAAGGCAGG + Intronic
1069513249 10:69057516-69057538 CCAGTTAGTTTCCCCCAGCATGG - Intergenic
1075022404 10:118961407-118961429 CCAGTGAGGTTCCTGAAGCCTGG + Intergenic
1078090852 11:8263442-8263464 CCCGCTAGCTGCCCGAAGACCGG - Exonic
1080663377 11:34315183-34315205 CCAGTTAGTTTCCAAATGCCAGG - Intronic
1084492351 11:69485789-69485811 CCACTCTGCTTCCTGAAGCCAGG + Intergenic
1087751681 11:102013690-102013712 CCAGGTAACTGCCAGAAGCCAGG + Intergenic
1088466644 11:110147058-110147080 GCAGTCAGCTTCCTGAGGCCAGG + Intronic
1089079410 11:115763319-115763341 CCAGCTAGATTCCCAAAGCCAGG + Intergenic
1090974141 11:131667555-131667577 CCAGTGAGCTTCCCAGAACCTGG + Intronic
1097819765 12:64116853-64116875 CCAGGTAGCTTCCCATAGCATGG - Intronic
1104363000 12:128151694-128151716 CCAGTTAGCTATGCGAAGGCAGG - Intergenic
1118330959 14:64815717-64815739 TCAGTTCCCTTCCCCAAGCCAGG + Intronic
1119442634 14:74638487-74638509 ACAGTGAGGTTCCCGAATCCTGG - Intergenic
1120918238 14:89729461-89729483 CCAATTAACATCCCTAAGCCAGG - Intergenic
1130110657 15:80961075-80961097 CCAGTTACCACCCCTAAGCCTGG - Intronic
1131071789 15:89470817-89470839 CCAGTTGGCTTCTCAAAGCAGGG - Intergenic
1135510311 16:23077391-23077413 CCAGTAATCTTCCCCAACCCCGG + Intronic
1138822746 16:60281356-60281378 CCAGTAAGCTTCCTGAAAGCAGG + Intergenic
1141932894 16:87217439-87217461 CCTGACAGCTTCCCCAAGCCAGG + Intronic
1149132182 17:53316164-53316186 TCACTGAGCTTCCCGACGCCAGG - Intergenic
1157257030 18:46148740-46148762 CCTGTTAACTACCCGAAGTCTGG + Intergenic
1158703080 18:59766681-59766703 CCAGTCATCCTCCTGAAGCCTGG + Intergenic
1161686644 19:5706020-5706042 CCACCCAGCTTCCCGGAGCCAGG - Intronic
1161769419 19:6223244-6223266 GCAGTTGGCTTCCCGAAGCCAGG - Intronic
1162303367 19:9856895-9856917 CCGGTCAGCTTCCCACAGCCTGG + Exonic
1167334003 19:48873535-48873557 GCAGTTCCCTTCCTGAAGCCTGG + Exonic
927458283 2:23276172-23276194 CCAGTGAGCATCCTGAAGGCAGG - Intergenic
929125951 2:38522983-38523005 CCAGTTCTCTTCCCGTACCCAGG + Intergenic
931235299 2:60407636-60407658 CCAGTCTGCTTCCAGAATCCAGG + Intergenic
940005159 2:149003393-149003415 CCAGTCAGCTGCCCGGGGCCAGG - Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
947110270 2:226710794-226710816 CCACTTAGTTTCCCTAAGCCTGG + Intergenic
948111074 2:235456451-235456473 CCACTCAACTTCCCGAGGCCTGG + Intergenic
1169471162 20:5886786-5886808 GCAGTTAGCTTCCAGGAGCATGG + Intergenic
1169476856 20:5939631-5939653 CCATGAAGCTTCCTGAAGCCAGG - Intronic
1172681257 20:36717343-36717365 TCCTTTAGCTTCCTGAAGCCTGG + Intronic
1173386239 20:42590592-42590614 CTTGTTACATTCCCGAAGCCTGG - Intronic
1175463658 20:59174200-59174222 CCAGCTAGCCTCCCGTGGCCAGG - Intergenic
1176145589 20:63563982-63564004 CCAGTTTGCTGCCCGCACCCAGG - Exonic
1179397759 21:41057037-41057059 CCAGTGTGCTTCCCAATGCCTGG - Intergenic
1179409156 21:41148924-41148946 CCAGTTAGCTTGCAGAAGTGGGG - Intergenic
1181497006 22:23292989-23293011 CCTCTTGGCTTCCGGAAGCCTGG + Intronic
1182320727 22:29477277-29477299 GGAGTTATCTTCCCAAAGCCTGG - Intergenic
954460197 3:50622104-50622126 CCAGTTGGCTTCCGTGAGCCAGG + Intronic
961551062 3:127670972-127670994 CCAGTCAGCTTCCTGATGCCAGG - Intronic
961676248 3:128568758-128568780 CCAGCTAGCCCCCCGAAGCCTGG + Intergenic
964122789 3:153203715-153203737 CCATTTAGCATCCCTAACCCTGG - Intergenic
965288596 3:166847993-166848015 CCAGTTAGCTTCATGATGACAGG - Intergenic
965660594 3:171037923-171037945 CCAGTTAGCTTCCCTCTGTCTGG + Intergenic
968829459 4:2925222-2925244 GCAGCTACCTTCCAGAAGCCAGG - Intronic
969450530 4:7270392-7270414 ACAGGTGGCTTCCCGGAGCCGGG - Intronic
977006544 4:91573635-91573657 CCTGGTAGCATCACGAAGCCAGG - Intronic
999323762 5:150630599-150630621 CCAGTTGGCTCCCCCATGCCTGG + Intronic
1000281482 5:159786253-159786275 CTAGTTATCATCCCGACGCCTGG + Intergenic
1015101053 6:129481272-129481294 ACAGTTAGCTTTCCTAAGCCTGG + Exonic
1018370770 6:163165722-163165744 CCAGTTAGCTTCCCGAAGCCTGG - Intronic
1022260038 7:28695347-28695369 CCAGTGAGCTTCCTGGTGCCAGG + Intronic
1023358959 7:39396569-39396591 TCAGATGGCTTCACGAAGCCTGG - Intronic
1027960488 7:84939952-84939974 CCAGGAAGCTTCGGGAAGCCTGG - Intergenic
1049242255 8:141543922-141543944 CCAGGAAGCTTCCCGAGGCTGGG + Intergenic
1052736225 9:32345215-32345237 CCAGTTAGGTTGCCGCAGTCCGG - Intergenic
1060279180 9:122204605-122204627 CCAGGTCGGTTCCCGAGGCCTGG - Exonic
1062475994 9:136727880-136727902 CCAGGAAGCTTCGGGAAGCCTGG - Intergenic
1189655510 X:43240496-43240518 CAAGTTAGCTTTTAGAAGCCTGG + Intergenic
1199218830 X:145293459-145293481 CAAGTTAGTATCCCGAAGCCAGG + Intergenic
1201605365 Y:15778390-15778412 CTATTGAGCTTCCTGAAGCCAGG - Intergenic