ID: 1018370843

View in Genome Browser
Species Human (GRCh38)
Location 6:163166254-163166276
Sequence TTGTTGTTGAGCAGGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018370843_1018370846 4 Left 1018370843 6:163166254-163166276 CCATTTGCCCTGCTCAACAACAA 0: 1
1: 0
2: 1
3: 16
4: 192
Right 1018370846 6:163166281-163166303 AAAAAAATGTAGATTAGAATCGG 0: 1
1: 0
2: 5
3: 90
4: 932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018370843 Original CRISPR TTGTTGTTGAGCAGGGCAAA TGG (reversed) Intronic
900988466 1:6086732-6086754 TTGGGCTTGAGCAGCGCAAAGGG - Intronic
901067268 1:6500272-6500294 TTGTTGGGGAGCAGGAAAAAGGG + Intronic
901248788 1:7756457-7756479 TAGTTTGTAAGCAGGGCAAAAGG + Intronic
901856176 1:12045518-12045540 TTGTCGGTGACCAGGGCAGAGGG - Intergenic
902345826 1:15816657-15816679 TTGTTGTTGAACAAGGCAGTGGG + Intergenic
902844479 1:19099104-19099126 TTATTCTTGAGGAGGGGAAAAGG - Intronic
903804329 1:25993737-25993759 TTGTTGTTGAGGTCTGCAAATGG + Intronic
904026938 1:27509870-27509892 TTGTTGCTGAGCTGGGAGAAGGG + Intergenic
904846900 1:33426663-33426685 TTGCTGGTGTGAAGGGCAAAAGG - Intronic
909294455 1:73929453-73929475 TTGTTTTTGAGCACTGAAAAGGG + Intergenic
910447725 1:87315716-87315738 TTGATGTGGACCAGGGCAAATGG - Intergenic
911282761 1:95951861-95951883 TTTCTGTTGAGCAGGGTAATAGG + Intergenic
913219431 1:116647457-116647479 TTATTGTTGAGCAGAGCCAGGGG - Intronic
916745117 1:167679333-167679355 TGGTAGATGAGCAGGTCAAATGG + Intronic
917691810 1:177477499-177477521 TTCTTGTTGAGAAGGGCATTTGG - Intergenic
918012852 1:180603748-180603770 TTGTGGTTGCACAGGGCCAAAGG + Intergenic
919600720 1:199619084-199619106 CTGTTGTCAAGCTGGGCAAATGG + Intergenic
919799074 1:201341120-201341142 TTCTTGTTGTGCAGGTCTAATGG + Intergenic
920503659 1:206501330-206501352 TAGTGGATGAGCAGGGCACAGGG + Intergenic
924374457 1:243390745-243390767 TTGTTGTTGAGTCAGGCAAGTGG - Intronic
924719764 1:246611171-246611193 CTGCTGTTGAGCTGGGGAAAGGG + Intronic
1064239179 10:13609667-13609689 TTGTAAATGAGCTGGGCAAACGG + Intronic
1064249957 10:13699420-13699442 TTGTTGTTGAACAGGCTAACAGG - Intronic
1067924703 10:50496522-50496544 TTGTTGAGGAACAGGACAAATGG - Intronic
1071143884 10:82544422-82544444 TAGTTGTAGGGCAGGGGAAATGG - Intronic
1071380949 10:85058988-85059010 CTGTTGTTGAGTAGGGGAGAAGG + Intergenic
1075279124 10:121123650-121123672 CTGTTGTTGAGTAGGTCAATTGG - Intergenic
1075343423 10:121664948-121664970 TTGCTGTTGAGGATGCCAAATGG + Intergenic
1075382367 10:122029782-122029804 TTGTTAATGAGCAGGACTAAAGG - Intronic
1075796925 10:125127262-125127284 TTGTTGATGAGCACTGCAAGGGG - Intronic
1076150582 10:128159230-128159252 GTGTGGGAGAGCAGGGCAAAGGG + Intergenic
1079662962 11:23064745-23064767 TTGTTGGTGAGAAGGTAAAATGG - Intergenic
1082803594 11:57432347-57432369 TTGTTGTGGAAAAAGGCAAAGGG + Intergenic
1085473892 11:76776476-76776498 TTATTGTAGAGCAGGTCTAATGG + Intergenic
1085527593 11:77173317-77173339 TGGTGGTTGAGCTGGGCCAAAGG - Intronic
1085698485 11:78725999-78726021 TTTTTGTTTGGCAGGGCACAAGG + Intronic
1085788960 11:79479219-79479241 TTGTTGTGGAGGAAGGCAAAGGG - Intergenic
1088603116 11:111501078-111501100 TTGTTCTTGAGCTGGGCAGATGG + Intronic
1089252667 11:117176319-117176341 TTGTAGTTATGCTGGGCAAATGG - Intronic
1089792994 11:120957900-120957922 TTGTTGTTTATCAGGGATAATGG - Intronic
1090310492 11:125732452-125732474 TTGGGTTTGTGCAGGGCAAAAGG - Intergenic
1090612083 11:128480286-128480308 TTGTGGTTGGGCAGGGCAGCCGG + Exonic
1091384292 12:82924-82946 CTGTTGTTCAGCAGGGGATAGGG + Intronic
1092386499 12:8039604-8039626 TTATTGTGGAGCAGGGCCAAGGG - Intronic
1093084454 12:14851336-14851358 TTGTTGTAAGGCAGGGCAAGGGG - Intronic
1094056878 12:26277319-26277341 TTGTTGTTGAGAAGGGCAGTGGG + Intronic
1096099473 12:48960725-48960747 TTGTTGTTGTTCATGTCAAATGG + Intergenic
1096764542 12:53873026-53873048 TTGGTGCTGAGCAGAGCAGAAGG + Intergenic
1098714325 12:73810541-73810563 TTTTTGTTAGGAAGGGCAAATGG + Intergenic
1099123754 12:78726334-78726356 ACGTTGTTAGGCAGGGCAAAGGG - Intergenic
1099306536 12:80963666-80963688 TTGATGCTGAGCAAAGCAAAGGG + Intronic
1102449945 12:113034113-113034135 TTGTTGGTGAGAAGTGGAAATGG + Intergenic
1102716192 12:114975035-114975057 TTTTTGTAGAGCTGTGCAAAAGG + Intergenic
1104203493 12:126614762-126614784 TTGTTGTTGTGCAGGGTAGAAGG + Intergenic
1108710452 13:53027904-53027926 GAAATGTTGAGCAGGGCAAATGG + Intergenic
1109738450 13:66518776-66518798 CTGTTGTTGGGAGGGGCAAAGGG + Intronic
1111738393 13:92171520-92171542 TTTTAGTTGAGAAGGGGAAATGG - Intronic
1111752154 13:92346269-92346291 CTGCAGTTGAGCAGGGCTAAGGG - Intronic
1113157303 13:107338407-107338429 TTTTTGTTGAGAAAGGCGAAAGG - Intronic
1116904112 14:50388669-50388691 TTTTTGCTGAGGAGGGCAGAGGG - Intronic
1120994641 14:90407443-90407465 TAGGTGTTGAGCGAGGCAAATGG + Exonic
1125792473 15:42378539-42378561 TTCTTGTTTAGCATGGCTAAAGG + Intronic
1128107580 15:65055929-65055951 TTCATGGTGAGGAGGGCAAAAGG + Intronic
1128731810 15:70026377-70026399 TAGTTGTAGAGCAGGGAGAATGG - Intergenic
1130517369 15:84636356-84636378 TGGTTGGTGGGAAGGGCAAAAGG + Intergenic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1135102946 16:19622902-19622924 TTGTTGTGGAGGAGGACACATGG - Intronic
1139224296 16:65218983-65219005 TTGTTGTTGAGGAGGACAACTGG + Intergenic
1140487932 16:75308894-75308916 TTAATGGTGAGCAAGGCAAAGGG - Intronic
1140541233 16:75758309-75758331 TTATTGTAGAGCAGAGGAAAAGG + Intronic
1140710021 16:77668992-77669014 TTGTTGTTCAGAAGGAGAAAGGG - Intergenic
1141707572 16:85676325-85676347 TTGTTATTGTGGAGGGCAAGGGG - Exonic
1144472477 17:15557077-15557099 TTGGTGGTGAGCAGGGCATGGGG - Intronic
1144582295 17:16465830-16465852 TTGTTGCTTAGGAGGGGAAAAGG + Intronic
1144924000 17:18787611-18787633 TTGGTGGTGAGCAGGGCATGAGG + Intronic
1145924023 17:28632781-28632803 TTGTTTTTTGGCAGGGGAAAGGG - Intronic
1146545394 17:33733938-33733960 GTGTTGTTCAGCAGTGCCAAGGG - Intronic
1146600198 17:34207602-34207624 TTGTTGTTGAGAAGGTAAAATGG - Intergenic
1147026012 17:37584100-37584122 CTGTTTTAGAGCAGGGTAAAGGG - Intronic
1148632178 17:49119770-49119792 TTGACGTGGAGCAGGGCAAAGGG - Intergenic
1148848214 17:50541328-50541350 CTGTGGGTGAGCAGGGCAAGGGG + Exonic
1149516500 17:57284867-57284889 TTCTGGTTGAGGAGGGCATAGGG - Intronic
1150431275 17:65119489-65119511 TTCTTGTTGAGTAGTGGAAAGGG + Intergenic
1151295134 17:73179717-73179739 ATGTAGCTGAGCAGGGGAAAAGG + Intergenic
1153673673 18:7436592-7436614 GTGTGGTTGAGCAGGACAAGGGG - Intergenic
1154384251 18:13879404-13879426 TGGTTGTTGAGTAGGGACAATGG + Intergenic
1156721502 18:40075765-40075787 TTGGTGTTTGGCAGGGGAAATGG - Intergenic
1157797350 18:50587435-50587457 TTTTTGTTGTGCAGCCCAAATGG + Intronic
1158081918 18:53602457-53602479 GTGTTGTTGAGCATTGCAGATGG - Intergenic
1159584706 18:70272658-70272680 ATGTTGATAAGAAGGGCAAAAGG - Intergenic
1161086705 19:2338797-2338819 TTGTAGCTGAGCAGGGCCACGGG - Exonic
1161607255 19:5222054-5222076 TTGTAGTTCAGCAGGGCTTAAGG - Intronic
1164556903 19:29260196-29260218 TTGACGCTGAGCAGGCCAAAGGG - Intergenic
926938437 2:18110658-18110680 TTGTTTTGGAGGAAGGCAAAAGG + Intronic
927859828 2:26553694-26553716 TTTTTATTGAGCAGGGGAAATGG - Intronic
928829526 2:35463108-35463130 CTGTTGTTGAGCAGGTTAATAGG + Intergenic
928875568 2:36034642-36034664 AAATTGTTGAGCATGGCAAAAGG + Intergenic
929020544 2:37548242-37548264 GTGTCTTTGAACAGGGCAAAGGG + Intergenic
933803784 2:85983376-85983398 TCGTTGTTGAGTATGTCAAATGG - Intergenic
935110486 2:100089827-100089849 TTAATGTTGGGAAGGGCAAAGGG - Intronic
935391575 2:102558664-102558686 TTCTTATAGAGCAGGGCAAGAGG + Intergenic
935801720 2:106703721-106703743 TTGTTGAATAGCAGGGGAAATGG - Intergenic
936124489 2:109775374-109775396 TTAATGTTGGGAAGGGCAAAGGG + Intergenic
936220200 2:110596082-110596104 TTAATGTTGGGAAGGGCAAAGGG - Intergenic
936439057 2:112534413-112534435 CTGTTGTGGAGCTGGGGAAAGGG - Exonic
938790654 2:134672793-134672815 TAATGGATGAGCAGGGCAAAGGG - Intronic
941902514 2:170691901-170691923 GTGTTGTGGAGCACAGCAAAGGG + Intergenic
944538057 2:200730759-200730781 TTTTGGTTGAACTGGGCAAATGG + Intergenic
945464460 2:210151367-210151389 TTGTTGTTGAGAAGAGCTAATGG - Intronic
1173861272 20:46285225-46285247 TTGTTCTCGAACAGGCCAAATGG + Intronic
1174582239 20:51580119-51580141 AGGTTGTTGAGCAGGGGAAAGGG - Intergenic
1175056424 20:56202872-56202894 GTGTTGTTTAACAGAGCAAACGG + Intergenic
1175493082 20:59392233-59392255 TTGTAGTTGAGCAGGGCAGGGGG - Intergenic
1178475889 21:32936873-32936895 TTGTTTGTGACCTGGGCAAATGG - Intergenic
1178829284 21:36041631-36041653 TTGATGTTGTGGAGGACAAAAGG - Intronic
1179936043 21:44603769-44603791 GCATTGTTGACCAGGGCAAATGG - Intronic
1180820721 22:18825512-18825534 TTATTGTTGAGCAGAGCCAGGGG - Intergenic
1181192253 22:21150535-21150557 TTATTGTTGAGCAGAGCCAGGGG + Intergenic
1181206944 22:21259984-21260006 TTATTGTTGAGCAGAGCCAGGGG - Intergenic
1182024958 22:27110911-27110933 TTGTTGTTCAGAAGGGGGAAGGG + Intergenic
1184438527 22:44495122-44495144 CAGTTGTTCAGCAGGGCAATTGG + Exonic
1185363354 22:50422705-50422727 ATGCTGCTGAGCAGGGCAAAGGG - Intronic
1203219979 22_KI270731v1_random:35439-35461 TTATTGTTGAGCAGAGCCAGGGG + Intergenic
1203270847 22_KI270734v1_random:51387-51409 TTATTGTTGAGCAGAGCCAGGGG - Intergenic
949891627 3:8737647-8737669 GTGTTGGTGAGGAGGGCAAGTGG - Intronic
950049254 3:9974116-9974138 TTCTCGTTGAGCAGGATAAAGGG - Intronic
955868138 3:63407726-63407748 TTGTTGGAGAGCAAGACAAATGG + Intronic
956289514 3:67646935-67646957 TTGTTCTTGAGGAGGGCAATAGG - Intronic
957861079 3:85951025-85951047 TTGTTGTTGAGACTGGCAACAGG + Intronic
959652611 3:108766101-108766123 TTGTTGTTTGGCAGGGTAATTGG + Intergenic
960258755 3:115540556-115540578 TTATTGTTGAGCAAAGAAAATGG - Intergenic
960659662 3:120043872-120043894 TTGTTGTAGGGCAGGGTAGAAGG - Intronic
960998211 3:123353207-123353229 TTGTTGGGGAGCGGGGGAAATGG - Intronic
963704925 3:148674903-148674925 TTATTGTTGAGTAAGCCAAATGG - Intergenic
966093356 3:176167636-176167658 TTATTGTTGAGGAGAGCAGAGGG + Intergenic
969925046 4:10577447-10577469 TTGCTGTTTAGCTGGGCACATGG + Intronic
973685374 4:53364842-53364864 TTGTTGTTTAACAAGGCAATGGG + Intronic
973755381 4:54068625-54068647 TTGTTGTTAAGCAGGAGAATAGG - Intronic
973994245 4:56440491-56440513 TTGCTGTTGGGCAGGGGAAGGGG - Intronic
974783071 4:66579971-66579993 CTGTTGTTGAGCATTGTAAATGG - Intergenic
974826280 4:67134746-67134768 TTGTTGTAGTACAGGGAAAAAGG - Intergenic
975117736 4:70697841-70697863 CTGCTGTAGAGCAGGGCAACTGG + Intergenic
978975957 4:114872922-114872944 TTGTTGTTGAAAAGGGCAAAAGG - Intronic
980185356 4:129454377-129454399 TTGTTGTTAAGATAGGCAAATGG - Intergenic
980678134 4:136117433-136117455 TTGATGTTCAGCTTGGCAAAGGG - Intergenic
980984892 4:139685605-139685627 TTTTTGTTGACAAGGGAAAATGG - Intronic
981076538 4:140598195-140598217 TTGTTGTCGGGCAGGGTAGAAGG + Intergenic
981813203 4:148798891-148798913 TTGGTGATGAGGAGGGTAAAGGG + Intergenic
983631724 4:169856117-169856139 TTGTTGGTGAGCATGTAAAATGG + Intergenic
984201915 4:176733359-176733381 ATGTTCTTTAGCTGGGCAAATGG + Intronic
984769721 4:183426927-183426949 ATGATGCTGAGCTGGGCAAATGG - Intergenic
986004007 5:3652517-3652539 GTGTTGTTGGGCAGGGAAAGTGG + Intergenic
986622888 5:9693878-9693900 TTGTTGTTGAGCATAACAACTGG - Intronic
992518173 5:77518435-77518457 TTATTATTCTGCAGGGCAAATGG + Intronic
997292836 5:132749724-132749746 CTGCTGTTGAGCAAGGAAAAAGG + Intronic
997808029 5:136938987-136939009 TCTTTGGGGAGCAGGGCAAAGGG + Intergenic
998303192 5:141046390-141046412 TTGTGTGGGAGCAGGGCAAAGGG + Intergenic
999352737 5:150891850-150891872 TTGTTGTTGAGAAGACCAACAGG - Intronic
999857556 5:155611397-155611419 TTATTGTTGCTCAGGGCAACTGG + Intergenic
1000466370 5:161582743-161582765 TTGTTGATCACCAGGGCAGAGGG - Intronic
1003101754 6:3181210-3181232 TTGTTATGGAGGAGGGCAAGTGG + Intergenic
1003221567 6:4165165-4165187 TGGATGTTGAGCAGGGCCACAGG - Intergenic
1004326394 6:14677481-14677503 TTGTGTTTGAGAAGGGTAAAGGG - Intergenic
1007435035 6:41804591-41804613 TTGTTTTTGAGCATGTAAAAGGG - Intronic
1008544130 6:52570828-52570850 TTGCTTTTCAGCAGGGGAAATGG - Intronic
1009935705 6:70232388-70232410 TTGTGGTAGAGCAGGGTCAAGGG + Intronic
1010043605 6:71416449-71416471 TAGTTGTTGAGCAGAGGGAAAGG - Intergenic
1010184776 6:73130989-73131011 ATGTAGTTGAGAAGGACAAAAGG + Intronic
1010283783 6:74051132-74051154 CTGGTGGGGAGCAGGGCAAAAGG + Intergenic
1012502843 6:99908937-99908959 TTATTGTTGGGCAGGGGATATGG - Intergenic
1017953143 6:159154996-159155018 CTATTGTTCAGCAGGGAAAATGG - Intergenic
1018370843 6:163166254-163166276 TTGTTGTTGAGCAGGGCAAATGG - Intronic
1019039701 6:169093698-169093720 GTGTTGTTGTGAAGGGCAGATGG - Intergenic
1019138879 6:169930578-169930600 TTCTTGTTCAGGAGGGCACAAGG - Intergenic
1021737952 7:23657479-23657501 TTGTTGTTGGGCAGGATAGAAGG - Intergenic
1022610257 7:31864609-31864631 TTGTTATTGACCATAGCAAAAGG + Intronic
1025714286 7:63940801-63940823 TGGTTGTTGAGCTGGGTAACAGG + Intergenic
1026554952 7:71399812-71399834 TTGTTCTGGTGCAGGGGAAATGG + Intronic
1030067360 7:105670352-105670374 TTCTTTCTGGGCAGGGCAAATGG - Intronic
1031514216 7:122682249-122682271 TTGTTGTTCATCATGGAAAAGGG + Intronic
1032388995 7:131543688-131543710 TGGTTGTTGGACAGGGGAAAGGG + Intronic
1033017281 7:137684721-137684743 TGTTTGTTGAGCAGCGCATAAGG - Intronic
1033632194 7:143169732-143169754 CTGTTGTTGAGAAGGTAAAATGG + Intergenic
1033898013 7:146099068-146099090 TTGTTGTTGGGCATTGCTAAAGG - Intergenic
1037548133 8:19943548-19943570 TTGTTGCTGAGGATGGCAAATGG - Intronic
1038756034 8:30341442-30341464 TTGTTATTAAGCAAGGCACAGGG + Intergenic
1038973548 8:32665691-32665713 TTGTTTTTGAGCAGCACAAGTGG - Intronic
1039201702 8:35102022-35102044 TTGTTGTTGAGAATGTCAATTGG + Intergenic
1039673783 8:39635226-39635248 TTCTTTTGTAGCAGGGCAAATGG + Intronic
1041393983 8:57373402-57373424 CTGTCATTGAGCTGGGCAAAGGG + Intergenic
1041993923 8:64029837-64029859 TGGGTGGTGAGCATGGCAAAGGG - Intergenic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1043425819 8:80147667-80147689 GGGTTGTTGAGCAGGGCAGCAGG + Intronic
1044858195 8:96496025-96496047 TTGTTGCAAAACAGGGCAAAGGG + Intronic
1046384562 8:113492346-113492368 CTGTTGTTGAGAATGCCAAATGG - Intergenic
1047024127 8:120808949-120808971 TGGTTGTATGGCAGGGCAAAGGG - Intronic
1049526322 8:143128473-143128495 TAGTTGTTGCGCTGGGCACAAGG - Intergenic
1049648166 8:143746387-143746409 TTCTTTTTGAGCAGGGGACAGGG + Intergenic
1049994586 9:1022791-1022813 TTGTTGGTGAGAATGGAAAATGG - Intergenic
1055471399 9:76615132-76615154 TTGTTTTTCAGAAGGTCAAATGG + Intronic
1055967002 9:81875163-81875185 TTGTTGTTGATCTTGGCAAGTGG + Intergenic
1056717513 9:89044593-89044615 ATGTTTTTGAGAAGGGAAAAAGG + Intronic
1057166752 9:92933655-92933677 TTGTTGTAGAGAAAGGCAGATGG + Intergenic
1059303860 9:113338956-113338978 ATGTTGTTGGGCAGGTTAAAAGG - Intronic
1187232407 X:17435375-17435397 TGGGTGGGGAGCAGGGCAAAAGG + Intronic
1188855697 X:35192893-35192915 TTGCTGATGAGAAGGTCAAATGG - Intergenic
1189703260 X:43733554-43733576 TAGTTTTTGAGGAGGCCAAAAGG - Intronic
1190566967 X:51740917-51740939 TTGTGATTGAACAGGGCACAAGG + Intergenic
1193658482 X:84226608-84226630 TTGTTGCCGAGGAGGGCCAAGGG + Intergenic
1194788722 X:98119000-98119022 TTCTTTTTGAGAAAGGCAAAGGG + Intergenic