ID: 1018373198

View in Genome Browser
Species Human (GRCh38)
Location 6:163187078-163187100
Sequence TGGGAGCCACTGATAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018373198 Original CRISPR TGGGAGCCACTGATAGGGAA GGG (reversed) Intronic
900762448 1:4482262-4482284 TGGGAGCCACTGGGAGCCAATGG + Intergenic
901636238 1:10671584-10671606 TGGGGGCCACAGAGAGGGGAGGG - Intronic
902577922 1:17389994-17390016 TGGGAAACACTAATAGGAAAAGG + Intronic
905770982 1:40637850-40637872 TAGGAGCCACGGACAGGGAGAGG - Intronic
913454214 1:119014572-119014594 TAGGAGCAACAGATATGGAAGGG - Intergenic
915531979 1:156508064-156508086 TGGGAGCCAGAGCTAGGGACAGG - Intergenic
919836544 1:201578560-201578582 TGGGCTCCACTGATAATGAATGG + Intergenic
920877732 1:209852947-209852969 TGGGAGCCACTGTCTGAGAAAGG - Exonic
921632823 1:217455649-217455671 AGTGAGCCACTGATATGGACAGG + Intronic
922744131 1:228034824-228034846 TGGGAGCCATTGATAATGACTGG - Intronic
1063211772 10:3887379-3887401 TGGAATCCACTGATAAGTAAGGG - Intergenic
1064580492 10:16788268-16788290 TGGGAGCCATGCATAGGGGATGG - Intronic
1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG + Intergenic
1065555468 10:26911262-26911284 TGAGAGCCCCTGATAGGCCAGGG - Intergenic
1065864176 10:29899213-29899235 TGAGAGGCACTGACAGGGAAGGG + Intergenic
1066320988 10:34303790-34303812 TGGGCGGCACTGACAGGGCATGG + Intronic
1067095309 10:43295608-43295630 TGGGAGCCACCGAATGGAAAGGG + Intergenic
1067429576 10:46234240-46234262 AGGGAGCCTGTGGTAGGGAAAGG + Intergenic
1067444077 10:46329688-46329710 AGGGAGCCTGTGGTAGGGAAAGG - Exonic
1067729005 10:48795650-48795672 TTGGAGCCATTGATGGGGAATGG + Intronic
1068923692 10:62512791-62512813 TTGGAACCATTGACAGGGAAAGG + Intronic
1070240370 10:74674190-74674212 TGGGTGCTATTGATAGGGACAGG - Intronic
1070615034 10:77962969-77962991 TGAAAGCCACTGACAGAGAAAGG - Intergenic
1071403299 10:85300142-85300164 TGGATACCAATGATAGGGAATGG + Intergenic
1073072798 10:100805533-100805555 TGGGAGGCAAGGATAGGGGAGGG + Intronic
1074591284 10:114816215-114816237 TGGGAGAAACTTAGAGGGAAAGG - Intergenic
1075080099 10:119377902-119377924 TGGGAAAAACTGATTGGGAAAGG + Intronic
1075723771 10:124601550-124601572 TGGGACGCACTGAGAGGGACTGG - Intronic
1076581421 10:131514522-131514544 GGGGAGCCCCTGAGAGGGACAGG + Intergenic
1077863450 11:6203309-6203331 TGAGAGTGACTGATAGAGAATGG - Intergenic
1081988937 11:47327321-47327343 TGGGAGCCAGCGCTAGGGAGTGG + Intronic
1083127634 11:60587560-60587582 TTGGAGACACTGAGAGGGAAAGG - Intergenic
1084481494 11:69423309-69423331 GGGAACCCACTGAGAGGGAAAGG + Intergenic
1085283859 11:75347448-75347470 TGAGAGGCAGTGGTAGGGAATGG - Intronic
1087298164 11:96401327-96401349 TTGGAGCCACTTATAGGATAAGG + Intronic
1088795846 11:113266216-113266238 TGATAGCCACTGAGAGGGAATGG + Intronic
1089053427 11:115565287-115565309 GGGGAGCGAATGGTAGGGAAGGG + Intergenic
1092351371 12:7758596-7758618 TGAGAGCCACTGGCAGGGAGGGG + Intergenic
1093856455 12:24110090-24110112 TGGTAGCCTCTTATAGGCAAAGG - Intergenic
1094065695 12:26358776-26358798 TGGCAGCCACAGATGGGGGAGGG - Intronic
1100278828 12:93098201-93098223 AGGGCGCCACTGAAAAGGAAAGG + Intergenic
1100881103 12:99017617-99017639 TGGGTGCCACTGATTGGTTAGGG - Intronic
1100888140 12:99095248-99095270 TGGGAGGTAGTGAGAGGGAAAGG - Intronic
1101549474 12:105748688-105748710 TGGGAGCCCAAGATAGAGAAGGG - Intergenic
1102821772 12:115914759-115914781 TGGGATGCACTTATGGGGAAGGG + Intergenic
1102988487 12:117297830-117297852 TGACAGCCACTACTAGGGAAGGG - Intronic
1103196269 12:119046091-119046113 AGCGACCCACTGATGGGGAAAGG + Intronic
1103557525 12:121775377-121775399 TGGGATCCACAGATTGGGAGAGG - Intronic
1104743014 12:131192851-131192873 TGGAAGCCAGGGATAGGGAGGGG - Intergenic
1105480160 13:20767743-20767765 TTGGAGTCCCTGAAAGGGAAGGG - Intronic
1105636141 13:22216956-22216978 TGGGAGTGACTGAGAGGAAAAGG + Intergenic
1105843376 13:24274457-24274479 TGGGAACCACTGAAGGGGGATGG + Intronic
1107006046 13:35613191-35613213 TGGGAGATATGGATAGGGAAAGG - Intronic
1108706511 13:52993359-52993381 TGGGAGCCTCTCTGAGGGAAAGG + Intergenic
1109100838 13:58181710-58181732 ATGGAGCCACTGCTAGGGGATGG + Intergenic
1109559999 13:64034340-64034362 TCGGAGCCACTGACAGGTAAAGG - Intergenic
1110884131 13:80611400-80611422 TGGAAGCCATAGATTGGGAATGG + Intergenic
1115929439 14:38474406-38474428 TGGGACCCACAGACAGGAAAAGG + Intergenic
1118261451 14:64251025-64251047 TGGAAGTCACTCATAGGAAAAGG + Intronic
1121170249 14:91847765-91847787 TTTGAGCCACTGTTTGGGAAAGG + Intronic
1121693273 14:95892948-95892970 TGGGAGCCACTTATAGGAAAAGG + Intergenic
1121896939 14:97657474-97657496 TGGAAGGCACTGGAAGGGAAGGG + Intergenic
1122769492 14:104091707-104091729 TGTGAGCCAGTGATAGGCGATGG + Intronic
1123498460 15:20855586-20855608 TGGGAGCCACTGCTTGGGGAAGG + Intronic
1123555695 15:21429214-21429236 TGGGAGCCACTGCTTGGGGAAGG + Intronic
1123591937 15:21866545-21866567 TGGGAGCCACTGCTTGGGGAAGG + Intergenic
1123996450 15:25721131-25721153 AGGCAGCCACAGATAAGGAAGGG + Intronic
1124023677 15:25945562-25945584 TGGGAGGGCCTGAGAGGGAATGG + Intergenic
1124379061 15:29149464-29149486 CGGAAGCTACTGGTAGGGAATGG + Intronic
1125046432 15:35246456-35246478 AGGGAGACACTAATGGGGAAAGG - Intronic
1128225407 15:65998032-65998054 TGGGGGGCACTGTGAGGGAAAGG + Intronic
1130169351 15:81495838-81495860 TGGGAGGCACTGACAGGAGATGG - Intergenic
1130671525 15:85917201-85917223 TGGAATCCACTGAGAGGGAGGGG - Intergenic
1130838745 15:87677600-87677622 TGGAAGCCACTGAAAGCTAAGGG - Intergenic
1202964036 15_KI270727v1_random:156424-156446 TGGGAGCCACTGCTTGGGGAAGG + Intergenic
1132866189 16:2093803-2093825 TGGGAGCCACTGAAGGTGAGGGG - Exonic
1136083327 16:27867408-27867430 TGGGAGCCACTGGGAGGCAGAGG + Intronic
1136640079 16:31556903-31556925 TGGGAGACTCTGAGAGGGAAAGG + Intergenic
1138134268 16:54508022-54508044 TGGGAGCCTCAGATAGGGCTGGG + Intergenic
1140463771 16:75162665-75162687 TGGGATCTACTGGTAGGGAAGGG - Intronic
1144583000 17:16470538-16470560 TGGCAGCCACTGCTAAGGGAGGG + Intronic
1144887678 17:18474782-18474804 TGGGAGTCACTGACTGGGAGGGG - Intergenic
1145144538 17:20469518-20469540 TGGGAGTCACTGACTGGGAGGGG + Intergenic
1145175989 17:20700920-20700942 TGGGAGTCACTGACTGGGAGGGG + Intergenic
1148673753 17:49432905-49432927 TGGGAGGCCCTGGCAGGGAATGG + Intronic
1149623318 17:58062049-58062071 TGGGGGCCACTCAGAGGGAGAGG + Intergenic
1154329900 18:13421273-13421295 TGGGAGCCAGTGGTAGGCAAGGG + Intronic
1154456464 18:14532011-14532033 TGGGAGCCACTGCTTGGGGAAGG + Intronic
1155748368 18:29389476-29389498 TGGCAGCCACAGAGAGGGCATGG + Intergenic
1160013472 18:75124115-75124137 TGGATGCCACTGATAAGGACTGG - Intergenic
1161037771 19:2095304-2095326 TAGGAGTCACTGAGAGGGGAGGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163106529 19:15125867-15125889 TGCGAGCCAATGAAAGGCAAGGG - Intergenic
1164507243 19:28870295-28870317 TAGGAGCCCCTGACAGAGAAGGG - Intergenic
1164707870 19:30333631-30333653 TGGAAGCTACTGATGGGCAATGG - Intronic
1166750176 19:45160820-45160842 TGGGGGACAGGGATAGGGAAAGG + Intronic
1167196847 19:48035115-48035137 GGGGAGCCACAGAGAAGGAATGG - Intronic
1167487059 19:49768725-49768747 TGGGAGCCACTGTTAGCAGACGG + Intronic
925069811 2:957329-957351 GGGGAGCAACGGATGGGGAACGG + Intronic
925216874 2:2103989-2104011 TGAGAGCCCCTGATAGAGAAAGG - Intronic
925687215 2:6484430-6484452 TGTGAGTTACTGATTGGGAATGG + Intergenic
926738866 2:16094723-16094745 AGGGAGACACTGGTGGGGAAGGG - Intergenic
927049684 2:19314539-19314561 TGGGAGTCACAGATTGGCAATGG - Intergenic
927057853 2:19383848-19383870 TGGGATCCACTAATTTGGAAGGG + Intergenic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
931011350 2:57918229-57918251 TGAGAGCCAAGGATATGGAAAGG - Intronic
931257473 2:60585741-60585763 TGGGAGCCAGTGTTATGGAGAGG - Intergenic
931427087 2:62181068-62181090 TGGAAACCCCTGAGAGGGAAGGG - Intergenic
931458603 2:62431830-62431852 TGGGTGGCAATGATAGGGACAGG + Intergenic
932080595 2:68711077-68711099 TGGGTGCCATTGAGAGGGAGGGG - Intronic
932731243 2:74223405-74223427 TGGGGTCCACTGAAGGGGAATGG + Intronic
933779984 2:85794812-85794834 TGGGAGGTGCTGACAGGGAAGGG - Intergenic
935981080 2:108628302-108628324 TGGGAGACACTGAAAGACAAAGG - Intronic
937737688 2:125312490-125312512 TGGGAGCCAGGAATAGGCAAGGG + Intergenic
939284370 2:140110126-140110148 TGGAAACCACTGAATGGGAAAGG - Intergenic
940144700 2:150533736-150533758 TGTGAGCCATTGATAGAGAAAGG - Intronic
941383301 2:164822386-164822408 TGGGAGCCCCAGGCAGGGAAGGG + Intronic
941989527 2:171541423-171541445 AGGGAGCCACTGAGAGGCAGGGG + Intronic
944956249 2:204812807-204812829 TAAGAGCCACTGCCAGGGAAAGG - Intronic
947824137 2:233092822-233092844 TGGGAGCCACTGACAGTGATGGG - Intronic
948220163 2:236262949-236262971 TGGGAGTTGCTGCTAGGGAATGG - Intronic
1168836412 20:880732-880754 TGGGAGCCACTGATTGAAAATGG + Intronic
1169508732 20:6241602-6241624 AGGAAGCCACTGCTAGGGTATGG - Intergenic
1169910419 20:10643665-10643687 TGAGAGCTACTTAAAGGGAATGG + Intronic
1170316610 20:15048316-15048338 TTGAAGCCACTGATATGTAAAGG + Intronic
1170485215 20:16808563-16808585 TGAGAGACACTGATGGGGAGGGG + Intergenic
1170762555 20:19263645-19263667 TGAGATCCACTGATAGGTAAGGG - Intronic
1171240710 20:23565269-23565291 TGAGGGCCACTGCTAGGGAGTGG - Intronic
1171284711 20:23927466-23927488 TGGGAGTCACTGACCTGGAATGG + Intergenic
1172843591 20:37916311-37916333 AGGGAGCCAGAGATAGGGCAGGG - Intronic
1173241791 20:41303487-41303509 TGGTATCCACTGATAGCCAAGGG - Intronic
1173319582 20:41975341-41975363 TGGGAGCCAGTGAGGAGGAAGGG - Intergenic
1173649602 20:44654609-44654631 TGAGACCCACTGATAGGGTTTGG - Intergenic
1174740875 20:53012851-53012873 TGGGATCCACTGTTGTGGAAAGG - Intronic
1176527673 21:7933057-7933079 TGGGATGCACTGGAAGGGAATGG - Intergenic
1176676099 21:9778844-9778866 TGGGAGCCACTGGTTGGACACGG + Intergenic
1176817700 21:13621326-13621348 TGGGAGCCACTGCTTGGGGAAGG - Intronic
1179357890 21:40678468-40678490 TCGGAGCCAGTGATAGAGATGGG + Intronic
1180025222 21:45156960-45156982 TGGCAGACACTGCTAGAGAATGG - Intronic
1180966427 22:19790292-19790314 TGGGAGGCACTGAGAGAGATGGG + Intronic
1181992687 22:26849509-26849531 TGGGAGCCACTGAAAGTTAGAGG - Intergenic
1184559137 22:45251468-45251490 TGGGAGCCACGGATAAGGGCTGG + Intergenic
950528475 3:13538900-13538922 TGGGAGCCAGAGAAAGGGAGGGG - Intergenic
950670604 3:14523116-14523138 TGGGAGCCTCTGGATGGGAAGGG - Intronic
951959154 3:28295854-28295876 TGGAACCCACAGATAAGGAATGG + Intronic
953812090 3:46121489-46121511 GGGCAGCAACTGAAAGGGAAAGG + Intergenic
953984095 3:47428105-47428127 AGGGACCCACTGATAGGCAGGGG + Intronic
955829513 3:62986272-62986294 TGGGAGCCACTGATAGAACGTGG - Intergenic
956382488 3:68679590-68679612 TGTGAGCCACTGTTAGGGATAGG - Intergenic
956469712 3:69553988-69554010 TGAGAACCACTGATAAGAAATGG - Intergenic
957357091 3:79103954-79103976 TGGGAGCCTATGATAGGAAAGGG + Intronic
958833847 3:99120622-99120644 GGGGAGGCAATCATAGGGAAGGG + Intergenic
959052216 3:101535330-101535352 TGGGAGCAGCTGATATTGAATGG + Intergenic
959086235 3:101853337-101853359 TGGGAGCCCCTGACTTGGAATGG - Exonic
961112806 3:124299240-124299262 TGTGAGTCACTGATCGGGGATGG + Intronic
961829131 3:129614428-129614450 TTGGGGCCACTGGAAGGGAAAGG - Intergenic
963071207 3:141306854-141306876 TGGAGACCACAGATAGGGAAGGG - Intergenic
965230941 3:166052186-166052208 TTAGTGCCACTGATAGGAAAGGG - Intergenic
967076151 3:186004367-186004389 AGGGAGACACTGAGAGGTAAAGG + Intergenic
970296328 4:14634828-14634850 TGGGAGCTATTGACTGGGAAGGG - Intergenic
970368165 4:15381876-15381898 TGGCATGCACTGATAGAGAAAGG - Intronic
970463986 4:16304796-16304818 TGGGAGTCACAGAAGGGGAAGGG + Intergenic
971336031 4:25724927-25724949 TGAGGGCCACTGGTGGGGAAGGG - Intergenic
971671017 4:29558218-29558240 TCGCAGCCACTGCCAGGGAAAGG + Intergenic
971704630 4:30024359-30024381 TGGAAACCACTGATCAGGAAAGG + Intergenic
972003386 4:34067634-34067656 TTGCAGCCACTGCCAGGGAAAGG + Intergenic
972234888 4:37120331-37120353 GGCCATCCACTGATAGGGAAGGG - Intergenic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
974691289 4:65300527-65300549 TGGGAGCCAGTGCCAGGGAGAGG - Intergenic
978622010 4:110641912-110641934 GGGAAGCCACTGAGAGGTAAGGG - Intronic
979966906 4:127086740-127086762 TGAGAACCTCTGCTAGGGAAGGG + Intergenic
981285813 4:143018241-143018263 TGGGAGTCCCAGAAAGGGAAAGG - Intergenic
983647716 4:170008682-170008704 TGGGACTCACAGAAAGGGAAAGG - Intronic
984157018 4:176206141-176206163 AGGGAGCCACTGAATGGGATTGG - Intergenic
984693603 4:182756374-182756396 TGGGAGTCACTGAGAATGAAAGG + Intronic
985399431 4:189579902-189579924 TGGGAGCCACTGGTTGGACACGG - Intergenic
985490888 5:178237-178259 TGGGAGCCAGTGCCAGGGAGAGG - Intronic
985704820 5:1394191-1394213 TGGGAGCCACGCATCGGGAAAGG + Exonic
985989091 5:3540222-3540244 TGGGGGGCACGGAAAGGGAAGGG + Intergenic
990018635 5:51098430-51098452 TGGCAGCCAGTGTCAGGGAAAGG - Intergenic
992396333 5:76372496-76372518 TGGGAGCCCCTGCCAGGCAAGGG + Intergenic
994958828 5:106571460-106571482 TGGGAGACTCTGAAAGGGAAGGG + Intergenic
995396088 5:111688698-111688720 TGGGAACCACTGATAGAGAGAGG - Intronic
997794998 5:136800261-136800283 AGGAAGCCACTGGTAGGGAAGGG - Intergenic
998065043 5:139151153-139151175 TGGGGGCCAATGGTTGGGAATGG - Intronic
999074200 5:148779775-148779797 TGGGAGCCACAGAGAGCCAAGGG + Intergenic
1000766631 5:165299631-165299653 TTGCAGCCAATGACAGGGAAAGG - Intergenic
1001679284 5:173544331-173544353 TGGGAGGCACTGCTGGGGGATGG + Intergenic
1002330848 5:178439480-178439502 TGAGGGTCACTGAGAGGGAAAGG - Intronic
1002428755 5:179191174-179191196 TGCGAGCCACTGACAGGGAAAGG + Intronic
1003204310 6:3993115-3993137 TTGCAGCCAGTGCTAGGGAAAGG - Intergenic
1004760771 6:18663647-18663669 TGGGAGTCACTGATATGCATTGG + Intergenic
1004773980 6:18821699-18821721 AGAGAATCACTGATAGGGAAAGG - Intergenic
1005094390 6:22097885-22097907 TGGGAGCTATTGAAAGGAAAAGG - Intergenic
1007376158 6:41458197-41458219 TGGGAGCCAGAGAAAGGGATTGG + Intergenic
1007790248 6:44304566-44304588 TGGGAGCCAAGGGGAGGGAAAGG - Intronic
1009937340 6:70249436-70249458 TGGGAGACACTGGTAGAGAAAGG + Intronic
1011366350 6:86586408-86586430 GGGGAGCCACTGATAGGGTACGG + Intergenic
1012485365 6:99715493-99715515 TGGGAGCAAGTGATAGTTAATGG - Intergenic
1012845386 6:104381488-104381510 TGTGGGCCACTGCTAAGGAAGGG + Intergenic
1014549930 6:122778766-122778788 TGGGAGTTAGTGATGGGGAAGGG - Intergenic
1017016256 6:150102035-150102057 TGGGAGCCATTCTTAGGTAAAGG + Intergenic
1017993403 6:159509913-159509935 ATGGAGGCACTGAAAGGGAAGGG - Intergenic
1018373198 6:163187078-163187100 TGGGAGCCACTGATAGGGAAGGG - Intronic
1018431947 6:163729724-163729746 GGGGAGCCACTGGAAGGGAGGGG - Intergenic
1020739142 7:11990734-11990756 TGTGAGTGACTGATAGGGACAGG - Intergenic
1021179888 7:17494308-17494330 TGGTCCCCACTGATAGGGACAGG + Intergenic
1023874682 7:44280453-44280475 TGGAGGCCCCTGATAAGGAAGGG + Intronic
1027122459 7:75531708-75531730 GGGGAGACACAGATTGGGAAAGG - Intergenic
1029144837 7:98438551-98438573 TGGGAGCAAGTGAGAGAGAAGGG - Intergenic
1030746458 7:113172237-113172259 TGGGAGCCATTGGTATGGAGGGG + Intergenic
1031575442 7:123410459-123410481 TGGGTGACAGTGATTGGGAAGGG - Intergenic
1032096747 7:128942087-128942109 TGGGAGCCACTGGGATGGACTGG - Exonic
1032128532 7:129211570-129211592 TGGGAGGCACTGCCAGGGACCGG + Intronic
1032342880 7:131092027-131092049 TGGGAACTACTGCTAGGCAATGG + Intergenic
1033425395 7:141239344-141239366 AGGGAGCCACTGAGCGGCAATGG + Intronic
1039488911 8:37932875-37932897 TGGAAGACACGCATAGGGAAAGG - Intergenic
1043369077 8:79570046-79570068 TGGGAGCCCCTGAAGTGGAATGG + Intergenic
1045396247 8:101763435-101763457 TGGTAACCAATGACAGGGAAAGG + Intronic
1045397243 8:101773171-101773193 TGGTAGACCCTGATATGGAATGG - Intronic
1045470488 8:102508208-102508230 GGGGAACCACTGCTAGGGAATGG + Intergenic
1045977192 8:108142843-108142865 TGGGAGCCACTGATTTATAATGG + Intergenic
1046270882 8:111896734-111896756 TGGGAGCCACAGAGAGAGGAAGG - Intergenic
1048551984 8:135441938-135441960 TGTGAGCCACTGATATGGTTTGG - Intergenic
1048881040 8:138872688-138872710 TGGGAGCCTCTGTCAGGCAATGG + Intronic
1049852930 8:144843810-144843832 TGTGAGCCACTGATACTTAAGGG - Intronic
1051711584 9:19935753-19935775 TGTGAGGAACTCATAGGGAAGGG + Intergenic
1054741593 9:68811416-68811438 TGGGAGCCATAGACAGGGATTGG + Intronic
1058874004 9:109226215-109226237 TGGGAGGCACTGACATGGACTGG + Intronic
1060585690 9:124784062-124784084 AGAGAGCCATTGAAAGGGAAGGG + Intronic
1060765745 9:126294013-126294035 TGGGAGCCACAGATGGGTAAAGG + Intergenic
1062609206 9:137366427-137366449 TGGGAGCCCTGGTTAGGGAAGGG - Intronic
1062661913 9:137641020-137641042 TGGAAGACACTGATGAGGAACGG - Intronic
1203529660 Un_GL000213v1:128175-128197 TGGGAGCCACTGCTTGGGGAAGG + Intergenic
1186133905 X:6498309-6498331 TGGGAGTCACTTATAGCAAAAGG - Intergenic
1190761484 X:53441360-53441382 GGGGAGCCCCTGATCGGGCACGG + Intergenic
1192215794 X:69157209-69157231 TGGGAGACACAGAGAGGAAAGGG + Intergenic
1200395179 X:155981852-155981874 TGGGAGCAGCTGATATTGAATGG + Intergenic
1200684048 Y:6244717-6244739 TGGGAGCACGTGGTAGGGAAGGG - Intergenic
1200686666 Y:6265033-6265055 TGGGAGCACGTGGTAGGGAAGGG - Intergenic
1200989544 Y:9335949-9335971 TGGGAGCACGTGGTAGGGAAGGG - Intergenic
1200992215 Y:9356282-9356304 TGGGAGCACGTGGTAGGGAAGGG - Intergenic
1200994865 Y:9376560-9376582 TGGGAGCACGTGGTAGGGAAGGG - Intronic
1200997529 Y:9396906-9396928 TGGGAGCACGTGGTAGGGAAGGG - Intergenic
1201000041 Y:9465442-9465464 TGGGAGCACGTGGTAGGGAAGGG - Intergenic
1201002702 Y:9485752-9485774 TGGGAGCACGTGGTAGGGAAGGG - Intronic
1201005357 Y:9506036-9506058 TGGGAGCACGTGGTAGGGAAGGG - Intergenic
1201008020 Y:9526365-9526387 TGGGAGCACGTGGTAGGGAAGGG - Intergenic
1201010635 Y:9546556-9546578 TGGGAGCACGTGGTAGGGAAGGG - Intergenic
1201048587 Y:9909669-9909691 TGGGAGCACGTGGTAGGGAAGGG + Intergenic
1201063901 Y:10070676-10070698 TGGGAGCAGTTGATAGGGATGGG + Intergenic
1202038311 Y:20657753-20657775 TGGGAGAAATTTATAGGGAAAGG + Intergenic