ID: 1018373332

View in Genome Browser
Species Human (GRCh38)
Location 6:163187861-163187883
Sequence GTGAAGAGCTCCAGGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018373327_1018373332 1 Left 1018373327 6:163187837-163187859 CCGCTGATCTGCGCCTGTCATCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG No data
1018373324_1018373332 20 Left 1018373324 6:163187818-163187840 CCTCCTGTTACGCGCCTGTCCGC 0: 1
1: 0
2: 0
3: 3
4: 17
Right 1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG No data
1018373326_1018373332 6 Left 1018373326 6:163187832-163187854 CCTGTCCGCTGATCTGCGCCTGT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG No data
1018373325_1018373332 17 Left 1018373325 6:163187821-163187843 CCTGTTACGCGCCTGTCCGCTGA 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018373332 Original CRISPR GTGAAGAGCTCCAGGGAGGC CGG Intronic
No off target data available for this crispr