ID: 1018373485

View in Genome Browser
Species Human (GRCh38)
Location 6:163189559-163189581
Sequence ATCTGTAAGCTAAAAATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018373485 Original CRISPR ATCTGTAAGCTAAAAATTGA TGG (reversed) Intronic
900880658 1:5378911-5378933 CTCAGTAAGCTAAAAATGGAAGG + Intergenic
904199414 1:28810342-28810364 ATATTTAAGCTGAAATTTGAGGG + Intergenic
905145733 1:35885486-35885508 GTCTGGAAGCTGCAAATTGAGGG + Intronic
906988861 1:50715915-50715937 ATATGTAAGCTAATAATATATGG - Intronic
907857455 1:58317775-58317797 AACTGTGAGCTAATAAATGAAGG + Intronic
908793579 1:67808281-67808303 CTATGTAAACTAAAAATAGAGGG + Intronic
909461859 1:75925800-75925822 ATTTTTCAGCTAGAAATTGAAGG - Intronic
909932110 1:81508268-81508290 ATCAGTAAGATAGAAAGTGAAGG - Intronic
911559228 1:99383611-99383633 AAGTGTGAGCTAAATATTGAAGG + Intergenic
911688868 1:100808649-100808671 ACATGTAAGCTGAGAATTGAAGG + Intergenic
912781214 1:112549963-112549985 CTCAGTAAACTACAAATTGAAGG - Intronic
913539737 1:119807358-119807380 ATCTGGAAGAGAGAAATTGAAGG + Intronic
913709562 1:121468920-121468942 TTCAGTAAGCTAAAAATAAAAGG - Intergenic
914739060 1:150448005-150448027 ATCTGTTATCTATAAATTAAAGG + Intronic
915845823 1:159263636-159263658 ATCTGTACAATAAAAAATGAGGG - Intergenic
916191532 1:162183642-162183664 CTCTGTAACATAAAAATGGAAGG - Intronic
916478886 1:165197296-165197318 TTCTGCCAGCTAAAAATAGAGGG + Intergenic
916529923 1:165647196-165647218 ATCTGTGAGGTTAAACTTGATGG - Intronic
916636644 1:166677048-166677070 TTCAGTAAGCTAAACATTCATGG - Intergenic
917830904 1:178884876-178884898 ATAAGTAAGATAAAAATTAATGG + Intronic
919341157 1:196308628-196308650 ATCTATAAACTAATAATTGGAGG - Intronic
921564881 1:216704739-216704761 ATCTATAATGTAAAAATTGGAGG + Intronic
921985699 1:221309594-221309616 ATCTGTAATTTAACAATAGATGG - Intergenic
923933462 1:238730904-238730926 ATTTGCAATCTAAAAATAGAAGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1064435666 10:15309123-15309145 ATCTGTAAGCAATAAATTAATGG + Intronic
1065637760 10:27747368-27747390 ATTTGTTAGCTGAAAATTGATGG - Intergenic
1066762187 10:38765700-38765722 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1066783928 10:38980938-38980960 ATGTGTAATATAAAGATTGAAGG + Intergenic
1066959406 10:42206778-42206800 ATCTGTAAACTAAATAGTAAAGG + Intergenic
1066984485 10:42453249-42453271 ATGTGTAATATAAAGATTGAAGG - Intergenic
1068195757 10:53713979-53714001 TTCTGTAAACCAAAAAGTGATGG - Intergenic
1068319353 10:55391218-55391240 CTCTGTAACATAAAAATTCAAGG - Intronic
1068533483 10:58214316-58214338 ATCTGTTAGCAAGAAATTAAGGG + Intronic
1071775431 10:88781722-88781744 ATCTATATACTAAAAATTGTTGG - Intergenic
1072258143 10:93640644-93640666 ATCAGTAATTTAAAAATTCAGGG + Intronic
1073830842 10:107381184-107381206 ATCTGTAAGGAAACAATAGAAGG - Intergenic
1075366854 10:121897995-121898017 ATGTGTAAGCTAAAAAGAGAGGG - Intronic
1076455536 10:130591161-130591183 ATATGTAAGCTTGAAATTGCTGG + Intergenic
1077974662 11:7235221-7235243 AACTATAAAATAAAAATTGATGG - Intergenic
1078418232 11:11183355-11183377 ATGCCTAAGCTAAAACTTGAAGG - Intergenic
1079619680 11:22538354-22538376 ATGTTTAAGCTAAAACCTGAAGG + Intergenic
1079824836 11:25177970-25177992 TTTTGTAGGCTAAAAATTCAAGG - Intergenic
1080437877 11:32262885-32262907 ATTTCTAAGCAAAATATTGAAGG - Intergenic
1084057641 11:66646704-66646726 ATCTGTAAACTAAAAGTAGTTGG - Intronic
1086216527 11:84388931-84388953 ATCTCTAAGCTAAATATTCAGGG - Intronic
1086571220 11:88286548-88286570 ATCTGTCACCTTGAAATTGAAGG + Intergenic
1086762672 11:90652577-90652599 ATCTGTTGGATAAAAATTGGAGG + Intergenic
1086900193 11:92358783-92358805 ACTTGGAAGCAAAAAATTGATGG - Intronic
1087028756 11:93680952-93680974 TTATGAAAGCTAAAAATTTAAGG - Intronic
1087670635 11:101102383-101102405 ATCTGTAATCAACAATTTGAAGG - Intronic
1088502424 11:110495883-110495905 ATATGTAAAATAAAAATAGATGG + Intergenic
1090163905 11:124525690-124525712 ATGTGGAAGCTAAAAATGTAAGG + Intergenic
1090537171 11:127655953-127655975 TTCTGTAAGCTAAATGTTAATGG - Intergenic
1091197461 11:133744168-133744190 ATATCTAAGCAAAATATTGAAGG + Intergenic
1091583637 12:1803593-1803615 AATTGTAATCTAAAAATGGAGGG + Intronic
1092552331 12:9516449-9516471 AACTGTAATTTAAAAATTCAAGG + Intergenic
1092797272 12:12124886-12124908 ATCTGTAACCTAAAAATCATTGG + Intronic
1093273178 12:17091433-17091455 ATCTGCAAGCTGAAGAGTGAGGG + Intergenic
1094438360 12:30446944-30446966 ATCTGTATTTTAAAAATTAAGGG + Intergenic
1094519788 12:31174162-31174184 AACTGTAATTTAAAAATTCAAGG - Intergenic
1095404519 12:41853332-41853354 ATGTGTTAACTAAAAATAGAAGG - Intergenic
1096877705 12:54643605-54643627 ATCTTGAAGCTAGATATTGAAGG + Intergenic
1097336160 12:58385580-58385602 ATGTGTAAAATAAAAATTCAAGG - Intergenic
1097775573 12:63640462-63640484 ATCTGTATGTTAAAATTTTATGG + Intronic
1098086658 12:66852015-66852037 AGTTGTAATCTATAAATTGATGG + Intergenic
1098556289 12:71822623-71822645 ATCTGTATTCTACAAATGGAAGG + Intergenic
1098558119 12:71841994-71842016 AACTCTTAGCTAAAACTTGAAGG - Intronic
1098709296 12:73734789-73734811 ATATTTAAACTAAAAATGGAAGG + Intergenic
1099873521 12:88376683-88376705 ATTTCTAAGCAAAATATTGAAGG - Intergenic
1104094942 12:125548494-125548516 ACCTTTAAGCTAAGGATTGAAGG + Intronic
1107801216 13:44109469-44109491 AAGTTTAAGCTCAAAATTGAAGG - Intergenic
1108614677 13:52120454-52120476 ATTTATAATATAAAAATTGATGG + Intronic
1110435809 13:75476946-75476968 AGCCCTAAGCTGAAAATTGAAGG - Intronic
1111473387 13:88716041-88716063 AAATGTAACCTAAAAATAGAAGG - Intergenic
1114589664 14:23849536-23849558 ATGTGCAATTTAAAAATTGATGG + Intergenic
1114792631 14:25677117-25677139 ATCTGTAAGCGGAAAATTTTTGG + Intergenic
1115818243 14:37186325-37186347 ATCTGTAATCTAAACATTTTGGG + Intergenic
1117816496 14:59604472-59604494 ATTTGTAATGTAAAAATTGTGGG - Intronic
1118752211 14:68815796-68815818 ATCTTTAAGCTGAACCTTGAAGG + Intergenic
1119240403 14:73054776-73054798 ATTTGTAAGAAAAAAATAGAAGG + Intergenic
1119311534 14:73650786-73650808 AGCTCTCAGCTAAAAATTAAAGG - Intronic
1119416754 14:74475946-74475968 ATGTGTAATGTACAAATTGAAGG - Intergenic
1119561548 14:75594001-75594023 ATTTCTAAGCAAAATATTGAAGG - Intronic
1120360644 14:83497414-83497436 ATCTGGAAGCAGAAAAGTGAAGG - Intergenic
1120844983 14:89117611-89117633 ATCAGAGAGCCAAAAATTGAGGG + Intergenic
1121370284 14:93351540-93351562 ACCTGTAAGCTAAACAAGGAAGG - Intronic
1121392375 14:93586864-93586886 GAATGTAGGCTAAAAATTGAGGG - Exonic
1122360621 14:101159767-101159789 ATCTGAGAGCTAAAAATTCCAGG - Intergenic
1123207735 14:106729371-106729393 ATTTGTTAGATAAAGATTGATGG - Intergenic
1202933519 14_KI270725v1_random:61954-61976 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1125043690 15:35221895-35221917 ATTTCTAAGCAAAATATTGAGGG - Intronic
1125925930 15:43563156-43563178 CTCTGTAAACCATAAATTGAAGG - Intronic
1125939074 15:43662707-43662729 CTCTGTAAACCATAAATTGAAGG - Intronic
1126381650 15:48054166-48054188 ATCTGTAGGCAAAAAGTTCATGG + Intergenic
1126741028 15:51776154-51776176 TACTGTAAGCTACATATTGAAGG - Intronic
1127088995 15:55448083-55448105 CTCAGTAAGCTAGATATTGATGG - Intronic
1127115407 15:55721587-55721609 ATGTGTAAGCTAAATTTTGAAGG - Intronic
1127720431 15:61693880-61693902 ATTTATAAGCAAAATATTGAAGG + Intergenic
1129648572 15:77461798-77461820 ATTAGTAACTTAAAAATTGATGG + Intronic
1129757405 15:78106716-78106738 ATGTGTGAGCCAAAATTTGAAGG - Intronic
1130823735 15:87522063-87522085 ATCTGCAAGCTATAGACTGAGGG + Intergenic
1132486239 16:193107-193129 ATTGGTAATTTAAAAATTGAAGG + Intronic
1135248864 16:20882825-20882847 TTTTGTAAGCTAAAAAATGTTGG - Intronic
1138356365 16:56384147-56384169 ATATGTAAGCTAAAACATGAAGG - Intronic
1139091605 16:63654816-63654838 ATCTGTAGCCATAAAATTGAGGG + Intergenic
1139191140 16:64864969-64864991 CTCTTTAAGCTTAAATTTGATGG - Intergenic
1139812435 16:69633608-69633630 ATGTGAAAGCTAAAAAATGTTGG + Intronic
1140379897 16:74477288-74477310 ATCTGTAAGGTAAAGAGAGATGG + Intronic
1143004869 17:3823726-3823748 ATTTGTAATTTAAAAATTGGTGG - Intronic
1143310151 17:5981057-5981079 AACTGTGAGCCAACAATTGAGGG - Intronic
1144175330 17:12699693-12699715 ATCTTTAAGCTTTAAATTAAAGG + Intronic
1147797160 17:43052706-43052728 ATCAGGAAGCTAAAAATACACGG + Intronic
1148037170 17:44673955-44673977 ATCTGTAAAATAAACATTCAGGG - Exonic
1150759369 17:67946598-67946620 ATCTTTAATATAAAACTTGAGGG + Intronic
1152169466 17:78734750-78734772 ATTTTTAACCTAAAAATTGTGGG + Intronic
1155571213 18:27196012-27196034 ATTTGTAGGCTTAAAATTGCAGG + Intergenic
1155744741 18:29340182-29340204 ATGTGTAAACTACAAATTGTGGG - Intergenic
1155904491 18:31433051-31433073 CTCAGTAAACTAAAAATAGAGGG + Intergenic
1156112929 18:33749149-33749171 ATCTTTAAGCTAAAATATAAGGG + Exonic
1156223613 18:35079932-35079954 ATCTGTAACATTAAAATTCAAGG + Intronic
1156515984 18:37680915-37680937 ATCTGTAAGGAAAAAAGGGAGGG + Intergenic
1158005422 18:52667031-52667053 ATCTGTGAGTCAAAATTTGAGGG + Intronic
1159560334 18:69986205-69986227 ATCTCTAAGCAAAGTATTGAGGG - Intergenic
1159713806 18:71797005-71797027 ATCTCTAAGCAAAATATTTAGGG + Intergenic
1160111378 18:76035036-76035058 ATCTATAAGATAGAAAATGAAGG - Intergenic
1167814396 19:51867169-51867191 ATTTGTAATTTAAAAATTTAAGG - Intronic
925886077 2:8394597-8394619 ATCTCTAAGGCAAAGATTGATGG + Intergenic
926377472 2:12248077-12248099 ATCTGTAAGTTAAAGATGGTTGG - Intergenic
926900450 2:17746054-17746076 ATTTTTAAGGTAAAAATGGATGG - Intronic
926968424 2:18441585-18441607 ATGTGTAAGTTAAAAAACGATGG - Intergenic
927584914 2:24294034-24294056 ATCAGTAAGCTGAAAATTGTAGG - Intronic
929205916 2:39292691-39292713 ATCTGGCAGCTTAATATTGATGG - Intronic
929268058 2:39940829-39940851 ATTTCTAAGCTAAGTATTGAGGG - Intergenic
929705206 2:44204313-44204335 AATTGTAAGTTAAAAATTCATGG + Intronic
930893516 2:56419780-56419802 ATCTCTAAAATAAAAGTTGAGGG - Intergenic
931564452 2:63600698-63600720 CACTTTAAGCTAAAAATTTAAGG - Intronic
931658413 2:64532135-64532157 ATCTTTCACCTAAAAATTGAAGG + Intronic
932470879 2:71955745-71955767 TTCAGTAAACTAAAAATAGAGGG - Intergenic
933279446 2:80316930-80316952 ATCTGGAAGAGAGAAATTGAGGG + Intronic
933473408 2:82757225-82757247 CTCGGTAAGTTAAAAATAGAGGG - Intergenic
933593498 2:84259501-84259523 AGCAGTAAACTAAGAATTGAGGG - Intergenic
934020217 2:87942467-87942489 ATATGTCAACTAAAAATAGAAGG - Intergenic
934325502 2:92010323-92010345 ATCTGTAAACTAAATAGTAAAGG - Intergenic
934463851 2:94240940-94240962 ATCTGTAAACTAAATAGTAAAGG - Intergenic
934875656 2:97917386-97917408 ATCTGTGACCTAAAAATCTAAGG + Intronic
935818963 2:106874664-106874686 CTCTTTAAGAAAAAAATTGAGGG - Intronic
939011207 2:136847782-136847804 ATGTGTAAGGTAAACATTAAAGG - Intronic
939054365 2:137345379-137345401 ATTTATAAGCTAGAAATTTATGG + Intronic
939198896 2:139009287-139009309 ATATCTGAGCTAAATATTGAAGG - Intergenic
939378165 2:141398382-141398404 AACTGTAACCTAAAAATATATGG + Intronic
941763534 2:169270909-169270931 ATTTTTAAGCAAAAGATTGATGG - Exonic
941859626 2:170265263-170265285 ATTTATAAGCTAAGAATTCATGG - Intronic
942456513 2:176141784-176141806 ATCTGTAAGCCAAAAGTTAAGGG - Intergenic
943236487 2:185327647-185327669 GTGTGTAAACTAAAAATTAAAGG - Intergenic
943831286 2:192465589-192465611 AGCTGTCAGGTAAAAATTGAAGG + Intergenic
944321549 2:198349733-198349755 ATTTGTCAGCTGAAAATTTAGGG - Intronic
945262497 2:207857195-207857217 ATATGTAAGACAAAAACTGATGG - Intronic
947012824 2:225584281-225584303 TTCTGTAAGTTATATATTGATGG - Intronic
947129624 2:226908208-226908230 TTCTGTGAGCTGAGAATTGAAGG + Intronic
947608178 2:231503885-231503907 ATATTTAAGCTAAAACTGGATGG + Intergenic
948543533 2:238707449-238707471 ATCTGTCAACTAAAAATTCTAGG - Intergenic
1170404778 20:16024695-16024717 ACCAGGAAGCTGAAAATTGAGGG + Intronic
1171733734 20:28742658-28742680 ATCTGCAAATTAAAACTTGATGG + Intergenic
1173432765 20:43005450-43005472 ATCTTTAGGCTGAAACTTGAAGG - Intronic
1175088091 20:56477893-56477915 ATCTGTTAGCTACAAATTCAAGG - Intronic
1176594917 21:8684106-8684128 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1178282443 21:31295032-31295054 GTCTGGAAGCCATAAATTGAAGG - Intronic
1178341749 21:31791439-31791461 ATCTGTGCCCTAAATATTGAGGG + Intergenic
1180585005 22:16880101-16880123 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1181468895 22:23126160-23126182 ATCTTTAATCTAAAAATACATGG + Intronic
1183666181 22:39247361-39247383 CTCTGCCAGCTAAAAAGTGATGG + Intergenic
1185180294 22:49356120-49356142 ATCTCTAAGCAAAATGTTGAAGG - Intergenic
949256219 3:2049811-2049833 AACTGTAAGATTAAACTTGACGG + Intergenic
949323550 3:2839097-2839119 ATCTCTTAAATAAAAATTGAAGG - Intronic
949982746 3:9512580-9512602 AGGTCTTAGCTAAAAATTGAGGG - Intronic
950267496 3:11585493-11585515 ATTTATAAGTAAAAAATTGAGGG + Intronic
950848392 3:16037418-16037440 ATCTGTATCCTAAAAAATTATGG + Intergenic
950989935 3:17422782-17422804 ATCTTTGTGCTAAAACTTGAAGG + Intronic
951059687 3:18190645-18190667 AGCTGTGAGCTAAAAAAGGAGGG - Intronic
951998464 3:28757279-28757301 ATCTGACAGCTAAAGGTTGATGG - Intergenic
953475729 3:43204380-43204402 AGCTGTAAGATACAAATTGTGGG - Intergenic
956165448 3:66395117-66395139 AGCTGTGAGCTAAAGAATGATGG + Intronic
956980775 3:74634728-74634750 TTCTGTAAGCCAAAAATCGTTGG - Intergenic
958130317 3:89410978-89411000 ATCTGTGAGCTCAAAAGTAATGG + Intronic
958419618 3:93915509-93915531 ATTTCTAAGCAAAATATTGAAGG - Intronic
958479615 3:94630287-94630309 ATCTTTAAGATACAAATTGTTGG + Intergenic
959055688 3:101565514-101565536 TTCTGCAATCTAAAAATAGATGG + Exonic
959486218 3:106929750-106929772 ATCTCTAAGCTTAAAATTTTGGG + Intergenic
959658139 3:108833684-108833706 ATCTTCCAGCTAAATATTGAAGG - Intronic
961910165 3:130306596-130306618 ATTTTTAAGATTAAAATTGAAGG - Intergenic
963575457 3:147056134-147056156 ATCTTTAAGCTGAGATTTGATGG - Intergenic
964172962 3:153792378-153792400 ATCTGTAATCTAAAAATGATGGG + Intergenic
964946300 3:162229605-162229627 ATCTGTAAGCTCAGAGTTTAAGG + Intergenic
965314232 3:167171271-167171293 ATCTGTCAGCTACAAATTCAGGG + Intergenic
965573498 3:170194935-170194957 ATCAGTAATTTAAAAATTGTCGG + Intergenic
965752599 3:171991956-171991978 ATCTGTAAACTGAAAAAAGAGGG - Intergenic
966338805 3:178902180-178902202 ATTTGTAAGCAAAATATAGAAGG + Intergenic
966815651 3:183887666-183887688 ATCTGTAAGAAGAAAAGTGATGG + Intergenic
966953837 3:184852486-184852508 ATCTGTAAACTAAACAGAGAAGG - Exonic
967281865 3:187830900-187830922 ATCTGTAGGCTAGAGCTTGAAGG - Intergenic
967449022 3:189601461-189601483 ATCTGCAAGTTAGAAATTTAGGG - Intergenic
971022885 4:22556390-22556412 ATATTTAAGCAAAATATTGAAGG + Intergenic
971768391 4:30864395-30864417 CTTTCTAAGATAAAAATTGAAGG - Intronic
972053992 4:34776883-34776905 TTCTGGAAGTTAGAAATTGATGG + Intergenic
974489235 4:62543529-62543551 AAAAGTAAGCTAGAAATTGAAGG - Intergenic
974786243 4:66622546-66622568 ATCTGTAAGCAGAAAATTCTAGG + Intergenic
976028191 4:80717288-80717310 ATGTGTAAGCAGAAAACTGAAGG + Intronic
976426200 4:84905885-84905907 ACCTTGAAGCTGAAAATTGAAGG - Intronic
976663214 4:87562117-87562139 ATCTGTAAGCTAATAAAGAATGG + Intergenic
977323096 4:95544775-95544797 ATATGTAGGCTAAAACTTCAAGG + Intronic
977325104 4:95564905-95564927 ATATGTTAACTAAAAATAGAAGG - Intergenic
977399018 4:96508738-96508760 ATATGTAAAATATAAATTGAAGG + Intergenic
977436563 4:97004047-97004069 ATTTCTAAGCAAAATATTGAAGG - Intergenic
979080051 4:116326979-116327001 ATATGTAAGATGAAAATTAATGG - Intergenic
980011956 4:127606235-127606257 CTCTGTCAGTTAAAAATTGGGGG - Intergenic
980293901 4:130884081-130884103 CTCTATAAGGTGAAAATTGATGG - Intergenic
980462414 4:133133049-133133071 ATCAGTAAGCTAAATATATATGG + Intergenic
981118920 4:141025752-141025774 ATATGTAAGTTAAAATTTTAAGG + Intronic
981167460 4:141578354-141578376 ATCTGCATGCTAGAAAATGAGGG - Intergenic
981796809 4:148605072-148605094 ATTTCTAAGCAAAATATTGAAGG + Intergenic
982147001 4:152405686-152405708 AATTGTAAGATAAAAATTGGAGG - Intronic
982278660 4:153662519-153662541 ATCTCTAGGCTGAAAAGTGAGGG + Intergenic
982692177 4:158561121-158561143 ATTTATAAACTAAAAAGTGAAGG - Intronic
982937087 4:161493940-161493962 ATATGTAAGCCTAAAATTGGGGG - Intronic
983152790 4:164305893-164305915 ATATGTCAACTAAAAATTAAAGG + Intronic
983354340 4:166636724-166636746 AGCTGACAGTTAAAAATTGAGGG - Intergenic
983355231 4:166648414-166648436 ATCAGTAAACTAGATATTGACGG - Intergenic
984018308 4:174452639-174452661 ATTTGTAAGTTACAAGTTGAAGG + Intergenic
986075925 5:4338122-4338144 ATTTCTAAGCAAAACATTGAAGG - Intergenic
986187112 5:5454357-5454379 ATACTTAAGCTAAAAATTGAAGG - Intronic
986217720 5:5736230-5736252 TTCTTTAAGCTAAAAATTTCAGG - Intergenic
988208221 5:28168403-28168425 ACCTTCAAGTTAAAAATTGAAGG - Intergenic
988317203 5:29645424-29645446 ATATGTTGACTAAAAATTGAAGG + Intergenic
988803661 5:34720278-34720300 ATGTGTAAACCAAAAATTTAAGG + Intronic
990046470 5:51438705-51438727 ATCTAAAAGCTTAAAATTAAAGG + Intergenic
990705085 5:58519212-58519234 CTCAGTAAACTAAATATTGAAGG + Intergenic
990854764 5:60252238-60252260 ATATGTAAGCTAAAAATACATGG + Intronic
991123674 5:63045466-63045488 ATTTGTTAGTTAAAAGTTGATGG + Intergenic
991240807 5:64458133-64458155 ATTTGTAAGTTTTAAATTGAGGG - Intergenic
991655515 5:68900193-68900215 ATTTGAAAGCTAGAAAATGATGG - Intergenic
992611868 5:78514942-78514964 GTGTGTATGCTATAAATTGATGG - Intronic
993435945 5:87894272-87894294 AACTGTAAGGTAGAAATTGGAGG - Intergenic
993473167 5:88331767-88331789 ATATGTGAACTGAAAATTGATGG - Intergenic
993748230 5:91629457-91629479 ATCTGTGAGCCAAAAATGGGAGG + Intergenic
994450194 5:99931209-99931231 ATCTCTAGGGTATAAATTGATGG - Intergenic
994579345 5:101618838-101618860 ATTTTTAAAATAAAAATTGATGG - Intergenic
994892415 5:105653929-105653951 ATATGCAAGCTAAAAGATGATGG + Intergenic
994937802 5:106278310-106278332 ATCTGGAAGGTAAATATTGCAGG - Intergenic
995063885 5:107839332-107839354 AGGTGTAAGCCAAAAATAGATGG - Intergenic
995307627 5:110672591-110672613 ATCTCTATGCTAAATATTTATGG - Intronic
996026352 5:118650477-118650499 ATTTATAAGCTAAAAGTTCAGGG + Intergenic
996979460 5:129472270-129472292 TTATGCAAGCTAAAATTTGAGGG + Intronic
997825041 5:137098734-137098756 ATCTGGGAGGCAAAAATTGATGG - Intronic
1000188625 5:158886108-158886130 ATCTGGAAGGTAGGAATTGATGG - Intronic
1002973762 6:2052387-2052409 ATCTCTAAGCTGAAAGTTAAAGG + Intronic
1004107016 6:12675259-12675281 AATTATAAACTAAAAATTGATGG + Intergenic
1004438951 6:15628295-15628317 ATCTGTACGATAAAAAATAAAGG + Intronic
1006054734 6:31375320-31375342 ATCAGTAATCTATATATTGATGG + Intergenic
1007076331 6:39069084-39069106 ATCTCTAAGCAAAGTATTGAGGG - Intronic
1008816573 6:55575449-55575471 ATATGTAAGCTGAAAAATTAAGG + Intronic
1008962769 6:57282729-57282751 ATCTGTAAGCTAACGAGAGAGGG + Intergenic
1009275897 6:61679235-61679257 AAATGTAAGCTAAATTTTGATGG - Intergenic
1010192420 6:73208129-73208151 ATCTATAATATAATAATTGATGG - Intergenic
1010647502 6:78408866-78408888 CTCTGAAGGCTAAAAATTCAAGG - Intergenic
1010685625 6:78851968-78851990 ATCAGTAAGGTAAAAAGTGCTGG + Intergenic
1010793932 6:80097470-80097492 ATCTACAAACTAAAAATTTATGG - Intergenic
1012721239 6:102748569-102748591 ATCTTTAAACTAACAAATGATGG - Intergenic
1013720075 6:113014731-113014753 ATCTTTATGCTAAAAAATAATGG + Intergenic
1014559229 6:122870977-122870999 ATTTCTAAGCAAAACATTGAAGG + Intergenic
1014728396 6:125001884-125001906 ATCTGTCAGGGAATAATTGATGG - Intronic
1014848118 6:126305054-126305076 ATCAATAAGCTAGAAATAGAAGG - Intergenic
1015297202 6:131609439-131609461 ATCTTTAAGCTAACACTTGAAGG - Intronic
1018373485 6:163189559-163189581 ATCTGTAAGCTAAAAATTGATGG - Intronic
1020167277 7:5817788-5817810 AACTCCTAGCTAAAAATTGAAGG - Intergenic
1021747200 7:23753954-23753976 ATCTGTAGACCAAAAATTGAAGG + Intronic
1022138447 7:27471177-27471199 ATCTGTAAGTGAAAAATAAAGGG + Intergenic
1022934477 7:35158058-35158080 ATCTGTATGTTAAAATTTTATGG + Intergenic
1023111296 7:36813533-36813555 ACCTTTAAGCAAAAACTTGAAGG - Intergenic
1023265496 7:38401196-38401218 ATGTGTAACCTAATAATTGTTGG - Intronic
1025075331 7:55937595-55937617 ATCTGTTACCTAAGAATTAAGGG + Intronic
1029830414 7:103250837-103250859 ATCTGTATGTTAAAATTTTATGG + Intergenic
1030013535 7:105195546-105195568 ATGGGGAAACTAAAAATTGATGG - Intronic
1030950804 7:115789042-115789064 ATCTGTCATCTTAAAACTGAAGG + Intergenic
1031112974 7:117633671-117633693 ATCAGCAAACTAAAAATAGAAGG - Intronic
1031113307 7:117638056-117638078 AACTGTAAGTGAAAAATTGCTGG - Intronic
1031187755 7:118504523-118504545 ATCAGCAAACCAAAAATTGAGGG - Intergenic
1033277078 7:139980075-139980097 GTCTTTAAGCTAAATTTTGAGGG - Intronic
1033383711 7:140850311-140850333 ATCTCTAAGCTCAAAATTTGAGG - Intronic
1033616606 7:143022577-143022599 ATTTCTAAGCAAAATATTGAAGG + Intergenic
1033910394 7:146256844-146256866 AACAGTAAGCTAAAACTTGGAGG + Intronic
1034055929 7:148035041-148035063 ATTTCTAAGCAAAATATTGAAGG + Intronic
1035450069 7:158971945-158971967 AACTACAAGCAAAAAATTGATGG - Intergenic
1035960878 8:4136288-4136310 ATCTGGAAGCTAAAAAAAGATGG - Intronic
1038046651 8:23771359-23771381 AATTGTAAGCTAAAATCTGAGGG + Intergenic
1038218708 8:25587141-25587163 ATGTTTAAGCTAAGACTTGAAGG + Intergenic
1039667642 8:39553082-39553104 ATTTATAGGCTAAAAATTGAGGG + Intergenic
1039926728 8:41940766-41940788 AACTGTAAGCTAAAACGAGAAGG + Intronic
1040018661 8:42720977-42720999 ATCTGGAACCTAAAGATTGATGG - Intronic
1040056017 8:43057213-43057235 ATCTGAAAGCAAAGAACTGATGG - Intronic
1040745585 8:50637405-50637427 TTCTGTATGATAAAATTTGAAGG + Intronic
1041249849 8:55923412-55923434 ATCTGTAAGCAAGAAATTTTTGG - Intronic
1041943791 8:63419265-63419287 CTCTGAAAGGTAAAAATTGAGGG + Intergenic
1041976425 8:63804048-63804070 ATCTCTAAATTAGAAATTGAAGG + Intergenic
1042671479 8:71268061-71268083 ATGTGTAAGCCAATAATTTATGG + Intronic
1042993083 8:74662603-74662625 TTCTGTAAGGTATAATTTGAGGG + Intronic
1043202970 8:77395047-77395069 ATCTGTTAGTTCAAAATAGAAGG + Intergenic
1043367170 8:79546469-79546491 ATATGTAATATAAAAATTAATGG - Intergenic
1043576571 8:81665676-81665698 AACTGTTAGCCAAAAATTCAGGG + Intronic
1043615095 8:82115447-82115469 ATCTCTAAGCAAAATTTTGAGGG - Intergenic
1044117873 8:88356448-88356470 GTCGCTAAGCTAAAACTTGATGG + Intergenic
1044425159 8:92041791-92041813 TTTTTTAAGCTAAAAAATGAAGG + Intronic
1045153766 8:99441973-99441995 GTCTGTAAAGTAAAAATGGAAGG + Intronic
1045680137 8:104650126-104650148 ATATGGAAGCAAAAAATTGTAGG - Intronic
1046619476 8:116513192-116513214 ATTTGTAAGCTCATATTTGAAGG - Intergenic
1046855946 8:119032214-119032236 ATCTGTAAAATATAAGTTGAGGG + Intronic
1047451711 8:124971091-124971113 ATGTGTAAGCTGAAATCTGAAGG + Intergenic
1047474295 8:125211585-125211607 ATCTGTAAGGTAAATACTGGTGG + Intronic
1049976696 9:866827-866849 ATCTCTCAGATAAAAATTGAGGG - Intronic
1049993732 9:1015072-1015094 ATCTTTAAGAACAAAATTGAAGG - Intergenic
1050633522 9:7585113-7585135 ATCTGTATGTTACAATTTGAAGG - Intergenic
1052730266 9:32277091-32277113 ATTTCTAAGCAAAATATTGAAGG - Intergenic
1053373316 9:37581067-37581089 ATATGTAATGTAAAAATTGTGGG - Intronic
1053693943 9:40617741-40617763 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1053940935 9:43248171-43248193 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1054270892 9:63022395-63022417 ATCTGTAAACTAAATAGTAAAGG + Intergenic
1054305188 9:63416965-63416987 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1054403935 9:64740945-64740967 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1054437556 9:65226455-65226477 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1054492847 9:65795526-65795548 ATCTGTAAACTAAATAGTAAAGG + Intergenic
1055131074 9:72775496-72775518 TTCTCTAAGCTAAAAATTTGGGG + Intronic
1055249766 9:74289825-74289847 ATCAGTCATCTAAAAATAGAAGG - Intergenic
1055250780 9:74302645-74302667 ATTTTAAAGCTAAATATTGAGGG - Intergenic
1056299612 9:85227598-85227620 ATCTGTAAGCTAAATATTTCTGG + Intergenic
1056669537 9:88614178-88614200 ATCAGTAAGCTAAAATGTGAGGG - Intergenic
1057680698 9:97180653-97180675 ATCTGAAAGCTGAGAATTCAAGG - Intergenic
1057732907 9:97626718-97626740 ATATCTAAAATAAAAATTGAGGG + Intronic
1057923272 9:99117396-99117418 AACTTAAAGCAAAAAATTGAAGG - Intronic
1058502092 9:105630872-105630894 ATCTGTAATCTCAACATTTAGGG + Intronic
1058731591 9:107855277-107855299 ATCTGTAAGCTAAAGCTATAAGG - Intergenic
1185817133 X:3166513-3166535 ATCAGGAAGCCAAAAATTGAAGG - Intergenic
1187944730 X:24415296-24415318 ATTTCTAAGCAAAATATTGAAGG + Intergenic
1188173235 X:26955094-26955116 ATGTGAAAACTAAAATTTGAAGG - Intergenic
1188553964 X:31391021-31391043 ATATTTAAGCTAAAATCTGAAGG - Intronic
1188722302 X:33538139-33538161 ATGTGAAATCTAAAAGTTGAAGG + Intergenic
1189265018 X:39708482-39708504 AACTGGAAGCTAAAAGATGATGG + Intergenic
1189871165 X:45384602-45384624 ATCTGAAAACTGAAAAATGATGG - Intergenic
1192087908 X:68119722-68119744 ATCTGTAATTTACAAATTGCTGG + Intronic
1192791962 X:74391354-74391376 ATATGTGAGGCAAAAATTGATGG + Intergenic
1193008453 X:76647444-76647466 ATTTCTAAGCAAAATATTGAAGG - Intergenic
1193249238 X:79268708-79268730 CTCTGAAAGCTTAAAATTTAGGG - Intergenic
1193898759 X:87148808-87148830 ATTTCTAAGCTAAGTATTGAAGG - Intergenic
1194293094 X:92099789-92099811 ATTTATATGCTAAAAATTGTTGG + Intronic
1194961302 X:100238738-100238760 AAGTGGGAGCTAAAAATTGAGGG - Intergenic
1195814748 X:108872819-108872841 ACATTTAAGCTGAAAATTGAAGG + Intergenic
1197689816 X:129486110-129486132 ATGTGTCAACTAAAAATAGAAGG + Intronic
1197979662 X:132202052-132202074 ATCTGAAGGCCAATAATTGATGG + Intergenic
1198591678 X:138190140-138190162 ATTTGTCAGCTAAATAATGAAGG + Intergenic
1198801887 X:140456684-140456706 ATCTGTGAGCTAAACATTAGGGG + Intergenic
1199018761 X:142850517-142850539 ATTTGTAAGGTAAAATTTCATGG - Intergenic
1199124305 X:144096661-144096683 ATATGTCAACTAAAAATAGAAGG + Intergenic
1200324171 X:155220815-155220837 TTCTGTAAGATAAATATTTATGG + Intronic
1200610290 Y:5320244-5320266 ATCTGTAATATAAAAATATATGG + Intronic
1200610607 Y:5324337-5324359 ATTTATATGCTAAAAATTGTTGG + Intronic
1200660805 Y:5954873-5954895 ATTTGTAAGATATAAAATGAAGG + Intergenic
1201191715 Y:11449287-11449309 ATCTGTAAACTAAATAGTAAAGG - Intergenic
1201264203 Y:12190432-12190454 ATCAGGAAGCCAAAAATTGAAGG + Intergenic