ID: 1018377115

View in Genome Browser
Species Human (GRCh38)
Location 6:163223466-163223488
Sequence CTCAGAAAATGTTTTCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 523}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018377115_1018377118 3 Left 1018377115 6:163223466-163223488 CCATTGAGAAAACATTTTCTGAG 0: 1
1: 0
2: 6
3: 51
4: 523
Right 1018377118 6:163223492-163223514 CCACTGAGCTCCACACACAATGG 0: 1
1: 0
2: 0
3: 31
4: 201
1018377115_1018377121 18 Left 1018377115 6:163223466-163223488 CCATTGAGAAAACATTTTCTGAG 0: 1
1: 0
2: 6
3: 51
4: 523
Right 1018377121 6:163223507-163223529 CACAATGGGAAAGCAGAAGAAGG No data
1018377115_1018377122 22 Left 1018377115 6:163223466-163223488 CCATTGAGAAAACATTTTCTGAG 0: 1
1: 0
2: 6
3: 51
4: 523
Right 1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG No data
1018377115_1018377119 4 Left 1018377115 6:163223466-163223488 CCATTGAGAAAACATTTTCTGAG 0: 1
1: 0
2: 6
3: 51
4: 523
Right 1018377119 6:163223493-163223515 CACTGAGCTCCACACACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018377115 Original CRISPR CTCAGAAAATGTTTTCTCAA TGG (reversed) Intronic
900924189 1:5692692-5692714 CTCAATAAATGTTTGTTCAATGG + Intergenic
902103659 1:14015144-14015166 ATCATAATACGTTTTCTCAAAGG - Intergenic
902397881 1:16142456-16142478 CTCAGTTAATGTTTGCTGAATGG + Intronic
902475978 1:16687756-16687778 CTTAGGAAACGTTTTCTCAGTGG + Intergenic
902619008 1:17639750-17639772 CTCAGTAAATGTTTGCTGAGTGG - Intronic
902663739 1:17923156-17923178 CTCAATAAATGTTTTCTGAATGG - Intergenic
902873554 1:19328097-19328119 CTCAGAAAGTGTTTGCTGAATGG + Intronic
903311436 1:22460646-22460668 TTCAAAACCTGTTTTCTCAAGGG - Intronic
903365888 1:22805229-22805251 TTCAGAAAATGGATTCTAAAGGG + Intronic
903756881 1:25668436-25668458 CTCAGTAAATATTTTCTGAATGG + Intronic
904724365 1:32535712-32535734 CTCAGAAACTGGTTTATAAAGGG - Intronic
905480914 1:38261418-38261440 CTCAGGAAATGTTTGCTGAAAGG + Intergenic
905481110 1:38262621-38262643 CTCAGGAAATGTTTGCTGAATGG + Intergenic
905817032 1:40959446-40959468 CTCACAAAGTATATTCTCAAGGG - Intergenic
906822727 1:48946300-48946322 TTCAGCAAATGTTTACTGAATGG - Intronic
907484105 1:54765002-54765024 CTCAAAAAATATTTTGTGAATGG - Intergenic
907678170 1:56537896-56537918 CTCAGATACTATTCTCTCAAAGG + Intronic
907765195 1:57403053-57403075 ATAAGAAAATGATTTCCCAAAGG - Intronic
907811302 1:57872929-57872951 CCCAGAAAGTGTTTACTCATTGG - Intronic
907913855 1:58851049-58851071 GCCAAAAAATGTTTTTTCAAGGG - Intergenic
908172710 1:61523244-61523266 TTCAGAAAATGTATTTTCCAAGG - Intergenic
908508085 1:64826103-64826125 CTTAGAAAATATTTTTTGAAAGG + Intronic
908794554 1:67818084-67818106 GTCAATAAATGTTTTCTCAATGG + Intronic
908863135 1:68512967-68512989 CTCAAAAAAAGTGTTCTTAAAGG - Intergenic
909176236 1:72364394-72364416 CTCATTAAATGTTTACTGAAAGG - Intergenic
909540879 1:76790191-76790213 CTCAATAAATGTTTGCTAAATGG + Intergenic
909756167 1:79228587-79228609 CTCAGGAAATTTTTTCTGAGTGG + Intergenic
909899641 1:81116248-81116270 CTCAGAAAATGTTTTCTAGCTGG - Intergenic
909915968 1:81319579-81319601 CTCAACAAATGTTTTCTGAATGG + Intronic
911641999 1:100299480-100299502 CTCAGAAATTGTTGCCTCAGTGG - Intergenic
913129164 1:115823648-115823670 CTCAGATATTGTATTCTTAAAGG - Intergenic
913244852 1:116862595-116862617 CTCACAAAATACATTCTCAAGGG - Intergenic
913612237 1:120519644-120519666 CTCAGGAAATGTTTTCTCAGTGG + Intergenic
913934579 1:125022086-125022108 CTCAGAAACTGCTTTGTGAAGGG + Intergenic
914578953 1:149002594-149002616 CTCAGGAAATGTTTTCTCAGTGG - Intronic
915561509 1:156690851-156690873 CTCAGAAAATACTTCCTCAATGG + Intergenic
917186573 1:172363091-172363113 CTCAGTAAATGCTTTCAGAATGG - Intronic
917197592 1:172482850-172482872 CTCAGTAAATGTTTGCTGGATGG + Intergenic
917636835 1:176945066-176945088 CCCAGAAAATATTTTCCCATGGG + Intronic
917750175 1:178045714-178045736 CTCACAAAGTGCATTCTCAAGGG - Intergenic
918336554 1:183520870-183520892 CTCAAAAATTGTTTTTTAAAGGG + Intronic
918489562 1:185066622-185066644 CTCAATAAATGTTTCCTAAATGG + Intronic
918800692 1:188967194-188967216 GTCAGAAAATGTTATCTCAGGGG + Intergenic
918885877 1:190193788-190193810 ATCAGAAACGTTTTTCTCAAGGG + Intronic
919012548 1:191983685-191983707 CTCAGCATATGTTTTCTCTTTGG + Intergenic
919082066 1:192878753-192878775 CTCAGTCACTGTTTTCTCATTGG + Intergenic
919310615 1:195902383-195902405 CTAAAAAAATGTTTTCTCTCTGG + Intergenic
919493876 1:198239677-198239699 ATCAGCAAATGTTTTTTGAATGG + Intronic
919693871 1:200552685-200552707 ATCAAAAATTCTTTTCTCAAAGG - Exonic
921240841 1:213179984-213180006 CTCAGAAAGTGTTTACCCAGAGG + Intronic
921518431 1:216127365-216127387 TTCAGAAAATATATTCTAAAGGG - Intronic
921602324 1:217119671-217119693 ATCATATAATGTTTACTCAAAGG - Intronic
922115660 1:222611104-222611126 CTCTGAAAATGTCATCTAAATGG + Intergenic
922587734 1:226748190-226748212 TTCACAAAATGTTTTCTCTGAGG + Intergenic
923294821 1:232583837-232583859 CTCAGAAAATGATGTAACAAAGG + Intergenic
923704167 1:236329910-236329932 TTCAGAGAATGTTTTTTTAAGGG + Intergenic
923887578 1:238176327-238176349 CTTAGAAATTGTTTTCTGATGGG - Intergenic
923919044 1:238543720-238543742 CTCTGGAAATGTTATCTCAGGGG - Intergenic
924033889 1:239915812-239915834 CACAGAAAATATTTTCCCACTGG + Intergenic
924488502 1:244512009-244512031 CCCAAAAAAGGTTTTCTCCAAGG - Intronic
1062981563 10:1727041-1727063 TTCAGTAAATGTTTGCTGAATGG + Intronic
1063457392 10:6193755-6193777 CTCAGAAAGTACATTCTCAAGGG + Intronic
1063516902 10:6705779-6705801 CTCAGAAGATGTGGACTCAATGG + Intergenic
1064198326 10:13263612-13263634 CTCAGTAAATATTTACTAAAGGG + Intergenic
1064575592 10:16742900-16742922 CCCAGAAAATGTTTTCAGCATGG - Intronic
1065093941 10:22262783-22262805 CTCAGACATTATTTTCTCTAAGG - Intergenic
1065160243 10:22912083-22912105 CACAGAAGATGTTATCTCAAAGG + Intergenic
1065471189 10:26082864-26082886 AACAGAAAATGTTTTCTGATTGG - Intronic
1065776294 10:29123439-29123461 CTCAGAAAGAGTGTTCTCAGAGG - Intergenic
1066147649 10:32578016-32578038 GTCAGAAAATGGTTTCTTACAGG + Intronic
1066314630 10:34232234-34232256 CTCACAAAATGTTTCTTCCAAGG + Intronic
1067378465 10:45750553-45750575 CTCATAAAATGTTCCTTCAAAGG - Intronic
1067883077 10:50063579-50063601 CTCATAAAATGTTCCTTCAAAGG + Intergenic
1067886161 10:50091233-50091255 CTCATAAAATGTTCCTTCAAAGG - Intronic
1068434172 10:56969358-56969380 GTCAGAAAACTTTTTCTTAAAGG + Intergenic
1068499065 10:57820198-57820220 CTCTGAATGTGTTTTCCCAAGGG - Intergenic
1068556953 10:58468808-58468830 ATGAGAAAATGTCTTCTAAAGGG - Intergenic
1068626018 10:59248491-59248513 GTCAGGAAACGTTTTCTAAAGGG + Intronic
1068686803 10:59878832-59878854 TTCAGAAAATTTTTTTTCATAGG + Intronic
1068852088 10:61754343-61754365 CTCAGGAAATGTTTGCACCACGG + Intronic
1069389880 10:67923399-67923421 CTCTCAAAATGTTTTGGCAATGG - Intronic
1069678089 10:70263571-70263593 CTCAGAAAATGTGCTGTGAATGG - Intronic
1069812662 10:71173981-71174003 CTCAGAAAATGGCTTCATAATGG - Intergenic
1071855972 10:89624799-89624821 CCCAGAAAATGTTTTCAACAAGG + Intronic
1073061498 10:100736304-100736326 ATCTGAAAATGTTTACCCAAAGG + Intronic
1073305391 10:102499932-102499954 CTCAATAAATGTTTTTTCATTGG - Intronic
1073648356 10:105331365-105331387 CCCAGAAAACGTTTTCAAAATGG + Intergenic
1073766986 10:106693522-106693544 CTCAGAAAATATTTATTGAATGG - Intronic
1073965635 10:108986219-108986241 CTCCAAAAATGTTTCCTTAAGGG - Intergenic
1078893293 11:15576801-15576823 CTCAGAAATTGGTTTCCCTAGGG - Intergenic
1078952278 11:16147537-16147559 TTCACAAAATGTTTCCTTAAAGG + Intronic
1082291505 11:50378986-50379008 CTCAGAAACTGTTTTGTGATGGG + Intergenic
1082589994 11:54994768-54994790 AACAGAAAGAGTTTTCTCAAAGG - Intergenic
1082853505 11:57786111-57786133 CTCAGAAAATCTAGTCTTAAGGG + Intronic
1083631820 11:64099401-64099423 CTCAGAATATGTTTGCTGGATGG + Intronic
1084513001 11:69617759-69617781 CTCTGAAAGTGTCTACTCAAGGG - Intergenic
1085939418 11:81190936-81190958 TTGAGAAAATGTTTTCCCAGTGG + Intergenic
1086423794 11:86664471-86664493 CTCAGAAAGTGTTTTCTCATAGG - Intronic
1086838494 11:91655376-91655398 ATCAAAGAATGTTTCCTCAAAGG - Intergenic
1086851310 11:91812460-91812482 ATCAGCAAATGTTTTTTTAAAGG + Intergenic
1086918881 11:92563179-92563201 CTCAGAAAATATTTTCTAATTGG + Intronic
1087343086 11:96933953-96933975 TTCAGAAAATATTTACTGAATGG + Intergenic
1087417371 11:97874373-97874395 CCCAGAAACTGATTTCTCATTGG + Intergenic
1087599889 11:100300411-100300433 CTGAGAAAATGTTCTACCAAAGG + Intronic
1087651981 11:100878486-100878508 CTCAGCAATTGTTTTCTCCCAGG + Intronic
1087676876 11:101173845-101173867 CTCTGAAAATGTTTGCTGAGTGG + Intergenic
1088597944 11:111453708-111453730 CTCAAAAAATCTTTTCTGAGTGG + Intronic
1089480853 11:118803897-118803919 CTCAGTAAATGCTTACTGAAGGG + Intergenic
1090051602 11:123384792-123384814 GTCAGAAAACTTTTTCTTAAAGG + Intergenic
1090992040 11:131826577-131826599 GTCAGAAAAAGTATTCTAAATGG + Intronic
1091521298 12:1246571-1246593 GTCTCAAAATGTTTTCTCTAAGG + Intronic
1091615151 12:2045303-2045325 GATAGAAAATGTCTTCTCAAAGG - Intronic
1091843875 12:3640003-3640025 CACAGAGCATGTTTTTTCAAAGG + Intronic
1091974349 12:4812530-4812552 AACAGATACTGTTTTCTCAAAGG + Exonic
1092009073 12:5094563-5094585 ATTAGAAAATCTTTTCTGAAAGG + Intergenic
1092313526 12:7384467-7384489 CCCACAAAATGTATTCTCCAAGG + Intronic
1093666589 12:21821064-21821086 CTCAGTGAATGTTTTATGAAGGG - Intronic
1093876419 12:24354182-24354204 ATCAGAAAATGTTCTCCCAGGGG + Intergenic
1094866658 12:34541092-34541114 CTCACAAAGTGGTTTCTCAGTGG + Intergenic
1096004855 12:48161178-48161200 CTCAGTAAATGTTTGATGAAAGG - Intronic
1096775802 12:53963349-53963371 GTCAGAAAATGCTTCCCCAAAGG - Intergenic
1096838329 12:54365729-54365751 CTCAGCAAACTTTTTCTCAAAGG - Intergenic
1097693846 12:62758987-62759009 CTCACAAAGTATATTCTCAAGGG - Intronic
1098338239 12:69425333-69425355 CTCAGAAAGTGTGTTTTAAATGG + Intergenic
1098375820 12:69812773-69812795 CACAGAAAATGTGCTCTCACTGG + Exonic
1098401504 12:70081378-70081400 CTCAGGAAATTTTTTCAAAAGGG + Intergenic
1099685477 12:85882066-85882088 CAAAGAAATTGTTTTTTCAAAGG - Intronic
1099717825 12:86319080-86319102 GTCAGAAAATGTGTTCTCACAGG - Intronic
1099832320 12:87859575-87859597 CTCAGATAAGGTTTTCACATTGG - Intergenic
1099875561 12:88401697-88401719 CTCAGTAAATGTTTGTTGAAAGG + Intergenic
1100228459 12:92582872-92582894 TTCAGAAAATGTTTACCCTATGG - Intergenic
1100378875 12:94043407-94043429 CTCATAAGATGTTTTATAAAGGG - Intergenic
1100466104 12:94847143-94847165 CTCAGGAAAGTTTTTCTGAAAGG - Intergenic
1101700531 12:107169721-107169743 CTCAGAATGGGTCTTCTCAATGG - Intergenic
1101933348 12:109033994-109034016 CTCAGATAATGTGTTCCCAGAGG + Intronic
1101975191 12:109351627-109351649 CTCAGAAAATATTTGCTGATTGG + Intronic
1102797895 12:115704886-115704908 CTCAGTAAATGTTTATTGAATGG + Intergenic
1103477513 12:121229475-121229497 CCCAGGAATTGGTTTCTCAAAGG + Intronic
1105651092 13:22378878-22378900 ATCAGAAACTGTTTCTTCAAGGG + Intergenic
1105715858 13:23064166-23064188 CTCAGAGAATAGTTTCTCTAAGG - Intergenic
1106906966 13:34419554-34419576 ATCAGAAAATCTTATCCCAAGGG - Intergenic
1107020613 13:35747288-35747310 CTCAGCCAATGTTTTCTAAAAGG + Intergenic
1107699186 13:43030821-43030843 CTTAGTAAATGTCTTTTCAAGGG + Intronic
1108062122 13:46543883-46543905 CTCTCAAGATGTTTTTTCAACGG + Intergenic
1108089059 13:46826873-46826895 ATCAGAAAATATTTTCTATAAGG - Intergenic
1108709256 13:53016904-53016926 CTCAGTTAATGTTTGCTCTATGG + Intergenic
1108714829 13:53068847-53068869 CTTAGAAAGTCTTTTCTGAAAGG + Intergenic
1109044894 13:57397487-57397509 CTATGAAAATGTTATCTCTAAGG - Intergenic
1109045458 13:57405587-57405609 CTCACAAAATACATTCTCAAGGG - Intergenic
1109098066 13:58143302-58143324 CTCAGAGAATTTTCTCTTAATGG - Intergenic
1109186422 13:59274324-59274346 ATGAGAAAATATGTTCTCAAGGG + Intergenic
1109269177 13:60235368-60235390 CTCAGAACATGTGTTCTGAGAGG - Intergenic
1109585337 13:64394597-64394619 ATCAGAAAGAGTTTTCACAAAGG - Intergenic
1109757916 13:66786260-66786282 ATGAGAAATTGCTTTCTCAAGGG - Intronic
1110673212 13:78207083-78207105 CTCAGAAACTTTTATCTCATGGG + Intergenic
1111379057 13:87422008-87422030 CACAAAAAAAGTTTTCCCAATGG - Intergenic
1111397745 13:87688438-87688460 CACAGAAAATATTTTCCAAATGG + Exonic
1112090336 13:96076515-96076537 CTCAATAAATGTTTACTGAATGG - Intergenic
1112280891 13:98062042-98062064 CTCACAAAATACATTCTCAAGGG + Intergenic
1112666218 13:101576837-101576859 CTCAGACAATTCTTTCTTAAAGG + Intronic
1113011835 13:105776411-105776433 CTCAGAAAATGTATTCTGTTTGG + Intergenic
1114914567 14:27246887-27246909 CTCTGAAGCTGTTTTCTCTAAGG - Intergenic
1115090675 14:29570892-29570914 CTCAGCAAATCCTTTCCCAAAGG + Intergenic
1115961267 14:38837753-38837775 CTCACAAAATGCTTGCACAAGGG - Intergenic
1115993624 14:39173967-39173989 CTCAGAAAACATTTTTTCACAGG - Intergenic
1116211350 14:41949859-41949881 CTCAAACATTGTTTTCTCATTGG - Intergenic
1116586268 14:46708728-46708750 CTCAGAAAATGCTTTAACTAAGG + Intergenic
1116855181 14:49945866-49945888 CTCAGAAAAAGCTTTCTCCCTGG - Intergenic
1117589066 14:57246276-57246298 CCCAGACCAGGTTTTCTCAAGGG + Intronic
1117603633 14:57401678-57401700 CTCAGAAAAGGTTTAATCATAGG - Intronic
1117947341 14:61042375-61042397 CTCTGTAAATGTTTGCTCCAGGG - Intronic
1118869518 14:69729476-69729498 CTCAGAAACTGGTATCCCAATGG + Intronic
1118877831 14:69799344-69799366 GCAAGAAACTGTTTTCTCAAAGG - Intergenic
1119139756 14:72255542-72255564 CTCTGAATTTGTTTTCTCATTGG + Intronic
1119559039 14:75575658-75575680 CTCAATACATGTTTTTTCAATGG + Intergenic
1120277818 14:82399447-82399469 GTCAGAAAAGGTGTTTTCAAGGG - Intergenic
1120858097 14:89230284-89230306 CTCAGAAAACGTCTGCTGAATGG + Intronic
1121841536 14:97138475-97138497 ATAAGAGAATGTTTACTCAAAGG - Intergenic
1122430426 14:101636652-101636674 CTTGATAAATGTTTTCTCAATGG - Intergenic
1123910503 15:24961498-24961520 CTCATAAAATGGCTGCTCAAGGG - Intronic
1123916201 15:25030532-25030554 ATTAGAAAATGTTTTCTCTCTGG + Intergenic
1124808896 15:32914397-32914419 CTCACAAAATGTTTAGGCAATGG + Intronic
1124866226 15:33494142-33494164 CTCAGCAAGTCTTTTGTCAAAGG + Intronic
1125388532 15:39165937-39165959 TTAACAAAATATTTTCTCAAAGG + Intergenic
1126938408 15:53737942-53737964 GTCAGATAATGTTTCCTAAATGG - Intronic
1127006268 15:54573549-54573571 CTCAGTAAATGTTTGTTAAATGG - Intronic
1127122410 15:55783021-55783043 CCCAGAAAAGGTTTTTCCAAGGG + Intergenic
1128927726 15:71674099-71674121 TTCAGAGAATGGTTTCTCTAGGG + Intronic
1129865560 15:78905525-78905547 GTCTGAAAATGTTTTCTTGAAGG - Intergenic
1130521254 15:84662366-84662388 CTAACAAAATGTTTTCTTAAAGG + Intergenic
1130578872 15:85117201-85117223 TTCAGGAAATGTTTTCTTATAGG + Intronic
1131670806 15:94617872-94617894 CTGAGAAGTTGGTTTCTCAAAGG - Intergenic
1132332630 15:101023322-101023344 CTCAAAAAATTTTTTTTGAATGG - Intronic
1133261389 16:4552963-4552985 CTCAGTAAGTGTTTGCTAAATGG - Intergenic
1133363521 16:5192878-5192900 CTCACAAAGTACTTTCTCAAGGG + Intergenic
1136034750 16:27530732-27530754 CTCAGTAAATATTTGCTGAATGG - Intronic
1136183779 16:28573049-28573071 CACGGAAAATGTTTTCCCCAAGG + Intronic
1137567292 16:49541226-49541248 CTCAGCCAATGATTGCTCAATGG + Intronic
1138816440 16:60208468-60208490 ATCAGTAACTGTATTCTCAAAGG + Intergenic
1139764212 16:69213364-69213386 TTCAGAAAATGCTTACTCAGTGG + Intronic
1140162217 16:72509001-72509023 CTCAGAAAGTGTTTTTAAAATGG + Intergenic
1140328438 16:74028861-74028883 CTAAGCAGCTGTTTTCTCAAGGG - Intergenic
1140862347 16:79029056-79029078 CTGGAAACATGTTTTCTCAATGG + Intronic
1141435042 16:83995180-83995202 ATCTGAAAATGTTTTCTGTAAGG - Intronic
1141875686 16:86822707-86822729 CTCAGAAAATGGCATCTCCACGG - Intergenic
1143931615 17:10435012-10435034 CTCAGAAATTATGTTTTCAAAGG - Intergenic
1144051478 17:11500700-11500722 CTCAGAAAATGAATTTTTAATGG - Intronic
1144131714 17:12252953-12252975 CTCAGAATCAGTTTTCTCACTGG - Intergenic
1144441717 17:15288531-15288553 AACAGAAAATGTTTTCCCACTGG - Intergenic
1146939199 17:36832319-36832341 CTCAATAAATGTTTCCTGAATGG - Intergenic
1148702227 17:49595531-49595553 CTCAGCAATTGTTTGCTCAGTGG + Intergenic
1150073284 17:62170909-62170931 CCCAGAAACTCTTTTCTAAAAGG - Intergenic
1150873659 17:68944436-68944458 CTCAGAACATTTTTTCCAAAGGG + Intronic
1151165876 17:72203455-72203477 CTCAAAACTTGTTTTCTGAATGG + Intergenic
1153013064 18:557622-557644 ATGTGAAAATGTTTTCCCAAGGG - Intergenic
1153752151 18:8243627-8243649 CTTGGAAAATATTTACTCAAGGG + Intronic
1154042964 18:10876850-10876872 CTCAGAAAATGCCCTCTCAGGGG + Intronic
1154193682 18:12250858-12250880 CTCAGAAAATGCTTGCTGAGTGG + Intergenic
1156720611 18:40065237-40065259 CTCAGAAAATGTCTGCCAAATGG + Intergenic
1156860977 18:41836001-41836023 CACTGAAACTGTTTTCCCAAAGG + Intergenic
1156979628 18:43269715-43269737 CTGAGAAATTATTTTATCAAAGG - Exonic
1157751964 18:50187189-50187211 CTCAATAAATGTTTTATTAAGGG - Intronic
1158236649 18:55322867-55322889 CTCTGAAAATGTGGTCTCAGGGG - Intronic
1158461821 18:57653064-57653086 ATGAGAAAATTTTTTCCCAAAGG - Intronic
1159125015 18:64213031-64213053 CCCAAAAAATGTTTGCTGAAAGG - Intergenic
1159365116 18:67455717-67455739 CTCAGAAAGTACATTCTCAAGGG + Intergenic
1159370370 18:67520752-67520774 ATCATAAGATGTTTTCTCCAGGG + Intergenic
1159500147 18:69258180-69258202 CTCAGTATTTGCTTTCTCAAAGG + Intergenic
1159526102 18:69591807-69591829 CTCAGCAAATGTTTTATTGAAGG - Intronic
1159818223 18:73104423-73104445 CTCAGATACAGTTTTCCCAAGGG - Intergenic
1164432992 19:28204343-28204365 CTTACAAAATGTTTTCTGAGTGG + Intergenic
1165509873 19:36259694-36259716 CTCACAAAGTATATTCTCAAGGG + Intergenic
1167195756 19:48027039-48027061 CTTAGAAAATCTTTTTTGAATGG - Intergenic
1167195893 19:48028190-48028212 CTTAGAAAATCTTTTTTGAATGG + Intergenic
1202709994 1_KI270714v1_random:13610-13632 CTTAGGAAACGTTTTCTCAGTGG + Intergenic
925367712 2:3322379-3322401 CTCAAAAAATGTTTTCAAAAAGG + Intronic
926210816 2:10868346-10868368 ATCAGAAAATGTTGTCTACAGGG + Intergenic
926222323 2:10944416-10944438 CTCAGAGAAGGTTATTTCAAAGG - Intergenic
926465959 2:13188457-13188479 GTCAGAAAACATTTTCTCTATGG - Intergenic
926527781 2:14003896-14003918 ATCAAAGAATGTTTTCCCAATGG + Intergenic
926570270 2:14521992-14522014 CTCAGTAAATATTTTTTGAATGG + Intergenic
927424713 2:22969276-22969298 CTCAGAAAATCATTTCCCCAAGG + Intergenic
927446226 2:23164196-23164218 GACAGAAAATTTTTTCTCTAGGG - Intergenic
929066518 2:37980932-37980954 CTCAGTAAATGTTGTTTGAATGG + Intronic
929086581 2:38173632-38173654 TTCAGAAAATATTTTATAAATGG - Intergenic
929399668 2:41565514-41565536 CTCAGAAACTGATTTCTTAGAGG + Intergenic
930044556 2:47157764-47157786 ATAAGATAATGTTTTCTTAAAGG - Intronic
931956461 2:67431762-67431784 CTCAGAAAATATTGTCCCCATGG - Intergenic
932241544 2:70161263-70161285 CTCAGAGCCTGTTTTCTCACGGG + Intronic
933239382 2:79902922-79902944 GTCAGCAAATGTTTTCTTGAAGG + Intronic
933488587 2:82954909-82954931 CTCTGAAAATGTTTTCATTATGG + Intergenic
933624024 2:84578118-84578140 GCCAGAAAATGTTTTCTATAAGG - Intronic
935059914 2:99598388-99598410 CTCAGACAACTTTTTCTCACCGG - Intronic
935108525 2:100069529-100069551 TGCAGAAAATGTTTTTTAAAGGG - Intronic
935561348 2:104563253-104563275 CTCTTAAAATGTTTTCTAGAAGG + Intergenic
935589039 2:104828564-104828586 ATCAGGAAATGTTCTCTTAAAGG - Intergenic
937232852 2:120409679-120409701 AGTAGAGAATGTTTTCTCAAAGG - Intergenic
939223495 2:139335400-139335422 ATCAGAAAATGTCTTCTCCCAGG + Intergenic
939372923 2:141326309-141326331 CTCAGGCAATGTTTTCTCCTTGG - Intronic
939508686 2:143079932-143079954 CTCTTAGAATGGTTTCTCAAGGG + Intergenic
939768946 2:146290319-146290341 CTGGGAAAATGTTTTCTTAGAGG - Intergenic
941175921 2:162197528-162197550 TTCATAAAATGTTTGGTCAATGG - Intronic
941313932 2:163968909-163968931 ATCAGAAAATATTTTCTCTTGGG + Intergenic
941619381 2:167758986-167759008 CTCCAAAAATGTTTTCTGGATGG + Intergenic
941966616 2:171306774-171306796 CTCAGAAAATGTTATACAAATGG - Intergenic
942942832 2:181639566-181639588 GTCAGATAATGTTGTTTCAAAGG + Intronic
943629031 2:190230153-190230175 AGCAGAAAATGTTTTATTAAGGG - Intronic
943802348 2:192077020-192077042 ATCAGAAAATGATATCTAAATGG + Intronic
943828194 2:192423967-192423989 CTTAAAAAATATTTTCTCCAAGG + Intergenic
944126437 2:196298994-196299016 CTCAGACAATTTTTTCTAAAGGG - Intronic
945570289 2:211458593-211458615 CTCAGAAAAGGTTTTTTGAAGGG - Intronic
945702212 2:213186006-213186028 CTCAGGAATTGTGTTTTCAAGGG + Intergenic
945887136 2:215387963-215387985 CTTAGAAAATGTTTTTTAAAAGG + Intronic
945966612 2:216194380-216194402 CTAAGAATATATTTTCTCAAGGG - Intronic
946469423 2:219944433-219944455 GTCACAAAATCTTTTCTGAAGGG - Intergenic
946706537 2:222463873-222463895 TTCAGAAAATGTTTTTTGAAGGG + Intronic
947054049 2:226080145-226080167 CTAAGAGACTGTCTTCTCAAGGG + Intergenic
947935474 2:234000025-234000047 CTCAGGAAAGGTTTTTTCCAAGG - Intronic
1169211800 20:3769899-3769921 TTCAGTAAATGTTTGCTGAAAGG - Intergenic
1170491293 20:16878052-16878074 CTCAGAAAATATTTGTTAAATGG + Intergenic
1170591336 20:17774070-17774092 TTCATAAAATGATTTCTCCAGGG - Intergenic
1170965007 20:21060555-21060577 CTCACAAAGTGCATTCTCAAGGG + Intergenic
1172434031 20:34915534-34915556 CACAGTAAATGTTTTCTGACAGG - Intronic
1172466150 20:35155970-35155992 CTCAAAAAATGTTTGCTGAAGGG - Intergenic
1173093978 20:40006528-40006550 CTAAGAAAATGTATTTCCAATGG + Intergenic
1173471522 20:43326967-43326989 CTCATAAAATTTTTTTTTAATGG + Intergenic
1174022944 20:47546294-47546316 CACAGAAAATGTTGGTTCAATGG - Intronic
1174343591 20:49913800-49913822 CTCAGAAAATGTTTTCAGCAGGG - Intronic
1174422800 20:50411143-50411165 ATCAGGAAATGTTTCCTAAAAGG - Intergenic
1175438928 20:58977130-58977152 CTCAGTAAGTATTTCCTCAATGG + Intergenic
1176915128 21:14616678-14616700 TTCAGTAAATGTTTTTTAAATGG - Intronic
1177094905 21:16820650-16820672 GTCATAATATGTTTTCTCCATGG - Intergenic
1177215699 21:18125281-18125303 ATCAGAAAATATTTACTGAATGG - Intronic
1177291232 21:19114889-19114911 CTCAAAAAATTGTTTCTCAATGG + Intergenic
1177978451 21:27881377-27881399 CTCAGAAACTCTTTTCCAAATGG - Intergenic
1178322033 21:31613147-31613169 CTCAGAAAATGTGTCCACAGAGG - Intergenic
1181904418 22:26182666-26182688 CCCACAGAATGTTTTCTCTATGG - Intronic
1181962403 22:26632175-26632197 CTCACAAAGTACTTTCTCAAGGG + Intergenic
1182156279 22:28076004-28076026 CTCATAAAATATTTTCAAAATGG + Intronic
1182755344 22:32674511-32674533 CACAGAAAATGTTTGTTGAATGG + Intronic
1182843070 22:33407741-33407763 GTCAGCAAATTTTTTCTGAAAGG + Intronic
1184095531 22:42314396-42314418 GTCAGAAAATGATTTCCCCATGG + Intronic
1184570072 22:45317386-45317408 CACAGAAAAGGTTTTCTTAAAGG + Intronic
1184758374 22:46530670-46530692 TTCAAAAAATGTTTTCTCCTTGG + Intronic
1184942542 22:47779771-47779793 CTCAGAAAATGATTTCCCCGAGG - Intergenic
950047362 3:9957248-9957270 CTCTGAAAATGTTATCTGAATGG - Intergenic
950718685 3:14867465-14867487 CACATAAAAGGTTTTCTGAAGGG + Intronic
951009443 3:17659139-17659161 CTCAAAATAGTTTTTCTCAATGG - Intronic
951116932 3:18874681-18874703 TTTTGAAAATGTTATCTCAAGGG + Intergenic
952270021 3:31821276-31821298 CTCTCAAACTGTGTTCTCAAAGG + Intronic
952742372 3:36747111-36747133 TACAGAAAATCTTTTGTCAAAGG - Intergenic
953199329 3:40764723-40764745 ATCAAAAAATGTTTTATCAAGGG - Intergenic
953624573 3:44560265-44560287 TTCAGAAAATGTTTACAGAATGG + Intronic
953827815 3:46269242-46269264 CTCAGCAAATGTTTGCTGAATGG - Intergenic
954065286 3:48100985-48101007 TTCAGAAAAGGTTTTCTGAGAGG + Intergenic
954098462 3:48350561-48350583 CTCAGAAAACCTCTTCACAAAGG + Intergenic
954328967 3:49878967-49878989 CTCTGAAACTGTTTTCACAGAGG + Intergenic
955176146 3:56615046-56615068 CTTAGAAAATGTTTACTGAGAGG + Intronic
955317451 3:57950614-57950636 CTCAGGAAATGTGGTCTAAAAGG - Intergenic
955849676 3:63206266-63206288 CTCTGAAAAAGATTTCTCCAGGG + Intergenic
956535809 3:70274998-70275020 CTCAGAACCTTGTTTCTCAAAGG + Intergenic
957443476 3:80284069-80284091 CTCTGTTAATGTTTTCTTAAGGG + Intergenic
957725055 3:84053426-84053448 CTCAGAAAAAGTTATCCAAATGG - Intergenic
958440722 3:94153210-94153232 CTCAGAAAATATTTGCTAAAGGG - Intergenic
958878800 3:99645817-99645839 CTTAGAAAATGTTCTTTCCAAGG + Intronic
959570212 3:107874927-107874949 ATCAGAATGTGCTTTCTCAAAGG - Intergenic
959756064 3:109900727-109900749 CTCAATAAATGTTTGCTGAAAGG - Intergenic
959977655 3:112480196-112480218 CTCACAAAATACATTCTCAAGGG - Intronic
961253453 3:125525590-125525612 CTCACAAAGTGCATTCTCAAGGG + Intergenic
961464025 3:127070681-127070703 CTTAGAAAATTGTTCCTCAAAGG + Intergenic
961506896 3:127375991-127376013 CTCAGGAAATATTTGCTAAACGG - Intergenic
961611864 3:128145897-128145919 CTCAATAAATGTTATCTCCAGGG - Intronic
962514403 3:136136654-136136676 CTCAGCAAATGTTTACTGAAAGG + Intronic
963585526 3:147182583-147182605 CTCTGAAAATGATGTATCAAAGG - Intergenic
963694807 3:148553133-148553155 CTCAGATATAGTTTTCTCATGGG - Intergenic
964051028 3:152393854-152393876 TGTAGAAATTGTTTTCTCAAAGG + Intronic
964418360 3:156473601-156473623 CACAGACAATCCTTTCTCAATGG + Intronic
964472668 3:157071120-157071142 CTCAGAAACTGTGGTCTCACGGG + Intergenic
964705533 3:159615043-159615065 GTCAGGAAAAGTTTCCTCAAAGG + Intronic
964999571 3:162936087-162936109 CTTAGGAAATGTATTCTAAATGG + Intergenic
965138021 3:164799446-164799468 GTCAGTAAATGTTTGCTTAATGG + Intergenic
965755644 3:172023976-172023998 CTTATAAAAAGTTTTCACAAAGG + Intergenic
966068968 3:175851380-175851402 CTCAGAAAATGTTTAGTGACAGG - Intergenic
966628133 3:182041879-182041901 TTCAAATATTGTTTTCTCAATGG + Intergenic
966714598 3:183002370-183002392 CTCATAAGATGTTTCCTCAGAGG - Intergenic
967219101 3:187234471-187234493 CAAAGAAAATGATTTTTCAAAGG + Exonic
967760956 3:193225982-193226004 CTCAGAAACTGTTCTGCCAAGGG - Intergenic
967899489 3:194434981-194435003 CATAGAAATTTTTTTCTCAATGG + Intronic
969193863 4:5545207-5545229 TTCAGTAAATGTTTGTTCAATGG - Intronic
969291579 4:6243506-6243528 CTCAGAAGATGTCTTCTGGAAGG - Intergenic
970238498 4:13983147-13983169 CTCTGAAAATGTTTTTGCTAAGG - Intergenic
970342044 4:15117725-15117747 CTCAGAAAATGTTTGCCTGAAGG + Intergenic
970500577 4:16672770-16672792 CTGAGAGAATGTTTTCTTCAAGG + Intronic
970619980 4:17808529-17808551 ATCTGAAAATATTTTTTCAAAGG - Intronic
971904082 4:32703586-32703608 CTCAGCAAATGTTTTCAATAGGG + Intergenic
972869705 4:43282469-43282491 GTCAGAAATTTTTTTCTCTAAGG - Intergenic
973055016 4:45645975-45645997 CTCAGTATGTGTTTTCACAAGGG + Intergenic
973166778 4:47087675-47087697 CTTCTAAAATGTTTTTTCAAAGG - Intronic
973208671 4:47589832-47589854 CAAAGAAAATCTTATCTCAATGG - Intronic
974641554 4:64639185-64639207 CACCCATAATGTTTTCTCAAAGG - Intergenic
975042934 4:69767317-69767339 CTCTGAATATGTTTCCTCATAGG - Intronic
975233866 4:71968534-71968556 CACAGGAAATGTTTTCTAAATGG - Intergenic
975645340 4:76540292-76540314 CTCAGCAAAAGAATTCTCAAGGG - Intronic
975728872 4:77318733-77318755 CTCAGACAATGGATCCTCAAGGG - Intronic
975881742 4:78917432-78917454 TTCCAAAAATGTTTTCTTAAGGG + Exonic
975907629 4:79233487-79233509 GTTAGAAAATTTTTTCTTAAAGG + Intronic
975978325 4:80125422-80125444 CTCAGAAAGTCTTTTCTTGAAGG + Intronic
976085602 4:81404170-81404192 CTCAGAAAATTACTTCACAAAGG - Intergenic
976237724 4:82917166-82917188 TTCAGAAACTGTTTTGTTAATGG + Exonic
977245813 4:94630128-94630150 CTCAGGAAATATGTTCTCAGTGG - Intronic
977372552 4:96158101-96158123 TGCAGAAAATGTTTTATGAATGG + Intergenic
977463244 4:97352373-97352395 TTCAGAATAATTTTTCTCAAAGG - Intronic
977526422 4:98151705-98151727 GTCTGTAAATGGTTTCTCAATGG + Intergenic
978382655 4:108146046-108146068 TTCAGCAAATGTTTTTTCAGTGG - Intronic
978585321 4:110270497-110270519 TTCAGGAAAAGTTTTCTGAATGG + Intergenic
978713372 4:111812221-111812243 CTCAGAAACTAGTTTTTCAATGG + Intergenic
980142450 4:128936334-128936356 GTCAGAGAATTTTTTTTCAAGGG + Intronic
980592520 4:134909621-134909643 CTGAGAAATCATTTTCTCAAAGG - Intergenic
981275008 4:142888931-142888953 CACAGAAAATGTCTTATAAATGG + Intergenic
982510128 4:156272045-156272067 AACAGAAATTGTTTTATCAAAGG - Intergenic
983478618 4:168245641-168245663 ATCAGATACTGTTTTCTGAAGGG - Intronic
983608776 4:169619802-169619824 CTCAATAAATGTTTGCTAAACGG + Intronic
983667474 4:170197296-170197318 ATCAGAAAAATTTTTCTTAAAGG - Intergenic
985274891 4:188228625-188228647 CTTTGAAATTGTTTTTTCAAGGG - Intergenic
985628568 5:1003196-1003218 GTCAGAAAATGGTTTTCCAAAGG - Intergenic
986104299 5:4645072-4645094 CTCAGAAATTGTGGTCACAAAGG - Intergenic
986892198 5:12322151-12322173 CTCAGAATGTTTTTTTTCAAAGG + Intergenic
986968534 5:13304271-13304293 CTCAGAAAATGTTTTTCTGAAGG - Intergenic
986973186 5:13361204-13361226 TTTTGAAAATGTTTCCTCAAAGG + Intergenic
987600736 5:20066757-20066779 CTCAGCAAAAGTTTTCTGACTGG + Intronic
987821864 5:22975126-22975148 CTCACAAAGTACTTTCTCAAGGG - Intergenic
987829750 5:23080065-23080087 CTCAAAAATTGTCTTATCAATGG - Intergenic
988330941 5:29839151-29839173 TGCAGAAAATGCTTTCTCAGAGG - Intergenic
988860125 5:35268736-35268758 CTCACAAAGTGCGTTCTCAAGGG + Intergenic
989226119 5:39031100-39031122 CTTATAAAATGTTTTCTTGAAGG + Intronic
989280021 5:39630235-39630257 CTGGGATAATGTATTCTCAAAGG + Intergenic
989454390 5:41625764-41625786 CTCAGGAAATGTTTGCTGAATGG - Intergenic
989897297 5:47107512-47107534 CTCAGAAACTGCTTTGTGAAGGG + Intergenic
990517774 5:56546414-56546436 CTTAAAAAATGTTCTCTCCATGG + Intronic
990549617 5:56861233-56861255 CTCAAAAAATGGTTTCTTAAAGG - Intronic
991542843 5:67748685-67748707 CTCACAAAGTGCCTTCTCAAGGG - Intergenic
992090939 5:73316314-73316336 CTCAGTAAATGTTTGTTGAATGG - Intergenic
992171630 5:74107635-74107657 CTTAGTAAATATTTTTTCAAAGG + Intergenic
992613163 5:78524800-78524822 CTCATGAAATGTTTTCTCTTTGG + Intronic
992656245 5:78912689-78912711 CTCAAAACATGCTTTCTCATGGG - Intronic
993389642 5:87303621-87303643 TTCAGAGTATGTTCTCTCAAGGG - Intronic
993465252 5:88237449-88237471 CTCACAAAATGATGACTCAAGGG - Intronic
993522685 5:88923169-88923191 CTCAAAAAATGTTTTCCAATGGG - Intergenic
993929839 5:93924375-93924397 CTCAGGAAATGTATACTGAATGG + Intronic
994148777 5:96424040-96424062 ATCAGAAAATGTATTTTAAAAGG - Intronic
994342728 5:98650882-98650904 CTAAGAAACATTTTTCTCAAGGG + Intergenic
995246262 5:109938827-109938849 TTGAGAATATGTTTTATCAAAGG - Intergenic
995616447 5:113969681-113969703 TTTAGAAAACGTGTTCTCAAAGG - Intergenic
996283700 5:121763857-121763879 CTCAGAGAATGTTTTCTCAGTGG + Intergenic
996422790 5:123280537-123280559 TTCAGAAAATGTATTTTAAAGGG - Intergenic
996942464 5:129024986-129025008 CTCAGAAATTATTTTCCCATGGG - Intronic
997356204 5:133264590-133264612 CACAGAAAAGGTTTTGGCAAAGG - Intronic
997926995 5:138039748-138039770 CACAGAAAATGTGGTCTGAATGG - Intronic
998279396 5:140790390-140790412 CTCATAGAATGTCTTCACAAGGG - Intronic
998450564 5:142231385-142231407 ATGAGAAAATGGATTCTCAAAGG - Intergenic
998597124 5:143543667-143543689 CTCAGCAAATGTGTTTTAAATGG - Intergenic
999892836 5:155997738-155997760 CTCAGAAGATGTTTTCCCATTGG + Intronic
1000286533 5:159831342-159831364 CTCAGCAAATGTTTCCTCTTTGG + Intergenic
1000616164 5:163429978-163430000 CTCCAGAAATGTTTTCTTAATGG - Intergenic
1000675562 5:164118512-164118534 CACAGAAAAGGATATCTCAAAGG + Intergenic
1001279773 5:170378534-170378556 TTCACAAAAGGATTTCTCAAAGG + Exonic
1001819306 5:174697337-174697359 CTCTGCAAATATTTTCTCGAGGG + Intergenic
1001962728 5:175889882-175889904 ATGAGGAGATGTTTTCTCAATGG - Intergenic
1002373909 5:178775002-178775024 AGCAGACAATGCTTTCTCAAAGG + Intergenic
1002924676 6:1598555-1598577 CTCAGTTTATTTTTTCTCAAAGG - Intergenic
1003340057 6:5212029-5212051 CTTAGAAAATATTTTCTCTTTGG + Intronic
1003438640 6:6119444-6119466 ATCAGAAAATTTTTTTTTAAAGG - Intergenic
1003584227 6:7372159-7372181 CTTAGAAAATCTTTTCTCAAAGG + Intronic
1004162081 6:13223278-13223300 CACAGAAAATTTTTTCTTTAAGG + Intronic
1004169382 6:13284101-13284123 CAGAGAAAATGATTTCTCATTGG - Intronic
1004402322 6:15300064-15300086 CTCAAAATATGATTTCTCATTGG + Intronic
1004686406 6:17950410-17950432 TTCAGAAAATGATTTATTAATGG + Intronic
1005311437 6:24563145-24563167 CTCAGTAAATGTTTGCTGATTGG - Intronic
1005330206 6:24742450-24742472 CACTGAAACTGTTTTCTAAAAGG - Intergenic
1006257260 6:32841672-32841694 CTCAGGAAATATGTTCTCCACGG - Exonic
1006939395 6:37742048-37742070 CTCCAAAAATGTTTGCTGAATGG - Intergenic
1007436491 6:41816299-41816321 TGTAGAAACTGTTTTCTCAAAGG + Intronic
1008873536 6:56301583-56301605 ATCAGAAACAGTTTTCTCAAAGG + Intronic
1009286477 6:61825308-61825330 CTCAGAATATGTTTTGCCTATGG - Intronic
1009660064 6:66599939-66599961 TTTAGCAAATATTTTCTCAAGGG - Intergenic
1011780241 6:90780658-90780680 CTGAGAAAATTTCTTCTTAATGG - Intergenic
1012007982 6:93740367-93740389 CTCATAAGATATATTCTCAATGG + Intergenic
1012055663 6:94405974-94405996 ATCATAAAATATTTTCTCCATGG + Intergenic
1012322815 6:97872406-97872428 CTCAGATTGTGTTTTCTTAATGG + Intergenic
1013089163 6:106883738-106883760 CTCAGAAAATGATATCTTAAAGG - Intergenic
1013559300 6:111288688-111288710 CACATAAACTGTTTTTTCAATGG + Intergenic
1014192489 6:118513660-118513682 CACAGAAAATATTTTTTTAAAGG + Intronic
1014300795 6:119679018-119679040 CTTAGAAAACTTTTTCTTAAAGG - Intergenic
1014503602 6:122225577-122225599 CACAGAAATTATTTTCTCATAGG - Intergenic
1014591187 6:123273089-123273111 TTCAGAATATTTTTTCTCTATGG - Intronic
1014994084 6:128119498-128119520 GTTTGAAAATATTTTCTCAAAGG + Intronic
1015648752 6:135428849-135428871 CTCAAAAAATGTTTGTTGAATGG - Intronic
1015770104 6:136759932-136759954 CTCACAAAGTGCATTCTCAAGGG + Intronic
1015858756 6:137653294-137653316 CTAAGAAAATGTCTTCTAAAAGG - Intergenic
1016407670 6:143747449-143747471 CTAAGAACATGTTTGCTCAGGGG - Intronic
1016760834 6:147734806-147734828 CTCAGTAAATGTTTTTTAAATGG + Intronic
1016772611 6:147869114-147869136 CTCAGAAAAATCTTTCTCAGAGG - Intergenic
1018008949 6:159650212-159650234 CTTAGGAAATGTTTTCTAGATGG + Intergenic
1018377115 6:163223466-163223488 CTCAGAAAATGTTTTCTCAATGG - Intronic
1019489047 7:1302661-1302683 CTCTAAAAACGTTTTCTAAAAGG + Intergenic
1019852015 7:3568880-3568902 GACAGAAAATATTTTCCCAAAGG + Intronic
1020541798 7:9468034-9468056 CTCACAAAGTACTTTCTCAAAGG - Intergenic
1020933154 7:14426415-14426437 ATCAGCAAATGTTTGCTGAATGG + Intronic
1021097422 7:16549029-16549051 CTCAGCAAATGTTTGCTGAGTGG + Intronic
1021473345 7:21032034-21032056 TTCAGAAAATGTTGACACAATGG - Intergenic
1021608054 7:22429183-22429205 CTCAGAAAAGAGTTTCTCCAGGG - Intronic
1021613222 7:22477437-22477459 CTCAGAATCTGTTTCCTCAGTGG - Intronic
1021664630 7:22963592-22963614 GTCAGAAAATTTTTTCTTAATGG + Intronic
1021978216 7:26029571-26029593 CTCACAAAGTATATTCTCAAGGG + Intergenic
1022122512 7:27323257-27323279 CTCAGGAACTCTTTTCTGAATGG + Intergenic
1022305729 7:29145198-29145220 CTAATAAAATGTATTCTCAATGG + Intronic
1022585661 7:31606320-31606342 CTCAATAAATGTTTGTTCAATGG + Intronic
1022902447 7:34824594-34824616 CTCCGAAGATGTTTCCCCAAAGG - Intronic
1023065011 7:36368102-36368124 CTCAAAAAATGTTTGTTGAATGG - Intronic
1023761216 7:43467100-43467122 CACAGAAAATGTTTGTTGAATGG - Intronic
1024123415 7:46267673-46267695 GTTTGAAAATGTTTTCTCACTGG - Intergenic
1024397991 7:48890730-48890752 CTAGTAAAATGTTTTCTAAATGG - Intergenic
1027175555 7:75900841-75900863 CCCAGAACATGTTTTTTCAGAGG - Intronic
1027573736 7:79905681-79905703 CTCAGATATTGGTTTCTAAATGG - Intergenic
1027575354 7:79923529-79923551 CTCATACAATGTTTTTTAAAAGG + Intergenic
1028485320 7:91350988-91351010 CTCAGAAACTCTGTTCTCAGGGG + Intergenic
1028528028 7:91807096-91807118 CTCAAAAAATGTTTGCTGAATGG - Intronic
1030450526 7:109704514-109704536 CATAGCAAATGTTTTCTAAATGG - Intergenic
1030463861 7:109875021-109875043 TTCTAAAAATTTTTTCTCAAAGG + Intergenic
1030525535 7:110649001-110649023 CTCAGTACTTTTTTTCTCAAAGG + Intergenic
1031188871 7:118520333-118520355 CTCAGAAAAGCTTTCCACAATGG + Intergenic
1031328570 7:120434070-120434092 GTCAGAAAATATTTTGTTAAGGG + Intronic
1031705765 7:124979165-124979187 CTCAGAGAATGATTTCTCTGTGG - Intergenic
1031995753 7:128229782-128229804 CTCAGAAAACCTCTTCACAAAGG - Intergenic
1032184602 7:129713569-129713591 CTCAAAAAGTGTTTACTGAAGGG - Intronic
1032259072 7:130320041-130320063 CTCAGAAAGTGATATCCCAAAGG - Intronic
1032504772 7:132426698-132426720 CCCAGAACATGCATTCTCAATGG + Intronic
1033267569 7:139899159-139899181 CTCAATAAATGCTTTCTGAAGGG + Intronic
1033596093 7:142859326-142859348 CTCAGAACTTGATTTTTCAAAGG - Intronic
1033984535 7:147207857-147207879 ATTAAAAAATGTTTTCTCAATGG + Intronic
1035094359 7:156341421-156341443 TTCAGAAATTGTTTTCTAAAAGG - Intergenic
1035516400 8:236625-236647 ATATGAAAATGTTTTTTCAAAGG + Intronic
1036049350 8:5178937-5178959 CCCAGAAACTGTTTGCTAAAGGG + Intergenic
1036207145 8:6813797-6813819 CTGTGAAAATGTCTTCTCACTGG + Intronic
1037008380 8:13809560-13809582 CTCAGGAAATCTGTTCTCAATGG + Intergenic
1037082306 8:14802479-14802501 CTCATAAAATGGTTCCTCCATGG - Intronic
1037192793 8:16147784-16147806 CTAAGGATATGTTTTGTCAAGGG + Intronic
1037454664 8:19051493-19051515 CTCAATAAATATTTTCTGAATGG + Intronic
1037861674 8:22409807-22409829 CTCAGCAAATGTTTACTGATGGG + Intronic
1038402448 8:27295123-27295145 CTCACAAAAAGTTTTTTAAAAGG + Intronic
1038459140 8:27702008-27702030 CTCAGTAAATGTTTCCTGAAAGG + Intergenic
1038608274 8:29033036-29033058 CCCACAAAATGTTTTTTTAATGG - Intronic
1039462782 8:37760209-37760231 CTCAGTAAATGTTCACTGAATGG + Intergenic
1040476217 8:47780324-47780346 TTAAGAAAATATTTTCTCATAGG - Intronic
1040680421 8:49802096-49802118 CTCACAAAGTATATTCTCAAGGG - Intergenic
1041916925 8:63147530-63147552 CTCACAAAATACATTCTCAAGGG + Intergenic
1043029007 8:75107418-75107440 CTTAGAAAATGCTTTTTTAAAGG - Intergenic
1043327063 8:79065382-79065404 GTCAGAAAATGTTTTCTTATGGG + Intergenic
1043541806 8:81271947-81271969 CTCAGAAAATCTTTTGTCAAAGG + Intergenic
1044536915 8:93367933-93367955 ATCAGGAAATGCTTTTTCAATGG + Intergenic
1045455014 8:102369296-102369318 CTCAGCAAGTGATTTCTTAAAGG + Intronic
1047214764 8:122867133-122867155 CTTAGAAATTGTTTTGTCTAGGG - Intronic
1047778184 8:128090753-128090775 CTCAGCAACTGTTGTCTCAGTGG - Intergenic
1047975364 8:130124656-130124678 CTAAGAAAATTTGTTCTGAAGGG + Intronic
1048174613 8:132140570-132140592 CTCAGAAAGTGACTTCTCCAAGG - Intronic
1048320876 8:133399481-133399503 CACAGAAAGTCTTTCCTCAAGGG + Intergenic
1048363041 8:133714683-133714705 CTCAGAACATGTTTTGTGGATGG + Intergenic
1048798676 8:138175608-138175630 CTGTGCAAATGTTTTCACAATGG - Intronic
1048833723 8:138498631-138498653 CTCAGTAAATGTTTGGTGAATGG + Intergenic
1049332500 8:142062607-142062629 CTCAGCAGCTGTTTTCACAAGGG - Intergenic
1049387453 8:142350457-142350479 GTCAGAAAATCTTTCCACAAAGG + Intronic
1050208781 9:3229574-3229596 CTCAAAATGTGTTTTCTCATTGG - Intronic
1050570418 9:6932432-6932454 TTCAACAAAAGTTTTCTCAAGGG - Intronic
1050603389 9:7274922-7274944 CTCAGGAAATGTTTTTTGAGTGG + Intergenic
1050741882 9:8829971-8829993 CCCAGTAAATATTTTCTGAAAGG - Intronic
1052286353 9:26790167-26790189 GTAAGAAAATGTTTTTTAAAAGG + Intergenic
1052488799 9:29136441-29136463 CTCAGAAATTATTTTCTCCAAGG + Intergenic
1052552699 9:29970509-29970531 CTCAGAAATTGATCTCTGAAAGG - Intergenic
1052749181 9:32471713-32471735 CTCAGGAAATATTTTCTTATTGG - Intronic
1052935523 9:34089718-34089740 ATCAGACAGTGTTTTCCCAATGG + Intronic
1053409554 9:37906688-37906710 CTCAAAAAATGCTTTCTAGAAGG + Intronic
1055140821 9:72875046-72875068 CTCAGTAAATGCTTGCTGAAGGG + Intergenic
1055502839 9:76919024-76919046 CTCAATAAATGTTTACTGAATGG + Intergenic
1056497946 9:87178558-87178580 GTCAGAAGATGATTTCTCAGAGG - Intergenic
1056784204 9:89577453-89577475 CTAAGAAACTGTTTTCCAAAAGG + Intergenic
1057013513 9:91630126-91630148 TTCAGAAACTGTTTCTTCAAAGG - Intronic
1057246610 9:93460733-93460755 CTCAGAAAATATTTGATAAATGG + Intronic
1057558368 9:96107697-96107719 CTCAGAAACTATTCTTTCAAAGG - Exonic
1057633183 9:96737440-96737462 CTCAGAAAATGATACCCCAAAGG - Intergenic
1058427546 9:104888037-104888059 CTCAGAAAATGTTTCTTGAGGGG + Intronic
1058553665 9:106142700-106142722 CCCAGAAATTGTTTTATCCATGG - Intergenic
1058593428 9:106589168-106589190 CTCAGAAAAGGTTTCCAGAAGGG - Intergenic
1058688219 9:107496849-107496871 CTTACAAAATGTTTTGTTAAGGG - Intergenic
1059643507 9:116240498-116240520 CTGAGAAAATGTTCTTTAAATGG + Intronic
1059726585 9:117014389-117014411 CTCAGAGACTGTTTTCTCCCAGG - Intronic
1060672714 9:125484304-125484326 CTGAGAAAATGTTTAAACAATGG - Intronic
1061323376 9:129846589-129846611 CTCAGAAAATATTTGCTGAATGG - Intronic
1186652892 X:11579946-11579968 CCCAGAAAATGATTTCTCTAGGG - Intronic
1186681675 X:11881567-11881589 CTCTGAAAATGTCTTATAAATGG - Intergenic
1187430324 X:19217695-19217717 CTGAGAAAATATTCTCTCAGAGG - Intergenic
1188372099 X:29381007-29381029 CTCAGAAAATGTTGTTACTAAGG - Intronic
1190634811 X:52423369-52423391 AACAGAAATTGTTTTTTCAACGG + Intergenic
1190679687 X:52814438-52814460 AACAGAAATTGTTTTCACAACGG + Intronic
1190954076 X:55174381-55174403 AACAGAAATTGTTTCCTCAACGG + Intronic
1191184514 X:57594274-57594296 CTGAGACACTGTTTTCACAAAGG - Exonic
1191212875 X:57908185-57908207 CTGAGACACTGTTTTCACAAAGG + Exonic
1192250049 X:69404630-69404652 CTCATCAAATCTCTTCTCAAAGG - Intergenic
1192619531 X:72663546-72663568 ACCAAAAAATGTTCTCTCAAAGG + Intronic
1193373493 X:80728624-80728646 CTCAGAAAATCATTTTTCCAAGG + Intronic
1193582678 X:83285189-83285211 CTCTGAAAATTTTGTCTCAGAGG + Intergenic
1193637928 X:83975901-83975923 CTGAGGAAATATTTCCTCAATGG - Intergenic
1196896405 X:120341113-120341135 CTCAGGAAATGTCCTTTCAAGGG - Intergenic
1197287479 X:124613187-124613209 ATCAGAAAATGCTTTGTAAAAGG - Intronic
1197622577 X:128767226-128767248 CTCAGTAAATGTCTGCTGAATGG + Intergenic
1198984263 X:142431397-142431419 CTCACAAAGTGCATTCTCAAGGG - Intergenic
1200824574 Y:7624777-7624799 ATTAGAAAATGCTTCCTCAAAGG - Intergenic
1200852239 Y:7895322-7895344 TTCAGAAAATGTTTGATCCAAGG - Intergenic
1201473944 Y:14361060-14361082 CTCAGAACATTTTTTTTCAAGGG - Intergenic
1202235481 Y:22706310-22706332 ATTAGAAAATGCTTCCTCAAAGG + Intergenic
1202307678 Y:23489858-23489880 ATTAGAAAATGCTTCCTCAAAGG - Intergenic
1202563123 Y:26180728-26180750 ATTAGAAAATGCTTCCTCAAAGG + Intergenic