ID: 1018377116

View in Genome Browser
Species Human (GRCh38)
Location 6:163223491-163223513
Sequence CATTGTGTGTGGAGCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018377116_1018377121 -7 Left 1018377116 6:163223491-163223513 CCCACTGAGCTCCACACACAATG 0: 1
1: 0
2: 0
3: 21
4: 203
Right 1018377121 6:163223507-163223529 CACAATGGGAAAGCAGAAGAAGG No data
1018377116_1018377122 -3 Left 1018377116 6:163223491-163223513 CCCACTGAGCTCCACACACAATG 0: 1
1: 0
2: 0
3: 21
4: 203
Right 1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018377116 Original CRISPR CATTGTGTGTGGAGCTCAGT GGG (reversed) Intronic
900978914 1:6035232-6035254 CAGTGTGTGAGGGGCTCAGCGGG + Intronic
905127254 1:35724358-35724380 CAGTGTGGCTGGAGCTCGGTGGG + Intronic
905789575 1:40783130-40783152 CAGGGTGTGTGGAACACAGTGGG - Intergenic
906656513 1:47552284-47552306 CCTTGTGGCTGGAGCACAGTGGG - Intergenic
908036793 1:60063578-60063600 CATTTTTTGTGGAGCACGGTGGG - Intronic
909570503 1:77104909-77104931 CAGTGTGTTAGCAGCTCAGTTGG + Intronic
909828905 1:80160626-80160648 AATTTTGTGAGGAGCTTAGTTGG - Intergenic
916361816 1:163978700-163978722 TCCTGTTTGTGGAGCTCAGTGGG - Intergenic
918236869 1:182589558-182589580 CATTGTGTCTGGAACACAATAGG - Intergenic
920710396 1:208289096-208289118 CTTTGGGTCTGGAACTCAGTAGG + Intergenic
1067120909 10:43471409-43471431 CTGTGTGTTTGCAGCTCAGTTGG + Intronic
1067725310 10:48766198-48766220 CTTTGTGTAAGGGGCTCAGTGGG - Intronic
1067788761 10:49272069-49272091 CATTGCATGTAGAGCTCACTGGG - Intergenic
1068015883 10:51515957-51515979 CATTGTGTTATCAGCTCAGTGGG + Intronic
1069210908 10:65759714-65759736 CATTGTGGGAGGGACTCAGTGGG - Intergenic
1070868228 10:79723485-79723507 CAATGTGTGTGGAGATCACATGG + Intergenic
1070949955 10:80423052-80423074 CATTGAATCTGTAGCTCAGTGGG + Intronic
1071635138 10:87245686-87245708 CAATGTGTGTGGAGATCACATGG + Intergenic
1071660105 10:87492306-87492328 CAATGTGTGTGGAGATCACATGG - Intergenic
1072024140 10:91437171-91437193 TAATTTGTGTGGAGATCAGTGGG + Intronic
1072302379 10:94073751-94073773 CATTCTGTGTGGGGAGCAGTAGG - Intronic
1073711440 10:106047230-106047252 AATGGTGTCTGGATCTCAGTTGG + Intergenic
1073898540 10:108191607-108191629 CATTGTGGGAGGAACCCAGTGGG + Intergenic
1074209064 10:111311701-111311723 CATGTTCTGTGGAGCTCAATTGG + Intergenic
1076256368 10:129028674-129028696 CCTTGTGTGTGGAGCTGCGTAGG - Intergenic
1076361133 10:129889579-129889601 GAATGTGTGTGGAACTCACTGGG - Intronic
1077316995 11:1923873-1923895 CATGGTGTGTGGAGTTCACTGGG + Intronic
1077802692 11:5556969-5556991 CATCGTGTCTGCAGCGCAGTGGG + Intronic
1079795069 11:24791402-24791424 CATTCTGAGTGGAGCTCTGATGG + Intronic
1080673598 11:34404153-34404175 CAATGAGTTTGGAGCTGAGTAGG - Intergenic
1081212706 11:40355613-40355635 CATTGTGTGTGGAACTTAATTGG - Intronic
1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG + Intergenic
1081585202 11:44379538-44379560 CATTGTGTGTGGACATCAGCTGG - Intergenic
1081765235 11:45605802-45605824 CAGTGTGCATGGAGCTCAGCAGG + Intergenic
1087069527 11:94063790-94063812 CATTCTGTGTGGAGCAAAGGAGG - Intronic
1088813235 11:113405406-113405428 CCTGGTGTCTGGAGCTCAGAGGG + Intergenic
1089275789 11:117335190-117335212 GACTGTGTGTGTAGCACAGTGGG + Intronic
1090293428 11:125566446-125566468 CAGTGTGTTAGTAGCTCAGTTGG + Intergenic
1090450106 11:126798571-126798593 CATTTAGCCTGGAGCTCAGTGGG + Intronic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1092525961 12:9310563-9310585 CATTCTGTGTGGCTCTAAGTGGG - Intergenic
1092541330 12:9421244-9421266 CATTCTGTGTGGCTCTAAGTGGG + Intergenic
1093991836 12:25597928-25597950 TGTTGTGGGAGGAGCTCAGTGGG + Intronic
1096531568 12:52245822-52245844 CATGGAGTGTGAAGCTCAGTGGG + Intronic
1099494936 12:83335396-83335418 CAGTGTGTTAGCAGCTCAGTTGG + Intergenic
1101472876 12:105015320-105015342 CATAGTGTGTGGTGCACAGTAGG + Intronic
1101555161 12:105802059-105802081 CATGGTGAGTGGAGCTGAGCAGG - Intergenic
1102105355 12:110316827-110316849 CATAGTGTGTGATGCTCAGAGGG + Intronic
1102250034 12:111380596-111380618 CAGGGTGTGGGAAGCTCAGTGGG - Intergenic
1102926244 12:116828601-116828623 CATTGTGTCTGGTGCATAGTAGG + Intronic
1103118059 12:118354619-118354641 CATTGTGGGAGGAACTCGGTGGG + Intronic
1104427512 12:128690205-128690227 CAGAGTGAGTGGAGTTCAGTGGG + Intronic
1110355733 13:74564831-74564853 AAATGTGTGTGGAGGTGAGTTGG - Intergenic
1111608735 13:90576288-90576310 CAGTGTGTTAGCAGCTCAGTTGG - Intergenic
1112071418 13:95855022-95855044 TATTATGTGTGGGGCTCAGATGG + Intronic
1113192282 13:107762553-107762575 CATTGTGTATGGAGGTAAGGCGG + Intronic
1117928608 14:60813025-60813047 CAGTGTGTTGGCAGCTCAGTTGG - Intronic
1118453889 14:65928283-65928305 CTTTGTATTTGGAGCTAAGTAGG - Intergenic
1119621559 14:76135684-76135706 CATTCTGTGTCCAGCTCAGAGGG - Intergenic
1119793516 14:77376116-77376138 CATCGTGTGTGGTGTTCAGGAGG + Intronic
1119874180 14:78043011-78043033 CATAGTGCCTGGAGCTCAGTAGG + Intergenic
1122033473 14:98930846-98930868 CTCTGTGTGTGGAGCTCACGGGG - Intergenic
1122136744 14:99637735-99637757 CATGGTGTCAGGAGCTCACTGGG + Intergenic
1122763827 14:104050710-104050732 CATTGTGTGCAGAGCTCCATGGG + Intronic
1123778418 15:23602784-23602806 CATGGGGTGTGGAGGTCAGTGGG - Intronic
1124096246 15:26651130-26651152 CAGTGTGTTAGCAGCTCAGTTGG - Intronic
1124244827 15:28059963-28059985 CATTGTGTGTGCTGCTCCTTGGG - Intronic
1126918568 15:53494117-53494139 CATTGTGTGTAAGGCTGAGTAGG - Intergenic
1127238037 15:57077214-57077236 CATTGAGTCTGTAGATCAGTTGG + Intronic
1127312113 15:57761568-57761590 CAAAGTGTGTGTGGCTCAGTGGG + Intronic
1127600611 15:60532862-60532884 GTTTGTGTGTGTAACTCAGTAGG - Intronic
1128272281 15:66321048-66321070 CAGAGAGTGTGGAGCTCAGTTGG - Intronic
1128289087 15:66463124-66463146 CATTGTGGGTGGGGCTCCTTCGG + Intronic
1130297341 15:82656650-82656672 CAGAGTGTCTGGATCTCAGTTGG - Intergenic
1131937423 15:97522150-97522172 GAATGTGTGGGGAGCTTAGTTGG + Intergenic
1132245820 15:100295415-100295437 CCTTGTGTTTTCAGCTCAGTAGG + Intronic
1135618424 16:23932173-23932195 GATAGTGTGTGGACCTCATTTGG + Intronic
1137365947 16:47859548-47859570 CCTTGTGGGTGGAAGTCAGTAGG - Intergenic
1137698166 16:50476676-50476698 CAGTGTGTGTGCAGCTCCATAGG - Intergenic
1137920070 16:52478266-52478288 CAGTGTTTCTGGAGCTTAGTGGG - Intronic
1138152309 16:54670062-54670084 CAGTGTGTTAGCAGCTCAGTTGG + Intergenic
1141525554 16:84608932-84608954 CATTGTTTCTGGAGCAAAGTAGG + Intronic
1143828431 17:9631595-9631617 CAGTGTGTCTGGGGCTTAGTGGG + Intronic
1144414107 17:15029969-15029991 CACTGTGTTTGTAGCTCTGTGGG - Intergenic
1146549624 17:33769171-33769193 CAGTGTGTTAGCAGCTCAGTTGG - Intronic
1149341236 17:55688210-55688232 CATTGTGGGAGGAACCCAGTGGG + Intergenic
1151885730 17:76922365-76922387 TTTTGTGTGTGGTTCTCAGTTGG + Intronic
1153092822 18:1368081-1368103 CAATGTGTTTTGATCTCAGTTGG + Intergenic
1154059046 18:11041509-11041531 CATTGTTTGTAAAGGTCAGTGGG + Intronic
1155353653 18:24930097-24930119 CATTGAGTGTGCTGCTCTGTGGG - Intergenic
1156463966 18:37337004-37337026 CATGGTGAGTGGAGCACAGCCGG - Intronic
1159221488 18:65469930-65469952 CATATTGTGTGAAGCTAAGTTGG - Intergenic
1159620187 18:70628427-70628449 CTTTGTAGGTGTAGCTCAGTGGG + Intergenic
1165617962 19:37218858-37218880 GATTGTGTGTAGTGCTCAATAGG + Intronic
925282441 2:2694292-2694314 GATGGTGTGTGGAGCTGAGAAGG + Intergenic
926753546 2:16218696-16218718 GCTTGTGTGAGGAACTCAGTGGG + Intergenic
926767255 2:16332880-16332902 CATAGTGTCTGGAGCCCTGTGGG + Intergenic
929988635 2:46764673-46764695 CATTGAGTGTGGAGAATAGTAGG + Intergenic
931925749 2:67070725-67070747 TATTGTATGTAGAGCTCAGGTGG + Intergenic
933405243 2:81849958-81849980 CGTTGTGCTTGGAGCACAGTAGG + Intergenic
933622267 2:84556421-84556443 CATTGTGTGTGGGGCCCAAGGGG - Intronic
935499555 2:103821668-103821690 CAGTGTGTCAGGAGCTGAGTGGG - Intergenic
936023242 2:109011545-109011567 CATTGTGTTGGGCGCTCAGTGGG + Intergenic
937099233 2:119255967-119255989 GATTCTGTGTGGAGAACAGTGGG - Intronic
937466169 2:122134967-122134989 CATAGTGGCTGGAGCTGAGTGGG + Intergenic
937675046 2:124580949-124580971 CATAATGTGTGGAGCACAGGGGG + Intronic
938073532 2:128320280-128320302 CATGGTGTGGGGTCCTCAGTGGG + Intergenic
938138949 2:128781163-128781185 GAGTGTGTGTGGAGATAAGTGGG + Intergenic
938986182 2:136578848-136578870 CATTGTTTGTGGAGATTGGTGGG + Intergenic
943386821 2:187211391-187211413 CATTGTGTGAGGGACACAGTGGG + Intergenic
943576843 2:189640027-189640049 TATTGTGTGAGGAACCCAGTGGG - Intergenic
946476289 2:220009659-220009681 AGATGTGAGTGGAGCTCAGTGGG + Intergenic
946907458 2:224430342-224430364 CAGTGTGTTAGCAGCTCAGTTGG - Intergenic
946942229 2:224781490-224781512 GATAGTGTCTGTAGCTCAGTGGG - Intronic
947468572 2:230378359-230378381 CATTGTGGCTGGAGCTTAGCAGG - Intronic
947525807 2:230876093-230876115 CATTGCGTGTACAGCTCAGCGGG + Intronic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
1169040691 20:2492873-2492895 CCCTGTGTGTGGAGCACAGCTGG + Intronic
1172477173 20:35247711-35247733 CATGGTGTGGGGTGGTCAGTGGG + Intronic
1174305166 20:49609841-49609863 CACTGTGTCTGGCACTCAGTAGG - Intergenic
1174405389 20:50299529-50299551 CATAGTGTGTGGCACACAGTAGG - Intergenic
1175204668 20:57302462-57302484 CATGGTGTGTGGTTCACAGTAGG - Intergenic
1175777139 20:61660569-61660591 GATTGTGTTTGCAGCTCAGGAGG + Intronic
1176290023 21:5038752-5038774 CATTGTGTCTGGGGCTGAGCAGG - Intronic
1178509686 21:33193946-33193968 CATTGTGAATGGATCACAGTGGG - Intergenic
1179132989 21:38655547-38655569 CAATGTGTGTGGAACGCACTTGG + Intronic
1179867231 21:44224887-44224909 CATTGTGTCTGGGGCTGAGCAGG + Intronic
1181482175 22:23207144-23207166 CATTGTGCTTGGACCCCAGTAGG - Intronic
1182028715 22:27140279-27140301 CCTTCTGTGTGGAGCTCTGTCGG + Intergenic
949855804 3:8459978-8460000 CATTTTCTGTGGAGCATAGTAGG + Intergenic
950214071 3:11145448-11145470 CACTGTGTGTGGGGTGCAGTAGG - Intronic
952105404 3:30064770-30064792 CATTGTGGGAGGGACTCAGTGGG - Intergenic
953004024 3:38960751-38960773 CATGTTGTGTGGGCCTCAGTGGG - Intergenic
954947078 3:54435118-54435140 CAGTGTGAGTGGGACTCAGTGGG + Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
957367624 3:79246882-79246904 CATGGTGTTTGGCACTCAGTGGG - Intronic
958625770 3:96622645-96622667 AATAGTGTGAGGAGCTCTGTTGG + Intergenic
959629518 3:108492103-108492125 CATAGTGTGTGGTGGTCAATGGG - Intronic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
962609212 3:137059274-137059296 CATTGTGTTTGACACTCAGTGGG - Intergenic
964142556 3:153420243-153420265 CAGTCTGTGTGGAGCCCAGAAGG - Intergenic
966882243 3:184357165-184357187 CATTGGGTGAGGAGCTGAGGGGG - Exonic
968711934 4:2125781-2125803 CAGTGCTTTTGGAGCTCAGTGGG + Intronic
969999191 4:11346797-11346819 CATTGTGGGTGGGTCTCAGGGGG - Intergenic
970703483 4:18771115-18771137 CAGTCTGTGTGGAGCCCAGAAGG + Intergenic
972383088 4:38537013-38537035 ACTTGGGTGTGGAGCACAGTGGG - Intergenic
975318122 4:72978637-72978659 CTTGGTGTGTGGAGCTCACCTGG - Intergenic
975659911 4:76678335-76678357 CATATTGTCTGGACCTCAGTAGG + Intronic
975968553 4:80005739-80005761 CATTGTTAATGGAACTCAGTTGG + Intronic
977986067 4:103385140-103385162 CCTTCTGTGTTGATCTCAGTGGG - Intergenic
978169149 4:105648343-105648365 CCTTGTTTCTGGAGGTCAGTGGG + Intronic
979029159 4:115618427-115618449 CAGTGTGTGTGGAGATCACATGG + Intergenic
979591973 4:122491181-122491203 CTTTTTTTGTGGAGGTCAGTGGG + Intergenic
982868056 4:160543143-160543165 CATTGTATGTGGATCGCAGCAGG + Intergenic
983087373 4:163463809-163463831 CATTGTGTGTGGTGTGAAGTTGG - Intergenic
983430845 4:167648811-167648833 CATTGTGGGAGGAACCCAGTGGG - Intergenic
986371843 5:7087962-7087984 CAGTGTGTTAGCAGCTCAGTTGG - Intergenic
987369421 5:17179705-17179727 CATTGGGTGAGAAGCTCAGCAGG - Intronic
987818706 5:22934675-22934697 AATTGTGAGTTGAGCTCATTTGG - Intergenic
987818903 5:22936335-22936357 AATTGTGAGTTGAGCTCATTTGG + Intergenic
990134715 5:52631370-52631392 CAGCTTGTGTGGAGCTCAGAGGG - Intergenic
992357834 5:76003816-76003838 CATAGGGTGTGGAGCTCAGAGGG + Intergenic
993353752 5:86881201-86881223 CATTGTGGGTGGGGCCCAGTGGG - Intergenic
995126605 5:108583116-108583138 CTTTTTGTGTGTAGCTAAGTAGG + Intergenic
995245704 5:109932855-109932877 AAATGTGTGTGGAACTCAATAGG + Intergenic
995530115 5:113084044-113084066 CATTGTCTGTGTAGCTCTGCCGG + Intronic
996250172 5:121319338-121319360 CAGTGTGTTAGCAGCTCAGTTGG - Intergenic
997076962 5:130690286-130690308 CATTGTGTTTGGCACTCAGTGGG - Intergenic
997399489 5:133591470-133591492 TATTGTGGGTGGAGGACAGTTGG - Intronic
997509906 5:134446969-134446991 CAGTGTGTATTGAGCTCAATGGG + Intergenic
997734413 5:136202913-136202935 CATTGTTTGAGGAGCTCCGATGG - Intergenic
999251655 5:150185951-150185973 CAGAGTGTGTGGAGTTCAGTGGG - Intergenic
1000478453 5:161742582-161742604 CATTATTTGTGCAGCACAGTGGG + Intergenic
1002063472 5:176640360-176640382 CAATGTGGGTAGTGCTCAGTAGG - Intronic
1003078790 6:3004443-3004465 CATTGTGGCTGAAGCTGAGTTGG - Intronic
1004351845 6:14897013-14897035 CTTTGACTGTGGAGATCAGTTGG + Intergenic
1004776079 6:18846569-18846591 CCTAGTGGGTGGAACTCAGTGGG + Intergenic
1005026464 6:21467142-21467164 CAGTGTGTTAGCAGCTCAGTTGG - Intergenic
1005175917 6:23044816-23044838 CAATGTGGATAGAGCTCAGTGGG + Intergenic
1006608149 6:35274408-35274430 GCTTGTGTGTGGAGCGCAGTAGG + Intronic
1008429504 6:51398890-51398912 AAGTGTGTGTGGACCTCAGTGGG - Intergenic
1008813681 6:55536971-55536993 CAATGTGTGTGGATCTAAATTGG - Intronic
1009406336 6:63317925-63317947 CCTTGTGTGTGGTGCTGAGCTGG - Intronic
1009537550 6:64908403-64908425 CAGTGTGTTAGCAGCTCAGTTGG + Intronic
1011659395 6:89581417-89581439 CAGTGTGTGAGGAGCCCAATGGG + Intronic
1013039307 6:106417926-106417948 CAGTGTGTTGGCAGCTCAGTCGG + Intergenic
1016206451 6:141473264-141473286 CAGTGTGTTAGCAGCTCAGTTGG + Intergenic
1016394939 6:143613836-143613858 CTTTGTGTGTGGAGGTGGGTTGG - Intronic
1017890590 6:158635456-158635478 CTTTGTGTGTGGAGTTAATTTGG + Intergenic
1018340575 6:162846989-162847011 CACAGTGTGGGGAGCACAGTGGG - Intronic
1018377116 6:163223491-163223513 CATTGTGTGTGGAGCTCAGTGGG - Intronic
1018582859 6:165322663-165322685 CATTGTGGGAGGAACCCAGTGGG + Intergenic
1018620099 6:165722242-165722264 CATTATCTGTGGAGCACAGAAGG + Intronic
1019262744 7:91314-91336 CATTTTGTGTGGAGAACAGCAGG + Intergenic
1019943919 7:4311870-4311892 CACGGTGTCTGGACCTCAGTTGG - Intergenic
1020678301 7:11205778-11205800 GGTTGTAAGTGGAGCTCAGTGGG + Intergenic
1024818747 7:53302660-53302682 CACTGTGTTTGGAGCTGAGTGGG - Intergenic
1024863940 7:53881112-53881134 CAGTGTTTATGGAGCTGAGTAGG - Intergenic
1027918330 7:84357033-84357055 TAGTGTGTGTGGTGCTCAGATGG - Intronic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1034459672 7:151191499-151191521 AAATGTGTGTGGAGCTCAGCTGG - Intronic
1035236354 7:157499954-157499976 CATGGTGTGTGGGGCTCTGATGG + Intergenic
1035812102 8:2501080-2501102 CAGTGTGTTAGCAGCTCAGTTGG - Intergenic
1036461967 8:8961319-8961341 CATTGTGGGAGGAACCCAGTGGG - Intergenic
1038325803 8:26571868-26571890 CTTTGTGTGTGTAGCTCTGAAGG - Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1042503095 8:69530932-69530954 CATTCTGTCTGGAGTACAGTAGG - Intronic
1043519163 8:81025879-81025901 CATGGTGTGTGTACCTCTGTGGG + Intronic
1045371790 8:101531692-101531714 CATTGTTTCTAGAGCTCAGTGGG + Intronic
1047450187 8:124958495-124958517 CATTGTGTCTGCCACTCAGTGGG - Intergenic
1049845212 8:144797485-144797507 AAGTGTGTGTGGAGGTGAGTGGG + Intergenic
1051996089 9:23219745-23219767 CAGTGTGTAAGCAGCTCAGTTGG + Intergenic
1053104869 9:35400801-35400823 CATAGTGTGTGGAGCTTTGCTGG + Intronic
1057372777 9:94489108-94489130 CATTTCTTCTGGAGCTCAGTGGG + Intergenic
1059221905 9:112630268-112630290 GTTTTTGTGTGGAGCTCTGTTGG + Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1186470608 X:9819262-9819284 CATTGTGAATGGATCTCAGGAGG - Intronic
1193459856 X:81777039-81777061 TGTTGTGAGAGGAGCTCAGTGGG - Intergenic
1193485420 X:82080505-82080527 GATTGTGTTAGCAGCTCAGTTGG + Intergenic
1193486055 X:82086526-82086548 CATTGTGTTAGCATCTCAGTAGG + Intergenic
1194743765 X:97606503-97606525 CATTGTGTGTGGCACACAATAGG - Intergenic
1197262526 X:124333701-124333723 CAAGGTGGGTGGATCTCAGTAGG - Intronic
1199094344 X:143722635-143722657 CCTTGTGTCTGGAGGTCAGCGGG - Intergenic
1199696041 X:150343206-150343228 CATTGTGTGGGATGTTCAGTGGG - Intergenic