ID: 1018377117

View in Genome Browser
Species Human (GRCh38)
Location 6:163223492-163223514
Sequence CCATTGTGTGTGGAGCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018377117_1018377121 -8 Left 1018377117 6:163223492-163223514 CCACTGAGCTCCACACACAATGG 0: 1
1: 0
2: 2
3: 24
4: 244
Right 1018377121 6:163223507-163223529 CACAATGGGAAAGCAGAAGAAGG No data
1018377117_1018377122 -4 Left 1018377117 6:163223492-163223514 CCACTGAGCTCCACACACAATGG 0: 1
1: 0
2: 2
3: 24
4: 244
Right 1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018377117 Original CRISPR CCATTGTGTGTGGAGCTCAG TGG (reversed) Intronic
900978913 1:6035231-6035253 CCAGTGTGTGAGGGGCTCAGCGG + Intronic
903499280 1:23792726-23792748 CCACCGTGTCTGGAGCTGAGCGG + Exonic
904168076 1:28571492-28571514 CCATTGTGGGTAGGGCCCAGTGG + Intronic
904438743 1:30516173-30516195 GCTTTGTGTGTAGAGCTGAGGGG + Intergenic
905127253 1:35724357-35724379 CCAGTGTGGCTGGAGCTCGGTGG + Intronic
905207149 1:36349493-36349515 CAGTTGTGTGTGCAGCTCTGGGG - Intronic
905640299 1:39584794-39584816 CCATCATCTGTGGAGATCAGGGG + Intergenic
906207788 1:43996327-43996349 CCCTGGTGTCTGGAGCTGAGTGG + Exonic
906656515 1:47552285-47552307 CCCTTGTGGCTGGAGCACAGTGG - Intergenic
906720320 1:47999247-47999269 CAAGTGTGTGTGTAGCTAAGAGG - Intergenic
907285732 1:53378298-53378320 CCGTGCTGTGTGCAGCTCAGGGG + Intergenic
907921598 1:58919281-58919303 CTAATGTGTCTGGAGCTTAGAGG + Intergenic
908036794 1:60063579-60063601 CCATTTTTTGTGGAGCACGGTGG - Intronic
909069376 1:70976199-70976221 GCACTGTCTGTGGAGCACAGAGG + Intronic
909102378 1:71365275-71365297 CCATTGTGTGCTGTGTTCAGAGG - Intergenic
909421307 1:75469521-75469543 CCAGTGTGTGTAGAACTTAGGGG + Intronic
911356504 1:96827465-96827487 CCATTTTGTGTGCATCCCAGAGG + Intergenic
913091167 1:115477580-115477602 CGTGTGTGTGTGGAGCTCTGTGG - Intergenic
913671165 1:121098063-121098085 CCCTTGTGAGTGAAGCTCGGCGG - Intergenic
914022933 1:143885484-143885506 CCCTTGTGGGTGAAGCTCGGCGG - Intergenic
914661420 1:149793428-149793450 CCCTTGTGGGTGAAGCTCGGCGG - Intronic
917611724 1:176695640-176695662 CCTTTGTGTGGGGAGGGCAGGGG - Intronic
918936665 1:190930048-190930070 CCATTCTGTCTGGAGAACAGTGG - Intergenic
920026554 1:203002371-203002393 CCATGGTGTGGCCAGCTCAGAGG + Intergenic
920805025 1:209224873-209224895 CCAGTGTGGTTGGAGCACAGAGG - Intergenic
922469518 1:225867232-225867254 CCTTGGTTTGTGGAGCTCTGGGG + Intronic
923073862 1:230591823-230591845 CCATGATGAGTGGAGATCAGGGG - Intergenic
1062899457 10:1131442-1131464 CCAGTGTGCCTGGAACTCAGTGG - Exonic
1064357884 10:14636170-14636192 CCATTGTGTATGGGGATGAGGGG - Intronic
1065125600 10:22570564-22570586 CCAGTGTGTGGGGACTTCAGAGG + Intronic
1065126944 10:22583345-22583367 CCATTGTGTGTGGGGTACAGGGG - Intronic
1065528355 10:26644520-26644542 CCCTTGTGTGTGAATTTCAGTGG - Intergenic
1067838624 10:49657682-49657704 CCAGTGTGTATGGAGCTGAGTGG - Intronic
1069552921 10:69376876-69376898 CCCTCGTGTGTGGGGCGCAGAGG + Intronic
1071191655 10:83108619-83108641 CCAGCATGTGTGGAGCTCGGAGG + Intergenic
1071819340 10:89264441-89264463 CCAATGAGTGTGCAGCTCAGTGG + Intronic
1072561482 10:96579976-96579998 CCACAGACTGTGGAGCTCAGGGG - Intronic
1074218935 10:111417109-111417131 CCATAGTGTTTGTAGCTCACAGG + Intergenic
1074229557 10:111520309-111520331 CCAGTGTGGGTGGAGGACAGTGG - Intergenic
1075545475 10:123351584-123351606 CCATTGTGGGAGGAGCCCAAGGG - Intergenic
1076238507 10:128884191-128884213 ACATTGTGTTGGGAGTTCAGCGG - Intergenic
1077138557 11:1013470-1013492 CCACTGCGTGTGCAGCTCTGTGG - Exonic
1077316994 11:1923872-1923894 CCATGGTGTGTGGAGTTCACTGG + Intronic
1077333921 11:1994980-1995002 ACAGGGTGTGTGGACCTCAGGGG - Intergenic
1077841719 11:5982705-5982727 CCAGTCTATGTGGAGCCCAGAGG - Intergenic
1078433482 11:11305495-11305517 CCATTGTGGGTGGAGGGGAGGGG + Intronic
1078755579 11:14205726-14205748 CTGTTGTCTGTGGAGTTCAGAGG + Intronic
1081292911 11:41348909-41348931 CCAGTCTGCGTGGAGCCCAGAGG + Intronic
1081666561 11:44920180-44920202 CCATTTTGGTTGGATCTCAGGGG - Intronic
1083657347 11:64235872-64235894 CCCTTGACTGTGGAGCTCATGGG + Exonic
1084480533 11:69417408-69417430 CCCTTTTGTCTGGGGCTCAGAGG - Intergenic
1086341728 11:85854649-85854671 CCATTGTGGAAGGAGCGCAGCGG + Intergenic
1087650476 11:100861294-100861316 CCAGTATGTTTGGAGCACAGTGG + Intronic
1088813233 11:113405405-113405427 CCCTGGTGTCTGGAGCTCAGAGG + Intergenic
1089580718 11:119480568-119480590 TAAATGAGTGTGGAGCTCAGAGG - Intergenic
1090825268 11:130380779-130380801 CCAGTGTTTGTGGGGCTCAGAGG + Intergenic
1202816904 11_KI270721v1_random:50162-50184 ACAGGGTGTGTGGACCTCAGGGG - Intergenic
1091653280 12:2325264-2325286 CCAATGTGAGAGCAGCTCAGAGG - Intronic
1091671582 12:2456011-2456033 CTACTGTGTCTGGAGGTCAGTGG - Intronic
1095648264 12:44576000-44576022 CCAATGTGCCTGGAGCACAGAGG - Intronic
1096004550 12:48158386-48158408 CCTTTGAGTCTGGAGCTCAAAGG - Intronic
1096472805 12:51889710-51889732 ACATTGTGTGTGGAGGTCCCAGG + Intronic
1096531567 12:52245821-52245843 CCATGGAGTGTGAAGCTCAGTGG + Intronic
1099220841 12:79912024-79912046 CCAGTGTGACTGGAGCACAGGGG - Intronic
1100220974 12:92504356-92504378 CCCCTGTGTATGGAGCTCAAAGG - Intergenic
1100979722 12:100154786-100154808 GCGTTCTCTGTGGAGCTCAGGGG + Intergenic
1102105354 12:110316826-110316848 GCATAGTGTGTGATGCTCAGAGG + Intronic
1102592667 12:113968856-113968878 CCAGTGTGTGTGGTGGTGAGGGG - Intergenic
1105205552 13:18220489-18220511 CCCTAATGTGTGTAGCTCAGAGG - Intergenic
1105282894 13:18979415-18979437 TCTGTGTGTCTGGAGCTCAGGGG - Intergenic
1106316710 13:28600692-28600714 CCACTGTGTTTTGAGATCAGGGG + Intergenic
1108063941 13:46558272-46558294 ACATTGTGTGTAGAATTCAGAGG + Intronic
1110242924 13:73288715-73288737 GCATGGGGTGTGGAGCTGAGTGG + Intergenic
1110481829 13:75987174-75987196 CCATTGTGTGTGCTGATCAAAGG - Intergenic
1112332443 13:98486710-98486732 CCATCGTGGGTGTAGTTCAGCGG - Intronic
1112672741 13:101659830-101659852 CCAGTGTGTTTGGACCTCTGGGG + Intronic
1113406536 13:110046071-110046093 CCTCTGTGTGTGGACTTCAGTGG - Intergenic
1113545151 13:111143006-111143028 TCACTGTGTGTGGAGCTGGGTGG + Intronic
1115483456 14:33885665-33885687 CAATTATGAATGGAGCTCAGAGG + Intergenic
1117270470 14:54138324-54138346 CCATTCAGTGTGGAGGCCAGAGG - Intergenic
1118629026 14:67686108-67686130 CCAGTGTGTCTGCAGTTCAGAGG - Intronic
1119621560 14:76135685-76135707 CCATTCTGTGTCCAGCTCAGAGG - Intergenic
1120543342 14:85778486-85778508 CCATGGTGTGGCCAGCTCAGAGG + Intergenic
1120897835 14:89550139-89550161 GCATGGTGTTTGGAGCTCATGGG - Intronic
1121017928 14:90559618-90559640 GAATTGTGTGTGTAGCACAGAGG - Intronic
1121210123 14:92202236-92202258 CCATTGTGATTGGAGCTCAGAGG + Intergenic
1121253774 14:92517163-92517185 CCATTGGGTGGGCAGCTCGGAGG + Intronic
1121290020 14:92766540-92766562 CCATCTTGTGTGGAGATCTGGGG + Intergenic
1121951834 14:98177618-98177640 CCTTGGTCTGTGGGGCTCAGGGG + Intergenic
1122033474 14:98930847-98930869 CCTCTGTGTGTGGAGCTCACGGG - Intergenic
1122136743 14:99637734-99637756 CCATGGTGTCAGGAGCTCACTGG + Intergenic
1122763826 14:104050709-104050731 CCATTGTGTGCAGAGCTCCATGG + Intronic
1123778419 15:23602785-23602807 ACATGGGGTGTGGAGGTCAGTGG - Intronic
1123893869 15:24809174-24809196 CCAGCCTGTGTGGAGCCCAGAGG + Intergenic
1124244828 15:28059964-28059986 CCATTGTGTGTGCTGCTCCTTGG - Intronic
1124269166 15:28265484-28265506 CCAGTGGGTGTGGGGCTCAGTGG - Intronic
1124724960 15:32148539-32148561 CCATTGTGTGAGGATCCTAGGGG + Intronic
1124873332 15:33565796-33565818 GCTTTTTGTGTGGAGGTCAGGGG - Intronic
1127648421 15:60982149-60982171 CCATTGTGTGTGGGGGTGGGAGG + Intronic
1129361703 15:75028583-75028605 CCTGTGTGTGTGGTGCTCTGTGG + Intronic
1131150116 15:90042438-90042460 TCAGTCTGTGTGGAGCTCAGTGG - Intronic
1132185184 15:99797513-99797535 GTGTTCTGTGTGGAGCTCAGAGG - Intergenic
1132244724 15:100285756-100285778 CCAGCCTGTGTGGAGCCCAGAGG + Intronic
1132431804 15:101767042-101767064 GTGTTCTGTGTGGAGCTCAGAGG + Intergenic
1133022421 16:2972659-2972681 CCATGCTGTGTGGAGCAAAGAGG - Exonic
1133162395 16:3920654-3920676 CCAGTGTGTGTGAAGCCCCGAGG - Intergenic
1140145224 16:72300367-72300389 CCATTGTGTGGGGAGTCCATGGG - Intergenic
1141513918 16:84530419-84530441 CCAGTGTGAGTGGCGCTGAGGGG - Intronic
1142467579 17:145053-145075 CCATTCTGTGTGGAGAAAAGAGG + Intergenic
1142868271 17:2804471-2804493 GTTTTGTGTGTGGAGCTGAGTGG + Intronic
1143828430 17:9631594-9631616 CCAGTGTGTCTGGGGCTTAGTGG + Intronic
1145102392 17:20087949-20087971 CCACTGTGTGAGGAGCTGGGGGG + Intronic
1148631872 17:49117200-49117222 CCATTGTGTGTTGACTTCAGAGG + Intergenic
1149443432 17:56694567-56694589 CTTTTGTTTGTGGAGCTCAAAGG + Intergenic
1154404066 18:14071979-14072001 CCACTGTGTTTGCAGCACAGTGG + Intronic
1156381816 18:36568491-36568513 GCAGTCTGTGTGGAGCCCAGGGG - Intronic
1158117598 18:54013500-54013522 CCATGGTGTGGCCAGCTCAGAGG - Intergenic
1158634103 18:59140731-59140753 CCTTTGTGAGAGGACCTCAGAGG + Intronic
1160258411 18:77266842-77266864 CCATTATGTGTGGAGATTATGGG + Intronic
1161422944 19:4185667-4185689 CCATAGTGGGTGGAGGTCTGGGG - Intronic
1161772022 19:6235993-6236015 CCATTGTGTGTGGTGTTCATGGG - Intronic
1162286330 19:9741758-9741780 CCATGGTGTGGCCAGCTCAGAGG - Intergenic
1164578437 19:29419459-29419481 CCATTGTCCCTGGGGCTCAGTGG + Intergenic
1167095474 19:47373031-47373053 CCAGTCTGTGGGGGGCTCAGTGG - Intronic
925274912 2:2641771-2641793 CCACTGTGGGTGGGGGTCAGAGG + Intergenic
925413718 2:3655281-3655303 CGAATGTGGGTGGAGCCCAGTGG - Intergenic
928216145 2:29362979-29363001 CCATTGTGTGTGGAAGGAAGGGG + Intronic
928947632 2:36786086-36786108 CCATTGTGGGTGGGGAGCAGCGG - Intronic
930864567 2:56109733-56109755 CCATTGTGTGCTGACTTCAGAGG - Intergenic
932311312 2:70744594-70744616 CCATTGTGGCTGAAGCTGAGTGG + Intronic
933161132 2:79026337-79026359 CCATTGTTAGTGGACCACAGTGG - Intronic
933622268 2:84556422-84556444 TCATTGTGTGTGGGGCCCAAGGG - Intronic
933701626 2:85259124-85259146 CCACTGTGTGTGGTGCTGTGGGG - Intronic
935499556 2:103821669-103821691 CCAGTGTGTCAGGAGCTGAGTGG - Intergenic
935730633 2:106062385-106062407 GCACTGGGTGGGGAGCTCAGAGG + Intergenic
936023241 2:109011544-109011566 CCATTGTGTTGGGCGCTCAGTGG + Intergenic
937675045 2:124580948-124580970 GCATAATGTGTGGAGCACAGGGG + Intronic
938073531 2:128320279-128320301 CCATGGTGTGGGGTCCTCAGTGG + Intergenic
940177513 2:150895139-150895161 CTATTGTGTGGGGTGCTCAAAGG + Intergenic
941054901 2:160776685-160776707 CCATTCAGTATGGAGCCCAGAGG + Intergenic
943501440 2:188693967-188693989 CCAGTCAGTGTGGAGCTCACAGG - Intergenic
944621718 2:201522706-201522728 CCAACCTGTGTGGAGCCCAGAGG + Intronic
946141924 2:217698706-217698728 CCATTCTGAGTGCAGCTCTGTGG - Intronic
946988432 2:225301122-225301144 CCATTCTATGTGGAGGTAAGCGG - Intergenic
947525806 2:230876092-230876114 GCATTGCGTGTACAGCTCAGCGG + Intronic
948675522 2:239594497-239594519 CCTCTGTTTGAGGAGCTCAGAGG + Intergenic
948779734 2:240311406-240311428 CCAGTGTGTGAGGAGCTGAGAGG - Intergenic
948850312 2:240702409-240702431 ACACTTTGTGTGGAGGTCAGAGG - Intergenic
948883357 2:240871311-240871333 CGGCTGTGGGTGGAGCTCAGAGG - Intronic
1172041046 20:32046157-32046179 CCATTGTGGCTGGAACACAGAGG - Intergenic
1173398810 20:42705549-42705571 CCATGGTGTGGCTAGCTCAGAGG + Intronic
1177804014 21:25856331-25856353 CCATGGTGTGGCCAGCTCAGAGG - Intergenic
1178509687 21:33193947-33193969 CCATTGTGAATGGATCACAGTGG - Intergenic
1179618699 21:42598510-42598532 CCATTGTGGGTGGTGTCCAGTGG - Intergenic
1181463008 22:23096362-23096384 ATCTTCTGTGTGGAGCTCAGCGG + Exonic
1181583210 22:23839104-23839126 CCATTGGCTGTCGGGCTCAGGGG - Intronic
1182021304 22:27083833-27083855 CCATTGTGTTTTGATCACAGTGG - Intergenic
950700720 3:14743864-14743886 CCATGCTGTGTGCAGCTTAGGGG - Intronic
952236313 3:31483938-31483960 TCATTGGGTGTGGAGCTGGGAGG - Intergenic
953004025 3:38960752-38960774 CCATGTTGTGTGGGCCTCAGTGG - Intergenic
954947077 3:54435117-54435139 CCAGTGTGAGTGGGACTCAGTGG + Intronic
957367625 3:79246883-79246905 CCATGGTGTTTGGCACTCAGTGG - Intronic
958064793 3:88529176-88529198 CCAGCCTGTGTGGAGCCCAGAGG - Intergenic
959346876 3:105206651-105206673 CCATTGTGTGTGCATATGAGAGG + Intergenic
960038751 3:113128001-113128023 CAATTGTGTGTGGATTTTAGTGG + Intergenic
961710350 3:128823602-128823624 ACATTGTGTGGGCAGCTCAGGGG - Intergenic
962914821 3:139891503-139891525 CCATTTTTTGTGGAACTCATGGG - Intergenic
965147819 3:164928550-164928572 CCAGTCTGTGTGGACCCCAGAGG - Intergenic
965442103 3:168727328-168727350 CCATTGCCTGTGGAGTTCTGAGG - Intergenic
966882244 3:184357166-184357188 TCATTGGGTGAGGAGCTGAGGGG - Exonic
969999192 4:11346798-11346820 TCATTGTGGGTGGGTCTCAGGGG - Intergenic
971329610 4:25671717-25671739 CAAATGTGAGTGGAGCTCAGTGG + Exonic
972577495 4:40365166-40365188 CTATTGGGTTTGGAGCTAAGGGG - Intergenic
973304866 4:48635074-48635096 CCAGTGTGGCTGGAGCTCAAGGG + Intronic
975617154 4:76257817-76257839 TCATTGTGGGAGGAGCTCAGTGG - Intronic
976289827 4:83406007-83406029 CCATTGTGAATGCAACTCAGAGG + Intergenic
979591972 4:122491180-122491202 CCTTTTTTTGTGGAGGTCAGTGG + Intergenic
980714082 4:136610239-136610261 CCATGGTGTGGCTAGCTCAGGGG - Intergenic
981223310 4:142262308-142262330 CCAGTGTGACTGGAGCTAAGGGG - Intronic
981466230 4:145075797-145075819 CCAGCCTGTGTGGAGCCCAGAGG + Intronic
982356801 4:154478709-154478731 CCCATGCATGTGGAGCTCAGAGG - Intronic
984051024 4:174865427-174865449 CAATTGTATGTGGAAATCAGAGG - Intronic
984856693 4:184201435-184201457 CCATGGTGTGTAGACCGCAGTGG + Intronic
985120029 4:186631128-186631150 CCATTGTGTATCCAGGTCAGGGG - Intronic
987099299 5:14578054-14578076 GCATTCTGTGTCTAGCTCAGGGG + Intergenic
989256299 5:39369283-39369305 CCATGGTGTGGGCTGCTCAGTGG - Intronic
989770490 5:45139175-45139197 CCAGTGTCTGTCTAGCTCAGTGG - Intergenic
990134716 5:52631371-52631393 CCAGCTTGTGTGGAGCTCAGAGG - Intergenic
990537170 5:56734136-56734158 CCTTTGTGCATGGAGCCCAGGGG - Intergenic
992357833 5:76003815-76003837 CCATAGGGTGTGGAGCTCAGAGG + Intergenic
992771599 5:80053918-80053940 CCTTTGTGAGTGGAGCCCATTGG - Intronic
993228835 5:85204959-85204981 CCAGCCTGTGTGGAGCCCAGAGG - Intergenic
993353753 5:86881202-86881224 ACATTGTGGGTGGGGCCCAGTGG - Intergenic
994844989 5:104977336-104977358 CCATTGTATAAGGAGCCCAGGGG - Intergenic
996792479 5:127307439-127307461 CCATTCGGTGTGCAGCTCCGTGG - Intronic
997076963 5:130690287-130690309 CCATTGTGTTTGGCACTCAGTGG - Intergenic
997156940 5:131571806-131571828 CCATGGTGTGGCCAGCTCAGAGG - Intronic
997158406 5:131581716-131581738 CCATGGTGTGCCCAGCTCAGAGG - Intronic
999019930 5:148154161-148154183 CCATTTGGTGTAGAGCCCAGAGG + Intergenic
999251656 5:150185952-150185974 GCAGAGTGTGTGGAGTTCAGTGG - Intergenic
1001358519 5:171057513-171057535 CCATTTTGTGTGGATATCATAGG + Intronic
1002032688 5:176442193-176442215 GGAGTGTGTCTGGAGCTCAGGGG - Intergenic
1003647282 6:7924129-7924151 CCTTTGTGTGTGGAGTTCTCAGG - Intronic
1004319532 6:14621640-14621662 CTACTGTGTGTGGAGCACCGTGG - Intergenic
1004970751 6:20907670-20907692 CCCGTGTGTGAGGAGCTGAGTGG + Intronic
1006327697 6:33366178-33366200 CCACCGTGTCTGGAGCTGAGCGG - Intergenic
1006407152 6:33851986-33852008 CCATTGTGTTTGGGACTCATGGG + Intergenic
1007808573 6:44470030-44470052 CCTTTGGGTGTGGGGGTCAGGGG + Intergenic
1008048484 6:46875549-46875571 CCAAGGTGGGTGGAGGTCAGGGG + Intronic
1008429505 6:51398891-51398913 AAAGTGTGTGTGGACCTCAGTGG - Intergenic
1008629591 6:53350318-53350340 TCAGTGTTTGTGGAGCTCAATGG - Intergenic
1012733137 6:102907185-102907207 TTATTGTGTGTCTAGCTCAGAGG + Intergenic
1012952384 6:105532262-105532284 CCAATTTGGCTGGAGCTCAGAGG + Intergenic
1014401896 6:121000144-121000166 CCTTTGTGTCTGGAGCTCTCAGG - Intergenic
1015022832 6:128497320-128497342 CCATTTTATGCTGAGCTCAGTGG + Intronic
1015937763 6:138420032-138420054 GCAATGTGTGTGGAACTTAGCGG + Exonic
1016577400 6:145584537-145584559 CCAGCCTGTGTGGAGCCCAGAGG - Intronic
1017098774 6:150829257-150829279 CCCTTCTGGATGGAGCTCAGTGG - Intronic
1018377117 6:163223492-163223514 CCATTGTGTGTGGAGCTCAGTGG - Intronic
1019445345 7:1068088-1068110 CGCTTCTCTGTGGAGCTCAGGGG + Intronic
1022438571 7:30413373-30413395 CCATTCTGTGTGGTGCTCCCGGG + Intergenic
1022573115 7:31472588-31472610 GCTATGTGTGTGGGGCTCAGTGG + Intergenic
1022587608 7:31629397-31629419 CCATTGTGCCTGGAGCTTCGTGG - Intronic
1022998874 7:35786977-35786999 CCACTGTGTGTGTACCTCTGTGG - Intergenic
1023809927 7:43904209-43904231 CCAGTGTGTTTGGAGCTAAGTGG - Intronic
1024003990 7:45212072-45212094 CCATTTTGTGTGGAGCTTGGAGG + Intergenic
1024818748 7:53302661-53302683 ACACTGTGTTTGGAGCTGAGTGG - Intergenic
1030247487 7:107399491-107399513 GGAGTGTGTGTGGAGCTAAGGGG - Intronic
1030871222 7:114758497-114758519 CCCTTGTGGCTGGAGCTGAGGGG - Intergenic
1032310345 7:130780398-130780420 CCAGCCTGTGTGGAGCCCAGAGG - Intergenic
1033111633 7:138583668-138583690 CCAGTGTGTGTGGAAGGCAGTGG + Intronic
1035547103 8:490463-490485 CCATGTTGTGGGGAGCTCTGTGG - Exonic
1038001297 8:23393917-23393939 CTATTCTGTGTTGAGCACAGGGG - Intronic
1039822778 8:41148312-41148334 CTAATGTGACTGGAGCTCAGGGG - Intergenic
1042511565 8:69617671-69617693 CCATTTAATGTGGAGATCAGTGG - Intronic
1042681591 8:71391828-71391850 TCCTTGTATGTAGAGCTCAGTGG + Intergenic
1044784342 8:95778663-95778685 CCATGGTGTGAGGAGGGCAGTGG - Intergenic
1045371789 8:101531691-101531713 TCATTGTTTCTAGAGCTCAGTGG + Intronic
1047002590 8:120587657-120587679 TCATTGTTTGAAGAGCTCAGAGG + Intronic
1050965429 9:11795585-11795607 CCAGTCTGTATGGAGCCCAGAGG - Intergenic
1053042746 9:34888800-34888822 CCATGGTGTGTTGGGCTCAGAGG - Intergenic
1055058652 9:72046766-72046788 GAATTGTTTGTGGAGCTCTGGGG + Intergenic
1056820119 9:89835322-89835344 CCTGTGTGTGTGGTGCCCAGGGG + Intergenic
1057372776 9:94489107-94489129 CCATTTCTTCTGGAGCTCAGTGG + Intergenic
1057497774 9:95574345-95574367 CCATTGTCTGTGGGACGCAGAGG - Intergenic
1057497940 9:95575027-95575049 CCATGGTCTGTGGGACTCAGAGG - Intergenic
1057560239 9:96122388-96122410 GCATTGTGGGAGAAGCTCAGGGG + Intergenic
1058663285 9:107284755-107284777 CTATTTTGGGTGGAGATCAGGGG + Intronic
1059745379 9:117195376-117195398 CCATTGTGTCTGGAGCATGGAGG + Intronic
1059998061 9:119933153-119933175 CCACTTTGTCTGGAGCTAAGGGG - Intergenic
1060029151 9:120199235-120199257 CCATTGTATGTGGAGCTACCTGG - Intergenic
1060463667 9:123883001-123883023 TCATTGTGGCTGGAGTTCAGTGG - Intronic
1061488338 9:130931683-130931705 CCCTTGTGTGTAATGCTCAGGGG - Intronic
1061896590 9:133651665-133651687 CAGGTGTGTGTGGAGCTGAGAGG - Exonic
1062094116 9:134694326-134694348 CCAGTGTGGGTGGAGGGCAGAGG - Intronic
1062357563 9:136171974-136171996 CCGTTGTGAGGGGTGCTCAGGGG + Intergenic
1062556579 9:137115620-137115642 CCATCCTGTGTGGGGCTGAGCGG + Intergenic
1062728706 9:138096388-138096410 CCAGTGTGTGTGAAGCTCTCAGG - Intronic
1186837002 X:13448206-13448228 CCATCCTCTGTGGATCTCAGTGG + Intergenic
1187222169 X:17338692-17338714 CAGCTGTGTGTGGAGCACAGGGG + Intergenic
1187801366 X:23067432-23067454 CCAGCCTGTGTGGAGCCCAGAGG + Intergenic
1189678242 X:43486541-43486563 CCAGCCTGTGTGGAGCCCAGAGG + Intergenic
1189891860 X:45610922-45610944 CCAGCCTGTGTGGAGCCCAGAGG - Intergenic
1190161138 X:48032247-48032269 CCACTGTGGGTGGAGCACATTGG - Intronic
1190727669 X:53200841-53200863 CAGTTGTGTGTGTAGCTGAGTGG - Intronic
1192932646 X:75824349-75824371 CCAACCTGTGTGGAGCCCAGAGG - Intergenic
1193401838 X:81054819-81054841 CCAGTCTGTGTAGAGATCAGAGG + Intergenic
1196574511 X:117302470-117302492 CCAGTCTGTGTGAAGCCCAGAGG - Intergenic
1196586868 X:117440080-117440102 CCAGCCTGTGTGGAGCCCAGAGG + Intergenic
1199094346 X:143722636-143722658 GCCTTGTGTCTGGAGGTCAGCGG - Intergenic
1201290197 Y:12415219-12415241 CCATTGTGTGGGCAGCTTATGGG - Intergenic