ID: 1018377122

View in Genome Browser
Species Human (GRCh38)
Location 6:163223511-163223533
Sequence ATGGGAAAGCAGAAGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018377116_1018377122 -3 Left 1018377116 6:163223491-163223513 CCCACTGAGCTCCACACACAATG 0: 1
1: 0
2: 0
3: 21
4: 203
Right 1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG No data
1018377114_1018377122 23 Left 1018377114 6:163223465-163223487 CCCATTGAGAAAACATTTTCTGA 0: 1
1: 1
2: 5
3: 45
4: 471
Right 1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG No data
1018377115_1018377122 22 Left 1018377115 6:163223466-163223488 CCATTGAGAAAACATTTTCTGAG 0: 1
1: 0
2: 6
3: 51
4: 523
Right 1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG No data
1018377117_1018377122 -4 Left 1018377117 6:163223492-163223514 CCACTGAGCTCCACACACAATGG 0: 1
1: 0
2: 2
3: 24
4: 244
Right 1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018377122 Original CRISPR ATGGGAAAGCAGAAGAAGGA TGG Intronic
No off target data available for this crispr