ID: 1018379974

View in Genome Browser
Species Human (GRCh38)
Location 6:163249875-163249897
Sequence CACTTCCCTTTTGAGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018379974_1018379976 -1 Left 1018379974 6:163249875-163249897 CCTTTGTTCTCAAAAGGGAAGTG 0: 1
1: 0
2: 3
3: 25
4: 197
Right 1018379976 6:163249897-163249919 GACGCCAGCTGGCCAGTCTGAGG 0: 1
1: 0
2: 4
3: 18
4: 161
1018379974_1018379979 18 Left 1018379974 6:163249875-163249897 CCTTTGTTCTCAAAAGGGAAGTG 0: 1
1: 0
2: 3
3: 25
4: 197
Right 1018379979 6:163249916-163249938 GAGGCTAAGTATTTGCACAAAGG 0: 1
1: 0
2: 1
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018379974 Original CRISPR CACTTCCCTTTTGAGAACAA AGG (reversed) Intronic
900778590 1:4602354-4602376 CACTCCCCTTCTGAAAACAAGGG + Intergenic
901933423 1:12612029-12612051 CCCTTCCCTTGGGGGAACAAAGG - Intronic
902096706 1:13951494-13951516 CAGAACCCTTTTGAGAATAAAGG - Intergenic
903032043 1:20470751-20470773 CACTTTCCTTTTGGACACAAGGG - Intergenic
904716231 1:32469700-32469722 CAATTTCCTTATCAGAACAAGGG + Intronic
904746247 1:32713019-32713041 CATTTCCCATTTGAAAACAAAGG - Intergenic
904843767 1:33392605-33392627 CATTTTCCTTTTTAGAATAATGG - Intronic
905891573 1:41521582-41521604 CACTTCCCTGTTGAGGGCCAGGG + Intronic
906636247 1:47412517-47412539 CACTGCCCTTTGGAGGCCAAAGG - Intergenic
907658839 1:56373024-56373046 TTCTTCCCATTTTAGAACAAAGG - Intergenic
907754915 1:57302013-57302035 CACCTTCCTTTTGACAAAAAGGG + Intronic
909738246 1:78994501-78994523 GACTACCCTTTTGAGGAGAATGG - Intronic
910315658 1:85880600-85880622 TACTTTTCTTTTAAGAACAAGGG - Intronic
910679007 1:89843621-89843643 CACTTCCTGTTTGAAAACACAGG - Exonic
910964050 1:92789789-92789811 CATTTCCTTTCTGTGAACAATGG - Intronic
912115629 1:106403464-106403486 GACTTCCTTTCTGAGAAAAAGGG - Intergenic
912856192 1:113170677-113170699 CACTTCCCTTTTCCCCACAATGG - Intergenic
915459630 1:156062082-156062104 GACTTCTCTCTTGAGAAGAAAGG + Intronic
917414748 1:174797327-174797349 CATTTCACATTTAAGAACAAGGG - Intronic
922351770 1:224739870-224739892 CCCCTCCCATTTGAGAAAAAGGG - Exonic
922960760 1:229643883-229643905 AACTTCCCGTTTGAAAACTAAGG - Intronic
1062982263 10:1735723-1735745 CACCTCCCTTCTGAAACCAAAGG + Intronic
1065615188 10:27513809-27513831 CACTTCACTTTTGTAAACAAGGG - Intronic
1068513334 10:57994348-57994370 CATTTCCCTTTTGACAGTAAGGG + Intergenic
1069404231 10:68081087-68081109 CCTTTCCCTTTTAAGAACACCGG + Intergenic
1069622882 10:69848740-69848762 CCCTCCCCTTATGAAAACAATGG + Intronic
1073134065 10:101209983-101210005 CACTACCCTTTGGAGACGAAGGG - Intergenic
1074097260 10:110324973-110324995 AACTTCCTCTTTGAGCACAAAGG - Intergenic
1074365237 10:112852612-112852634 CACTCACCTTTTGTGACCAATGG + Intergenic
1074953053 10:118359042-118359064 CTCTTTCCTTGTGAGAAGAAAGG + Intergenic
1075196510 10:120364230-120364252 CACATCCCTATTGCAAACAATGG + Intergenic
1077119472 11:900194-900216 CACTTCCCTCTGGAGGCCAAGGG - Intronic
1077439492 11:2561424-2561446 CGCTTCCCTCTTGAGCACATGGG + Intronic
1079058501 11:17227896-17227918 CACCTCCCTTTTTTAAACAATGG + Intronic
1079890042 11:26040928-26040950 TAATTTCCTTTTCAGAACAATGG + Intergenic
1082874631 11:57975421-57975443 CACTTCCTTTTTTAGAAAAAGGG + Intergenic
1085853069 11:80143868-80143890 CATTTCCCTTTAGATCACAAAGG + Intergenic
1086014836 11:82154847-82154869 CAAATGCCTTTTGAGAATAAAGG - Intergenic
1086056063 11:82648133-82648155 CAGTTGCCTTTTGAGAATATAGG + Intergenic
1087192449 11:95269203-95269225 CACTTCTCTTCTAAGAGCAAAGG - Intergenic
1087209651 11:95434022-95434044 CACTTCCATTTTTACAAAAAAGG + Intergenic
1087924647 11:103905258-103905280 AAGTTCCCTTTTAAGAACTAAGG - Intergenic
1088618616 11:111659482-111659504 CACTACTCTTTTAAGAAAAAAGG - Intronic
1091559059 12:1596565-1596587 CTCTTCAGATTTGAGAACAAGGG - Intronic
1092749692 12:11707234-11707256 GACTTCCCATTTGAGAAGCAGGG - Intronic
1093108271 12:15116280-15116302 GACTTCCCTTTTGAAAAGACTGG + Intronic
1094583492 12:31755927-31755949 CACTTCCGTTTTCTGACCAAGGG + Intergenic
1095298975 12:40560169-40560191 CACTTCACCTCTGTGAACAAGGG + Intronic
1095632083 12:44389397-44389419 CCCTTCACCTTTGGGAACAAAGG + Exonic
1098611314 12:72461994-72462016 CACTTCCTTATTGATAACATGGG - Intronic
1098681667 12:73363818-73363840 CACATCCCTTTTGAAAAGAAAGG + Intergenic
1099142009 12:78989701-78989723 CACTTCCCTTTTGCAAAGGATGG - Intronic
1100226189 12:92558342-92558364 CACTTCAATTTTGAGAACACTGG - Intergenic
1100870880 12:98908744-98908766 CACCTTCCTCTTGGGAACAATGG - Intronic
1101221379 12:102644671-102644693 CAGTTCCCTTTTGAAAACAAAGG + Intergenic
1101328693 12:103739861-103739883 CACTTTACTTATGAGAAAAATGG + Intronic
1106488864 13:30197807-30197829 CAATTCCCTAATGAGAACCAAGG + Intergenic
1107655471 13:42588667-42588689 CTCTTCTCTTTTTAAAACAAGGG - Intronic
1109090824 13:58042914-58042936 CACTTCCGTTTTAAGGACATGGG + Intergenic
1109904116 13:68815744-68815766 CACATACCTTTAGAGAAGAATGG - Intergenic
1110404670 13:75136524-75136546 CACTACAGTTTTTAGAACAAGGG - Intergenic
1111405273 13:87796181-87796203 CAGTTCTCTTTTGATAATAATGG - Intergenic
1113210469 13:107973441-107973463 CATATTCCTTTTGAGAACAGAGG - Intergenic
1115387561 14:32815049-32815071 CTGATCCCTTTTGAGAACAAAGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118945816 14:70386296-70386318 CACTATCCTTTTGAGAAGACAGG + Intronic
1119592198 14:75900267-75900289 CACTTTCATTTTGAGGACAAGGG - Intronic
1120160364 14:81139027-81139049 CAAATCACTTCTGAGAACAATGG - Intronic
1121728705 14:96171569-96171591 CACTTCCTGTCTGAGAAGAAAGG + Intergenic
1123466768 15:20522659-20522681 CACTGCCCTCGTGAGAACAAAGG - Intergenic
1123651345 15:22478382-22478404 CACTGCCCTCGTGAGAACAAAGG + Intergenic
1123741754 15:23287225-23287247 CACTGCCCTCGTGAGAACAAAGG + Intergenic
1123745242 15:23315333-23315355 CACTGCCCTCGTGAGAACAAAGG - Intergenic
1123761548 15:23437246-23437268 CACTGTCCTCATGAGAACAAAGG - Intergenic
1124267751 15:28252328-28252350 CACTGCCCTCGTGAGAACAAAGG + Intronic
1124277514 15:28338653-28338675 CACTGCCCTCGTGAGAACAAAGG - Intergenic
1124305186 15:28572953-28572975 CACTGCCCTCGTGAGAACAAAGG + Intergenic
1125540370 15:40466514-40466536 CACTCCCCCTTTGAGGGCAAGGG - Exonic
1126913139 15:53436169-53436191 CACCTCACTTTTGATCACAATGG + Intergenic
1132384459 15:101390280-101390302 CACTTCCCGTTTGAGTCCAACGG - Intronic
1132437887 15:101825715-101825737 CACTTCACGTTAGAGAACACAGG + Intergenic
1135331471 16:21563518-21563540 CATGTCCCTTTTAAGAATAATGG - Intergenic
1136008445 16:27346998-27347020 CAGTTCCCTTTTGAGGCCAACGG + Intronic
1137915482 16:52425230-52425252 CACTTTTCTTTTGACAACAGGGG + Intergenic
1138234447 16:55369971-55369993 CATTTCCCTTGTGTGAATAAAGG + Intergenic
1139760721 16:69182714-69182736 CACTTCCCTTCTGCTAATAAAGG + Intronic
1140605835 16:76535769-76535791 CACTTACCATTTGAGCAGAATGG - Exonic
1142421218 16:89971833-89971855 CACTTCCAATTTGAGGTCAAGGG + Exonic
1144381173 17:14700089-14700111 CACTTCCAGCTAGAGAACAAAGG + Intergenic
1144388986 17:14776275-14776297 CACTTCCCTGCTGATAACACTGG + Intergenic
1145221261 17:21091372-21091394 CACTTCCCATTTGACAGCAGAGG + Intergenic
1147897204 17:43758521-43758543 CACCACCCCTTTGAGACCAAAGG - Exonic
1148619156 17:49021727-49021749 CACCTTCCTTTTCTGAACAATGG + Intronic
1150625067 17:66836159-66836181 CCCTTCCTTTCTGGGAACAAGGG - Intronic
1151406123 17:73887570-73887592 CACTTCCCTTCTGACACCAATGG - Intergenic
1151550320 17:74819007-74819029 CATTTCTCTTTGGAGAACAGGGG - Intronic
1152500230 17:80703343-80703365 CACTTCCCCTTAGTGAACACAGG - Intronic
1155423227 18:25678437-25678459 CCCTTCACTGTTGGGAACAATGG + Intergenic
1155813518 18:30271900-30271922 CTCTTCCCTTGAGAGAGCAAAGG - Intergenic
1156639134 18:39068686-39068708 TATTTCTCTTTGGAGAACAATGG - Intergenic
1158083048 18:53616436-53616458 TACTTCCCTTATGAGAATACAGG + Intergenic
1158225084 18:55192440-55192462 CACCTCACTTTGGATAACAAGGG + Intergenic
1159975891 18:74711677-74711699 AACTTCACTTTGGATAACAATGG - Intronic
1161361927 19:3855261-3855283 CATTTGCATTTTCAGAACAAAGG + Intronic
1167403157 19:49286460-49286482 CTCCTCCCTTTTGGGAACCAGGG - Intergenic
925532601 2:4881581-4881603 CACTACCATCTTGAAAACAATGG + Intergenic
928059455 2:28096257-28096279 CAATTCACTTTTTAAAACAATGG - Intronic
928496065 2:31833138-31833160 CTCTCCCCTTTTGAGAAAAATGG - Intergenic
932141269 2:69280429-69280451 CCCTTCACTTTTCAGAAAAATGG + Intergenic
937665227 2:124479588-124479610 CAATTCCCATTTGGAAACAAAGG - Intronic
937759310 2:125581355-125581377 CATTTCACTTTTGAGAAAACTGG + Intergenic
938639485 2:133265372-133265394 CACTACCCCTTAGAGAAAAAGGG - Intronic
939020531 2:136953183-136953205 AACTTGTATTTTGAGAACAAAGG + Intronic
940654595 2:156472797-156472819 AAGTTGCCTTTTGAGACCAAAGG + Intronic
942189957 2:173459458-173459480 CATTGCCCTTTTCAAAACAAGGG + Intergenic
942571552 2:177320648-177320670 CACATGCCTGTTGAGAACCACGG + Intronic
943997198 2:194785139-194785161 CTTTTTCCTTTTGAGAATAAAGG - Intergenic
944206346 2:197162526-197162548 CAACTCCCTCTTGAGAACCAAGG + Intronic
947213690 2:227730673-227730695 CTCTTCCCTGTTGAAAGCAAGGG + Intergenic
1168912945 20:1464479-1464501 CACATCTCCTTTGAGCACAAAGG + Intronic
1171004301 20:21449121-21449143 CAATGCCCTTTTTAGAAAAATGG - Intergenic
1173467562 20:43295522-43295544 TACCTCCCTCTTGAGACCAAAGG + Intergenic
1173627311 20:44482615-44482637 AACTTCCCATTTGCCAACAATGG - Intronic
1176343838 21:5723011-5723033 CACTTGGGTTTTGAGAAAAATGG - Intergenic
1176500989 21:7601445-7601467 CACTTGGGTTTTGAGAAAAATGG + Intergenic
1176538159 21:8121080-8121102 CACTTGGGTTTTGAGAAAAATGG - Intergenic
1178328338 21:31663587-31663609 CATCTCCCTTTTGAGGACACAGG + Intronic
1178470053 21:32884568-32884590 CAGCTCCTTTTTCAGAACAAGGG - Intergenic
1182022771 22:27094954-27094976 CACATGCATTTTGAGAACACTGG + Intergenic
1182057112 22:27368056-27368078 CATTTCTCTATTGAGAAGAAGGG + Intergenic
1182393685 22:30020153-30020175 CAAGTCCCTTTTGAGACCAGAGG + Exonic
1183936333 22:41264541-41264563 CCTTTCTCTTTTGAAAACAACGG + Intronic
1203243106 22_KI270733v1_random:37436-37458 CACTTGGGTTTTGAGAAAAATGG - Intergenic
949101846 3:155188-155210 CAATTCCCATTTGGGAACAGAGG - Intergenic
949131312 3:504934-504956 CATTTCTCTTTGGAAAACAATGG + Intergenic
949361657 3:3238534-3238556 CCCCAACCTTTTGAGAACAAGGG - Intergenic
954226912 3:49188104-49188126 CACCTCCCTTTTGAGAGTGAAGG - Intronic
960323094 3:116262040-116262062 CACTTCCCTATTGAGCCTAATGG + Intronic
961832030 3:129627787-129627809 CACTTGCCTACTGAGAAAAATGG + Intergenic
962663114 3:137625453-137625475 CACCACCCTTATGAGAAGAATGG - Intergenic
964409613 3:156384149-156384171 CACTGCCCTTTTGCTAAAAATGG + Intronic
971399545 4:26263334-26263356 CACTTCCACTTAGAGAACATTGG + Intronic
971992103 4:33912146-33912168 CACTTCCCTTGGGAAAAGAAAGG - Intergenic
972106992 4:35500997-35501019 TATCTTCCTTTTGAGAACAACGG + Intergenic
973885448 4:55316318-55316340 TAACTCCCTTTTGAGAACAGAGG + Intergenic
974168349 4:58232816-58232838 AACTTGCCTTCTGAGTACAAAGG - Intergenic
975009336 4:69329553-69329575 CTCTTACCATTTGAGGACAAAGG + Intronic
975054911 4:69918179-69918201 CACTTCCCTTATTAGCACCATGG + Intergenic
975794310 4:77990144-77990166 CACTTCCCTTTAGAGCTCATTGG + Intergenic
975925978 4:79454095-79454117 CACTTCCCTTTTGCGAATGTTGG - Intergenic
976898952 4:90149387-90149409 CATTGCCCTTTGAAGAACAATGG + Intronic
980008705 4:127570634-127570656 CAATTCCCCCTTTAGAACAATGG + Intergenic
981636215 4:146883134-146883156 CACTCCCCTTTTTAGAAAATGGG + Intronic
986125316 5:4878787-4878809 CACTTCCCTTCAGAGTACAGAGG - Intergenic
987788736 5:22536160-22536182 CACTTGCTACTTGAGAACAAAGG - Intronic
988281146 5:29148731-29148753 CACTTCCACTTAGTGAACAAGGG - Intergenic
991080361 5:62592434-62592456 CACTTAGCTTTTGAGAAAACTGG + Intronic
991096351 5:62744024-62744046 CACAGCCCTTTTCAGAAAAATGG + Intergenic
993122062 5:83787438-83787460 TACTTCACATTTGAGAACACAGG - Intergenic
995953102 5:117741228-117741250 CTCTCCTCTTTTGACAACAAAGG - Intergenic
996719929 5:126619936-126619958 CATTTTCCTTATGATAACAATGG + Intronic
997357509 5:133273120-133273142 CACTTCCCTGGAGAGAACAGAGG - Intronic
999060394 5:148627898-148627920 CACTTACATTTTGAAAACAGTGG - Intronic
1000062637 5:157670768-157670790 CACTTCCCTCTTGTGTAAAATGG - Intronic
1000554907 5:162714611-162714633 CTCTTCCCTGTAGAGAACAGAGG - Intergenic
1000955902 5:167543154-167543176 CACTTCCGTTTAGAGAGCATCGG + Intronic
1005414683 6:25587123-25587145 CACAGTCATTTTGAGAACAATGG + Intronic
1006206453 6:32347646-32347668 CCCTTCCCTGATGAAAACAATGG + Intronic
1006652812 6:35565635-35565657 CACTTCCCTTAAGGGAAAAAGGG + Intergenic
1007151710 6:39699521-39699543 CACTTCCCCCTTGTAAACAAAGG - Intronic
1007648266 6:43399375-43399397 ATATTCCCTTTGGAGAACAAGGG - Intergenic
1008867908 6:56236981-56237003 CAACTCCCTATTGAAAACAATGG + Intronic
1009488648 6:64259001-64259023 CACTTGCCTTCTGAGAACAGAGG + Intronic
1009852498 6:69215539-69215561 CACTTCACTTTTGAAAGCAATGG - Intronic
1010776745 6:79895374-79895396 CACATCTCTTTTGTGAACAGTGG - Intergenic
1011155759 6:84329328-84329350 CATTTCGCTTTTAACAACAAAGG + Intergenic
1016490090 6:144590789-144590811 CAGTTCCCTTTTCAGAAGATAGG + Intronic
1018379974 6:163249875-163249897 CACTTCCCTTTTGAGAACAAAGG - Intronic
1020574259 7:9905532-9905554 TACTTCACTTTTTAGCACAAAGG + Intergenic
1022998857 7:35786840-35786862 CAGTTCCATTTTGAGGACTAGGG - Intergenic
1025105641 7:56169912-56169934 CCCTCCTCTTTTCAGAACAATGG + Intergenic
1026314728 7:69218422-69218444 CCCTCCCCTGTTCAGAACAATGG + Intergenic
1027529044 7:79307233-79307255 CACTGCTGTTTTGAGAACAATGG - Intronic
1027808743 7:82865015-82865037 CACTTTATTTATGAGAACAAAGG - Intronic
1033425244 7:141238278-141238300 CACTTCTCTATGGAGAAAAAGGG + Intronic
1036075157 8:5490589-5490611 GACTTCCCTTGTGACCACAAAGG + Intergenic
1037456424 8:19068593-19068615 CTCTTCCCTTTTGATAGCAAGGG + Intronic
1037612049 8:20484070-20484092 CTCTTCCCTTTTTAAAAGAAGGG + Intergenic
1037713035 8:21370764-21370786 AACTTCCCTTTTGAAAAAATTGG - Intergenic
1038460639 8:27713772-27713794 CAGTTCCTTTTTGTGAAGAATGG + Intergenic
1038762175 8:30394499-30394521 CACTTCCCCTCTGAGCACAAAGG - Intronic
1039798566 8:40935492-40935514 AACTCCTCTTATGAGAACAATGG - Intergenic
1040820787 8:51554502-51554524 CACTTCCCTTTTAATTATAAAGG + Intronic
1041892849 8:62890759-62890781 CACTTCCCTTTTGGGTAGACAGG - Intronic
1043394462 8:79823254-79823276 CACTTCCATTTTAAGAAATAAGG + Intergenic
1044094009 8:88039963-88039985 CACTAACCCTTTGAGAACTATGG + Exonic
1045022981 8:98060633-98060655 CATTTCTCTTTTGGGAAGAATGG + Intergenic
1045220834 8:100198592-100198614 TACCTCACTTTTGACAACAAAGG - Intronic
1045852489 8:106719212-106719234 CACTTCCCTTTTCAGTGAAAAGG - Intronic
1045990592 8:108302074-108302096 CATTTACCTTTTGAAAATAAAGG + Intronic
1046223199 8:111241717-111241739 CATTTTCCTTCTGAGAACCAAGG - Intergenic
1046837465 8:118818710-118818732 CAATACCCCTTTGAGACCAAGGG + Intergenic
1047347514 8:124042563-124042585 CACTTCCATTTTCATAAGAAAGG + Intronic
1049119463 8:140721604-140721626 CACTTCACTTTTAAAAGCAATGG - Intronic
1050056787 9:1663911-1663933 CACTTTACTTTTCATAACAAGGG + Intergenic
1051551490 9:18334791-18334813 CACTTCCATTATAAGAAAAAAGG + Intergenic
1051640899 9:19223652-19223674 CACTTCAGTTTGGACAACAAGGG + Intergenic
1051809481 9:21032699-21032721 AACTTCCCTTTTGGTAAAAATGG - Intergenic
1056867719 9:90244437-90244459 CACTACCCTTATTTGAACAATGG - Intergenic
1057168272 9:92945198-92945220 CGCTCCCCTTGTAAGAACAAGGG + Intergenic
1057527581 9:95816443-95816465 AACATGCCTTTTGAGAACACAGG + Intergenic
1203731365 Un_GL000216v2:94386-94408 CAGTTCCCTTTTCTGAACACTGG + Intergenic
1203459431 Un_GL000220v1:20518-20540 CACTTGGGTTTTGAGAAAAATGG - Intergenic
1187659933 X:21532974-21532996 GACTGCTCTTTTGAGACCAAAGG - Intronic
1189014757 X:37085746-37085768 CACTTCCCCTCTGAGCACAAAGG - Intergenic
1189063111 X:37775892-37775914 AACTTCCCTTTTGAGAACACTGG - Intronic
1189204316 X:39224825-39224847 CACTTTCCTTTTAAACACAAGGG + Intergenic
1189699940 X:43708160-43708182 CACTGCCCTTTAGAGATTAAAGG + Intronic
1190465639 X:50723041-50723063 CAGTTTCTTTTTGAGGACAATGG - Intronic
1190467783 X:50743775-50743797 CACCTGCCTTATGAGAAAAACGG - Intronic
1193368433 X:80662731-80662753 TACTTTCCTTTTAAGATCAAGGG - Intergenic
1195114423 X:101682760-101682782 CACTTCCCTTATGCAAACAGGGG + Intergenic
1195826234 X:109003943-109003965 CACTGCCCTTTTCAGAGCCAGGG - Intergenic
1196058845 X:111385859-111385881 AACTTCCCTTTGGAATACAAAGG - Intronic
1197886550 X:131223988-131224010 CTCTTCCCTTTTGAGACCAAGGG - Intergenic
1200767440 Y:7092271-7092293 CACATCCTTTGTGAGAGCAATGG - Intergenic