ID: 1018380657

View in Genome Browser
Species Human (GRCh38)
Location 6:163255380-163255402
Sequence GCTGCCCGTCAGTCACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018380657_1018380660 2 Left 1018380657 6:163255380-163255402 CCAGGAGGTGACTGACGGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1018380660 6:163255405-163255427 CCACTCAGGTGTTTGCATAGAGG No data
1018380657_1018380662 24 Left 1018380657 6:163255380-163255402 CCAGGAGGTGACTGACGGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1018380662 6:163255427-163255449 GCAACTGGACACCATCCTGCAGG No data
1018380657_1018380661 9 Left 1018380657 6:163255380-163255402 CCAGGAGGTGACTGACGGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1018380661 6:163255412-163255434 GGTGTTTGCATAGAGGCAACTGG 0: 1
1: 0
2: 1
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018380657 Original CRISPR GCTGCCCGTCAGTCACCTCC TGG (reversed) Intronic
900402874 1:2479750-2479772 GCCGCCCCTCACTCACCTCCTGG - Exonic
901038574 1:6350659-6350681 GCTGCCTGTCACTCGTCTCCAGG - Intronic
901536548 1:9886146-9886168 GCTGCCCGTCAGTCCCCAGCTGG + Intronic
902605705 1:17568114-17568136 GCTCCCCGTCACTGCCCTCCAGG - Intronic
903182387 1:21611547-21611569 TCTGCCCGTGGGTCACGTCCAGG + Exonic
904047187 1:27615827-27615849 ACAGCCCGTCATTCACCTCTAGG + Exonic
907823290 1:57991430-57991452 CCTGCCCCTGAGTCACCTCCTGG + Intronic
908755007 1:67461420-67461442 GCTGCGAGTCAGTCTCCTCTTGG + Intergenic
909170712 1:72290594-72290616 GCAGCCTTTCAGTCACCTCTAGG + Intergenic
913579668 1:120213646-120213668 GCTACCCGCCAGGCACCTGCAGG - Intergenic
913628506 1:120684742-120684764 GCTACCCGCCAGGCACCTGCAGG + Intergenic
914561602 1:148825073-148825095 GCTACCCGCCAGGCACCTGCAGG - Intronic
914611230 1:149305135-149305157 GCTACCCGCCAGGCACCTGCAGG + Intergenic
919929280 1:202210617-202210639 GCTGCCAGCCAGTCAGCTCGTGG + Intronic
920725748 1:208433353-208433375 GCTCCACATCAGTCACCTCCTGG + Intergenic
920970359 1:210738134-210738156 GCTTCCCCTCAGACACCTCAGGG + Intronic
923706472 1:236348417-236348439 GCAGCCCGGCAGGCACCTCAGGG - Intronic
924118474 1:240771609-240771631 GCTTCCCGTCAGCCTCCTCCAGG - Intergenic
1062803271 10:395772-395794 CCTGCCTGTCCCTCACCTCCAGG - Intronic
1063362658 10:5470351-5470373 GCTGCTGCTCTGTCACCTCCAGG - Intergenic
1065778282 10:29142881-29142903 TCTGCCAGTCAATGACCTCCCGG - Intergenic
1069698405 10:70404540-70404562 GCTGGCCGGCGCTCACCTCCCGG - Exonic
1070102096 10:73398165-73398187 GCAACCCGTAACTCACCTCCGGG + Exonic
1076203184 10:128573930-128573952 GAGGCCCCTCTGTCACCTCCAGG + Intergenic
1076447435 10:130526308-130526330 GCTTCCTCTCCGTCACCTCCTGG + Intergenic
1076470368 10:130714272-130714294 GCTCCCCGTCATTCCACTCCTGG + Intergenic
1079309250 11:19349843-19349865 GCAGACACTCAGTCACCTCCCGG - Intergenic
1082106561 11:48227825-48227847 GCTGCCTGTCTGTCACCTTCTGG + Intergenic
1083253479 11:61482706-61482728 GCTTGCCGTCAGGCACCTCCAGG - Exonic
1083675542 11:64322921-64322943 GCTGCCTCTCAGCCACCTACAGG + Intergenic
1083681094 11:64352219-64352241 GCTGCCCGCGGGTCTCCTCCTGG - Exonic
1084679158 11:70655952-70655974 GCTGGGCGTCAGTCACCTGAGGG - Intronic
1091888008 12:4031005-4031027 GACGCCCGGCAGTCATCTCCTGG - Intergenic
1092128173 12:6089858-6089880 GCTGCCCTTCAGTGTTCTCCAGG - Intronic
1097221743 12:57455189-57455211 GCTGCCCATCAGGCCCCTGCAGG - Intronic
1104768311 12:131344996-131345018 GCTGCTGGTCACTCAGCTCCTGG + Intergenic
1104811737 12:131623593-131623615 GCTGCTGGTCAGTCAGCTCCTGG - Intergenic
1104963337 12:132498363-132498385 CCTGCCTGTCAGACACCTTCTGG + Intronic
1107300192 13:38958056-38958078 GCAGCCCAGCAGTCACATCCTGG + Intergenic
1107963596 13:45579800-45579822 GATGCCCCTCAGTCCCCTCTGGG + Intronic
1109064654 13:57671872-57671894 GCCGGCCGTCAGTCCCTTCCCGG + Intronic
1109110944 13:58318506-58318528 GCTGCCCGCCAGTCCCTTGCTGG + Intergenic
1112692682 13:101915830-101915852 GCAGCCCTTCAGTCAAATCCTGG - Intronic
1113759178 13:112835653-112835675 GCTGCCCCTCAGCCTCCTCAGGG - Intronic
1119427617 14:74546068-74546090 GCTTCCCTTCAGTCACATTCTGG - Intronic
1119732255 14:76958356-76958378 GCTGCCAGTCAGGCACTCCCTGG + Intergenic
1121377889 14:93430765-93430787 GCTTCCTGTCCGTCCCCTCCTGG - Intronic
1122038323 14:98964421-98964443 CCTCCCCTTCAGTCTCCTCCAGG + Intergenic
1122938379 14:104970310-104970332 CCTGCCCGTCTGTCAGCTGCAGG + Intronic
1123695050 15:22873104-22873126 GCTGCCCGGCATTCTCTTCCTGG - Intronic
1124387786 15:29224764-29224786 GCTGCCTGCCAGTCCCCTGCTGG + Intronic
1129210635 15:74065955-74065977 GCTGCCCCGCAGGCTCCTCCAGG - Intergenic
1129727835 15:77910588-77910610 GCTGCCCCGCAGGCTCCTCCAGG - Intergenic
1129840042 15:78738272-78738294 GCTGCCCCGCAGGCTCCTCCAGG + Intergenic
1131189346 15:90301344-90301366 GCTGCCCCTCAGGCTCCTTCCGG + Intronic
1132223610 15:100123847-100123869 GCTGCCCATCAGCCACCACGAGG + Intronic
1132760738 16:1507447-1507469 GCTGCCTGTCAGCCACCTCGAGG - Intronic
1133060331 16:3170736-3170758 GCTCACCGCCAGCCACCTCCTGG - Intergenic
1137572762 16:49577650-49577672 GCAGGCCTTAAGTCACCTCCTGG - Intronic
1137718421 16:50612940-50612962 GCGACCCTGCAGTCACCTCCTGG - Intronic
1141648270 16:85378819-85378841 GCTGCTCTGCAGTCTCCTCCCGG + Intergenic
1141897672 16:86968975-86968997 TCTGCCCGTCAGTCACCAGACGG - Intergenic
1143579424 17:7817037-7817059 TCTGCCCCTCAGTGAGCTCCTGG + Intronic
1143965110 17:10751437-10751459 GCTGCCAGTCCCTCCCCTCCAGG - Intergenic
1144045651 17:11452424-11452446 GCTGACCTTGAGTCACCTGCTGG - Intronic
1147555525 17:41476633-41476655 GCTGCCCAACAGTCACCCCCTGG + Intergenic
1147754620 17:42760572-42760594 CCTTCCCTTCAGACACCTCCTGG - Intronic
1151431480 17:74066463-74066485 GCTGCCCCTCTGTCCCCACCTGG + Intergenic
1151939882 17:77285890-77285912 CCTTCCCGTAAGTCAGCTCCCGG - Intronic
1152175101 17:78782145-78782167 GCTGTCCCCCAGTCCCCTCCGGG - Intronic
1160242046 18:77131808-77131830 TCTTCCCGGCAGTCCCCTCCTGG - Intronic
1160681234 19:412494-412516 GCTGCCCCACAGTGGCCTCCAGG + Intergenic
1163347154 19:16750349-16750371 GCTGCCCGTGTGTCTGCTCCAGG - Exonic
1166268734 19:41700791-41700813 CCTGACCATCAGTCACCCCCAGG - Intronic
926093648 2:10066286-10066308 GCACCCCGTGTGTCACCTCCAGG + Intronic
926093664 2:10066341-10066363 GCACCCCGTGTGTCACCTCCAGG + Intronic
932438856 2:71719136-71719158 GCTGCTCCTCAGCCAGCTCCTGG + Intergenic
934725721 2:96617136-96617158 CCTGCCCACCACTCACCTCCCGG + Intronic
934954603 2:98607256-98607278 GCTGCCGTTCAGCCAGCTCCTGG - Intronic
936163775 2:110103308-110103330 CCTGTCCCTCAGTCACCACCTGG - Intronic
936412785 2:112275468-112275490 AGTGCCCGTCAATCACCTGCAGG - Intergenic
944104546 2:196065595-196065617 CCTGCTCTTCAGTCTCCTCCTGG - Intronic
946137257 2:217657436-217657458 GCTGCTCTCCAGTCACCTCCCGG - Intronic
1168928670 20:1603882-1603904 GCTGCCCGTCATGCTCCACCTGG + Intronic
1168969708 20:1922551-1922573 GCTGCCCGTCATGCTCCACCTGG - Exonic
1168997835 20:2146023-2146045 GCTGCCCACCTGTCACCTACAGG - Exonic
1169796657 20:9469868-9469890 GCTGCCCATCATCCACCTCAAGG + Intronic
1174311817 20:49662043-49662065 CCTGCCCTTCAGCCACCTCTTGG + Intronic
1174317453 20:49713739-49713761 GCTCCCCGTCCGCCGCCTCCTGG + Exonic
1180840293 22:18955947-18955969 GCTGGCCGTGTGTCCCCTCCAGG + Intergenic
1180965247 22:19784763-19784785 GCTGCCCCTCTGACAGCTCCTGG + Exonic
1181004750 22:20007717-20007739 CCTGCCCTTCTGCCACCTCCTGG + Intronic
1181558301 22:23684747-23684769 GCTGCCCGCCAGTCCTGTCCAGG + Intergenic
1185291732 22:50030823-50030845 GCTGCCCGTCTGCAACCTCAAGG - Exonic
950043974 3:9938071-9938093 GCTGCCCCGCAGGCACCTTCGGG + Exonic
954197983 3:49007618-49007640 GCTGCCCGTCCTTCTCCTCAGGG - Intronic
954329446 3:49881729-49881751 GCTACCCATCTGTCACCTCTGGG - Intergenic
966582527 3:181584359-181584381 GCTGCCAGTCAGTGCCCTGCAGG + Intergenic
968566849 4:1317576-1317598 GCTGCTCGCCACTCCCCTCCTGG - Intronic
970234421 4:13944383-13944405 TCTGCCAGTCAGTGACCTGCCGG - Intergenic
985717166 5:1469186-1469208 GCTGCCCTACAGTGACCACCTGG - Intronic
986451729 5:7871800-7871822 GCTGACTGGCAGTCTCCTCCAGG - Intronic
993070390 5:83154805-83154827 GGTGCCTTTCAGTCACCTACAGG + Intronic
994177457 5:96726992-96727014 GCTGCCCATCAGCCACATTCTGG + Intronic
1002758594 6:184246-184268 GCTGCTCTACAGTCTCCTCCAGG - Intergenic
1006953785 6:37848361-37848383 GCTGCCTGACAGGCACCTACAGG - Intronic
1013709642 6:112881300-112881322 GCCGCCTGTCAGTCACACCCTGG - Intergenic
1015865690 6:137724218-137724240 GCTCCCCCACATTCACCTCCAGG - Intergenic
1017927481 6:158922754-158922776 GTTGCCCGTGAGCCAGCTCCGGG + Intergenic
1018170297 6:161139029-161139051 GCTGCCCATCCGTCCCCGCCAGG + Intronic
1018380657 6:163255380-163255402 GCTGCCCGTCAGTCACCTCCTGG - Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019638707 7:2090800-2090822 GCTGCCCACCAGGCCCCTCCAGG + Intronic
1023121760 7:36916339-36916361 GCAGCCTTTCAGTCACCTGCTGG + Intronic
1024085409 7:45888412-45888434 GCTGCCAATCATTAACCTCCTGG + Exonic
1024714552 7:52061147-52061169 GCTGCCTCTCAGTCATCTCTTGG - Intergenic
1027213250 7:76166915-76166937 TCTGCCCGACAGTGCCCTCCGGG - Intergenic
1035886805 8:3299996-3300018 CCTCCCCGTGTGTCACCTCCAGG - Intronic
1038268233 8:26052202-26052224 GCCTCCAGTCAGCCACCTCCTGG - Intergenic
1038882395 8:31628769-31628791 GCTGGCCATCAGTGACCTCTGGG - Intergenic
1039135052 8:34312611-34312633 ACTGGCCTTCAGTCATCTCCTGG - Intergenic
1047904926 8:129462793-129462815 TCTGGCAGTCAGGCACCTCCTGG - Intergenic
1049719332 8:144108375-144108397 GCAGCCCGGCTGCCACCTCCAGG - Exonic
1050182445 9:2935091-2935113 GCTGCCGGACAGGCAGCTCCAGG - Intergenic
1051427703 9:16950420-16950442 GCTGCCCTCCAGGAACCTCCAGG - Intergenic
1053504215 9:38627414-38627436 GCTGCCCTTTACTCTCCTCCAGG + Intergenic
1057152160 9:92806202-92806224 GCTGCCCATTACTCTCCTCCAGG - Intergenic
1060067761 9:120518501-120518523 GCTGCAAGTCACTCAGCTCCTGG + Exonic
1061007483 9:127936391-127936413 GCTGCCAGTCAGTAACCTCTGGG - Intronic
1062634409 9:137482684-137482706 GCAGCCCGTCCGTGCCCTCCTGG - Intronic