ID: 1018381388

View in Genome Browser
Species Human (GRCh38)
Location 6:163261125-163261147
Sequence CCGGGAAGACAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 960
Summary {0: 1, 1: 0, 2: 8, 3: 83, 4: 868}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018381388_1018381396 -1 Left 1018381388 6:163261125-163261147 CCCTCCTCCCTCTGTCTTCCCGG 0: 1
1: 0
2: 8
3: 83
4: 868
Right 1018381396 6:163261147-163261169 GCTCCCCATGTTCCTGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018381388 Original CRISPR CCGGGAAGACAGAGGGAGGA GGG (reversed) Intronic
900094616 1:935192-935214 CCGGGGGGACAGCGGGAGGTTGG + Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900218679 1:1495674-1495696 CCGGCAAGGCAGGGGTAGGAGGG - Exonic
900293917 1:1939229-1939251 GGGGGGAGAGAGAGGGAGGATGG + Intronic
900325085 1:2104670-2104692 CTGGGAGGAGAGAGGGAGGCTGG + Intronic
900334107 1:2152819-2152841 CCGGCCAGGCAGAGAGAGGAAGG - Intronic
900658277 1:3770834-3770856 GAGGGAAGACAGAGGATGGAGGG + Intronic
900701238 1:4049781-4049803 AGGGGGAGAAAGAGGGAGGAAGG + Intergenic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
901175909 1:7298900-7298922 AAGGGAAGAGAGAGGAAGGAAGG - Intronic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
902816864 1:18921376-18921398 TCGTGAAGACAGAGGTGGGAGGG + Intronic
902841473 1:19076870-19076892 CCAGTAACACAGAGGGAGGCTGG - Exonic
903122822 1:21227389-21227411 CCCTGAAGCCAGAGGGAGGCTGG + Intronic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
903384068 1:22915418-22915440 TCTGGAAGCCTGAGGGAGGAAGG - Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904861014 1:33537610-33537632 CTGGGAAGACGAAGGGAGAAAGG + Intronic
904998572 1:34650509-34650531 CCGGGAAGATGAGGGGAGGAAGG - Intergenic
905222254 1:36456232-36456254 TCGGTAATACAGAGGGGGGAAGG + Exonic
905733529 1:40311799-40311821 CCGGGAAGACAGGGTGGAGAGGG - Intronic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
906098865 1:43243194-43243216 GGGGGAAGAGAGAGGGAGGGTGG - Intronic
906892926 1:49738119-49738141 CCGGGAAGAGAAAGGGATTAGGG + Intronic
907105493 1:51878766-51878788 CCGGGAGGGCGGAGGGACGAGGG - Exonic
908013716 1:59810119-59810141 GAGGGAAGAAAGAGGGAGAAAGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
909469299 1:76008822-76008844 GTGGGAAGAGAGAGGGAGGAAGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
911725890 1:101240238-101240260 GCTGCAAGCCAGAGGGAGGAAGG + Exonic
911992127 1:104712153-104712175 AGGGGAAGACAGAGGAAGAAGGG - Intergenic
912091350 1:106080711-106080733 CCAGGAAGGGAGAAGGAGGACGG + Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912680066 1:111723390-111723412 TTGGGAAGAGAAAGGGAGGAGGG + Exonic
913275706 1:117136154-117136176 CTGGGAAGACAGAGAGAAAATGG - Intergenic
913550690 1:119914711-119914733 CCGGGAAGACAGGAGGGGAAAGG + Exonic
914196449 1:145450459-145450481 ACGGGAAGGCAGACGGAGGCAGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914830509 1:151167423-151167445 CGGGAAAGCCAGAGGTAGGAAGG + Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915737416 1:158093854-158093876 CAGGGAAGACCGACTGAGGAAGG - Intronic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
915976668 1:160395496-160395518 CCAGGCAGAAAGAAGGAGGAAGG + Intergenic
916215606 1:162390533-162390555 CCGGGAAGCCACCTGGAGGAAGG - Intergenic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917306076 1:173626936-173626958 AAGGAAAGAAAGAGGGAGGAGGG + Intronic
917459636 1:175218923-175218945 TCTGGAAGAGGGAGGGAGGAAGG + Intergenic
917574322 1:176304951-176304973 AGGGGAAGAAAGAGGAAGGAAGG - Intergenic
918290150 1:183099587-183099609 GGGGGCAGCCAGAGGGAGGAAGG - Intronic
918440243 1:184559550-184559572 AGGGGAAGAAAGAGAGAGGAAGG - Intronic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
919755281 1:201062521-201062543 CCAGGAAGAGGGAGGGAGGGAGG + Intronic
919775892 1:201193852-201193874 CTGGGAAGAAAGAGTGAGAAAGG - Intronic
919981837 1:202646740-202646762 TGGGGAAGACAGAGGGCTGAAGG + Intronic
920116364 1:203624502-203624524 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
920532837 1:206716894-206716916 CCAGGCAGACAGTGGTAGGAAGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921095840 1:211886737-211886759 TTAGGAAGACAGAGGCAGGAGGG - Intergenic
921485264 1:215708066-215708088 CCCAGAAGACAGTGGGAAGAAGG + Intronic
921598744 1:217084155-217084177 CAGGAAAGAAAGAGGAAGGAAGG + Intronic
921840561 1:219823666-219823688 CCCAGAAGAGAGAGGGAGGTGGG - Intronic
921957612 1:221000477-221000499 AGGGGAAGGAAGAGGGAGGAAGG - Intergenic
922321047 1:224487385-224487407 ACAGAAAGACAGAAGGAGGAAGG - Intronic
922538446 1:226400984-226401006 GCAGCAAGAGAGAGGGAGGAAGG - Intronic
922539390 1:226407730-226407752 CCGGGAAGGCTGGGGGAGGGCGG - Intronic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
923669286 1:236026172-236026194 GCAGGGAGACAGAGGGAAGATGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923879516 1:238088053-238088075 CTGGCAAGAGAGAGGGAGAAGGG - Intergenic
1063143603 10:3276572-3276594 CCGGGAGGGCAGTTGGAGGAGGG - Intergenic
1063545016 10:6972442-6972464 CCGGGAAGAGAATGGGAGGCTGG - Intergenic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1064267680 10:13838191-13838213 CTGGGAAGCCTGAGGCAGGATGG - Intronic
1064325802 10:14350117-14350139 CCGGGGAGAAAGACGGAGGCTGG + Intronic
1064346863 10:14540527-14540549 GGGGGAGGACAGAGGGAGGGTGG - Intronic
1064347026 10:14541539-14541561 CCGGGAAGACTCGGGGAGGCAGG - Intronic
1064392974 10:14957486-14957508 CCGGGGCTACAGAGGAAGGAGGG + Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065726149 10:28669394-28669416 CAGCGAAGAGAGTGGGAGGAGGG - Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066068336 10:31778705-31778727 CTGGGAGGAAACAGGGAGGATGG - Intergenic
1067054063 10:43041098-43041120 GGGAGAAGACAGAGAGAGGAGGG + Intergenic
1067227307 10:44384580-44384602 GCGGGAAGGCAGTGGGTGGAGGG + Intronic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1067682833 10:48451144-48451166 CCGGGAAGAGAGGCGGAGAAGGG + Intronic
1068830720 10:61491584-61491606 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069360308 10:67633862-67633884 CCTGAAAGAGACAGGGAGGATGG + Intronic
1069960796 10:72077925-72077947 TGTGGAAGACAGTGGGAGGAGGG - Intronic
1070162519 10:73874584-73874606 CCGGGGAGAGCGAGGGAGGGAGG + Exonic
1070314101 10:75294699-75294721 CGGGGAAGGAAGAGAGAGGAGGG + Intergenic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1070991045 10:80732499-80732521 ACGGGAAGACAGTGGGGAGAGGG - Intergenic
1071268965 10:83989755-83989777 GAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072205977 10:93205578-93205600 CCTGGAAGAGATAGGGATGAGGG + Intergenic
1073319022 10:102602763-102602785 CCGGGAAGGCAGTGGGAGGAGGG - Intronic
1074021806 10:109592336-109592358 CCAGAAAGAAAAAGGGAGGAGGG + Intergenic
1074287884 10:112115597-112115619 CTGGGAAGAGAGGGAGAGGAAGG + Intergenic
1074500324 10:114017867-114017889 TCGGGAAGGCAGAGGTGGGAAGG - Intergenic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075261502 10:120967272-120967294 CTTGGAAGACAGAGACAGGAGGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075341405 10:121649329-121649351 CCGGGAGGACGGAAGCAGGATGG + Intergenic
1075344213 10:121670414-121670436 GAGGGAGGACAGTGGGAGGATGG + Intergenic
1075546188 10:123356621-123356643 CCGGTGACAGAGAGGGAGGATGG + Intergenic
1075960857 10:126566862-126566884 TCGGGAAGACAGGTGGGGGAGGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076106247 10:127825945-127825967 CCGAGAAGAGCCAGGGAGGAAGG + Intergenic
1076106559 10:127827956-127827978 CCAGGAATCCAGAGGGAGTAGGG + Intergenic
1076125996 10:127974381-127974403 CCGGGAAGCCAGAGAGTGTATGG - Intronic
1076309249 10:129492393-129492415 GCGGAAAGACAGAGAGAGAAGGG - Intronic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076563510 10:131382531-131382553 CCGGCAGGTCAGAGGGAGGGAGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076830535 10:132992224-132992246 CCTCGAGGACAGAGGGTGGACGG + Intergenic
1076943168 10:133623356-133623378 AGGGAAAGACAGAGGGAGAAAGG - Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077163264 11:1123143-1123165 AAGGAAAGACGGAGGGAGGAAGG - Intergenic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078195595 11:9134349-9134371 GGGAGAGGACAGAGGGAGGAAGG - Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080050224 11:27851919-27851941 GAGGGAAGAAAGAGGGAGGGAGG - Intergenic
1080132356 11:28811793-28811815 GCGGGAAGTGAGAGGCAGGAAGG + Intergenic
1080514357 11:33006413-33006435 CCTGGGAGACCGAGGTAGGAGGG - Intergenic
1080615629 11:33942524-33942546 CTTGGAAGACTGAGGCAGGAAGG + Intergenic
1080765149 11:35289164-35289186 CAGGGAGGACAGAGGGAGTGGGG - Intronic
1081472931 11:43393608-43393630 CCCGAAGGACAGGGGGAGGATGG + Intronic
1081574413 11:44310260-44310282 AGGGGAAGAGAGAGAGAGGAGGG - Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1082008373 11:47433883-47433905 AGAGGAAGACAGAGGGAGGGAGG + Intergenic
1082071559 11:47943728-47943750 GGGGGAAGACAGAGAGAGGGAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1083410450 11:62488905-62488927 CCAGGAAGACAGGGGGCAGAGGG + Intronic
1083426747 11:62591996-62592018 GCGGGAGGACAGGGGGCGGAGGG - Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083758480 11:64803433-64803455 GCCAGAAGACAGAGGGAAGAGGG + Intergenic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084345356 11:68543606-68543628 CAGGGAAGACTGGGGCAGGAGGG - Intronic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1084948742 11:72653148-72653170 CCAGCAAGAGAGAGGGAGGGTGG + Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1085806692 11:79643157-79643179 TAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1087095591 11:94314459-94314481 CCGGGTAGAAAGAGGATGGAAGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087792719 11:102423812-102423834 TTGGGAAGACAAAGGGAGGGAGG + Intronic
1088182905 11:107132285-107132307 CAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088786700 11:113188788-113188810 CCAGGGAGACAGGGTGAGGAAGG + Intronic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1089014707 11:115156574-115156596 AGGGGAAGACAGAAGGAGGGAGG - Intergenic
1089282631 11:117385115-117385137 CAGGGAAGAAAGAGAGCGGAGGG - Intronic
1089350753 11:117820373-117820395 CTGAGAAGACAAAGGCAGGATGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089848417 11:121476815-121476837 CCTGGGTGACAGAGCGAGGAAGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090465230 11:126927672-126927694 GGTGGAAGACAGAGGGAGGAGGG - Intronic
1091238493 11:134037140-134037162 CCGGGAGGGGAGCGGGAGGAGGG + Intergenic
1091383807 12:79144-79166 CCGAGAACACAGAGGGAGCTGGG + Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1091916587 12:4274705-4274727 CCGGGGAGGTGGAGGGAGGAGGG + Intronic
1091971047 12:4787498-4787520 TGGGGATGGCAGAGGGAGGAGGG - Intronic
1092035967 12:5334754-5334776 TTGAGAAGACAGAGGGAGGGGGG + Intergenic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1092268895 12:7006292-7006314 CCTGGAAGACAGAGGTTGCAGGG - Intronic
1092334243 12:7614867-7614889 CCTGGGTGACAGAGTGAGGAAGG + Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092566605 12:9672670-9672692 CCTGAAAGAGACAGGGAGGATGG - Intronic
1092692684 12:11131186-11131208 CATGGAAGAGAGAGAGAGGAGGG - Intronic
1093439387 12:19176208-19176230 GGAGGAAGACAGAGGGAGGGAGG - Intronic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094209582 12:27874917-27874939 TCGGGAAGACAGATGTAGAATGG - Intergenic
1094615134 12:32029577-32029599 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1095977599 12:47950264-47950286 CCAAGAGGACAGAGGGAGCAAGG + Intergenic
1096155875 12:49341378-49341400 CCGTGATGGCAGAGGCAGGAGGG - Intergenic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096489424 12:52005820-52005842 TTGGGAAGACTGGGGGAGGAGGG + Intergenic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1098442391 12:70532635-70532657 ACGGAAAGAGGGAGGGAGGAAGG - Intronic
1098599430 12:72312849-72312871 GCAGTAAGAAAGAGGGAGGAAGG - Intronic
1098833397 12:75391000-75391022 CCGGAAGGAGAAAGGGAGGAGGG - Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1100563130 12:95769074-95769096 CAGGGAAGAAAGAGAGCGGAAGG + Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1100780681 12:98022972-98022994 CCTGGAAGACACAGGAAGGAGGG - Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101177877 12:102174967-102174989 GAGGGAAGAGACAGGGAGGAAGG - Intronic
1101517506 12:105450572-105450594 CCTGGGAGACTGAGGCAGGAGGG - Intergenic
1101824905 12:108212551-108212573 AGCGGAAGAGAGAGGGAGGAAGG - Intronic
1102219203 12:111182981-111183003 CCGGGCAGATTGAAGGAGGAAGG - Intronic
1102556063 12:113727343-113727365 GGGAGAAGAGAGAGGGAGGAAGG - Intergenic
1102744937 12:115242269-115242291 CTGGGAAGTCAGAGAGAGGGTGG + Intergenic
1102854074 12:116277862-116277884 CCGGGAAGAGGGAGGGAGGGAGG + Intergenic
1102889836 12:116549965-116549987 CCGGGAAGACAGAGTGCAGGTGG - Intergenic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103597788 12:122034784-122034806 CCGGGAGAAAGGAGGGAGGATGG - Intronic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1103741868 12:123096566-123096588 GAAGGAAGAAAGAGGGAGGAAGG + Intronic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1104051223 12:125195139-125195161 CGGAGAAGACAAAGGCAGGAAGG - Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104111211 12:125706419-125706441 GGGGGAAGAGAGAGAGAGGAGGG + Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104814476 12:131637830-131637852 TGGGGCAGTCAGAGGGAGGAGGG + Intergenic
1104870253 12:131990005-131990027 CCGTGAAGAAAGGGGGAAGAAGG + Exonic
1105733671 13:23245896-23245918 CCAGGAAGACACAGTGAGAATGG - Intronic
1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG + Intergenic
1106382560 13:29254328-29254350 ACAGGAAGACAGAGGCAGAATGG + Intronic
1106442063 13:29784226-29784248 CGGGAAAGAAAGAGGGAGGATGG + Intronic
1106602485 13:31199944-31199966 CGGCGGAGACGGAGGGAGGAGGG + Exonic
1106916392 13:34520059-34520081 CCCTGGAGACAGAGGGATGAAGG + Intergenic
1106953245 13:34907715-34907737 AGGGGAATACAGAGGGAAGAAGG - Intergenic
1107246637 13:38304789-38304811 CCTTGAAGACAGAGGTTGGATGG - Intergenic
1107628781 13:42320493-42320515 GGGGGAAGAGAGTGGGAGGAGGG - Exonic
1108074118 13:46661103-46661125 CCAGGAAAACAGTGGAAGGAGGG - Intronic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1108503404 13:51087898-51087920 CCAGGAAGGCAGTGGGAAGATGG - Intergenic
1108847700 13:54696508-54696530 TCTGGAAGTCAAAGGGAGGAAGG - Intergenic
1108882667 13:55140142-55140164 CCTGGGAGACAGAGTGAGAAAGG + Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109974231 13:69809781-69809803 TCTGGAAGACAGTGGAAGGATGG - Intronic
1111305802 13:86410899-86410921 CCTGAAAGAGAGAGGGAGAATGG + Intergenic
1111394437 13:87646739-87646761 CAGGGAAGACAGTGGGTGAAGGG + Intergenic
1111446196 13:88348129-88348151 GAGGGAAGAAGGAGGGAGGAAGG + Intergenic
1111549220 13:89784719-89784741 CCGTGAAGCCAGAGGGAGCCAGG - Intergenic
1111880771 13:93954388-93954410 CCTGGAAGACAGAGGTTGCATGG - Intronic
1112446763 13:99471581-99471603 GAGGGAAGGAAGAGGGAGGAAGG + Intergenic
1113005834 13:105700818-105700840 ACGGAAAGAGAGAGGCAGGAAGG - Intergenic
1113885255 13:113655416-113655438 TCAGGAAGAGAAAGGGAGGAAGG + Intronic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114547452 14:23513158-23513180 TCGGGGAGAGAGAGGGAGGGAGG + Intergenic
1115629376 14:35228449-35228471 GCGGGGAGATGGAGGGAGGAAGG - Intronic
1115765924 14:36623977-36623999 CCATGAAGAGAGAGGCAGGAGGG - Intergenic
1116271598 14:42776629-42776651 CCAGGAAGGAAGAAGGAGGATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118471919 14:66082239-66082261 GCAGGAAGACAGAGGGCGGGTGG - Intergenic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1120677908 14:87443410-87443432 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1120715539 14:87837246-87837268 GGAGGAAGACAGAGAGAGGAAGG + Intergenic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121406974 14:93725096-93725118 CCTGGAAGGCAGGGTGAGGAGGG + Intronic
1121467654 14:94126393-94126415 CCGAGAAGCCAGCGAGAGGAAGG - Intergenic
1121602995 14:95219952-95219974 GTGGGAAGACAGGGGGATGAGGG - Intronic
1121649960 14:95550607-95550629 GCGGGCAGACAGAGGAAGGTGGG - Intergenic
1121711186 14:96039925-96039947 TCGGGAAAACAGAGTGGGGAAGG - Intronic
1121991871 14:98565826-98565848 CATGGAAGACAGTGGAAGGAAGG - Intergenic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1122372097 14:101234483-101234505 TTTGTAAGACAGAGGGAGGATGG + Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1124012793 15:25852206-25852228 GAGGGAGGATAGAGGGAGGATGG - Intronic
1124408186 15:29410585-29410607 TCAGGAAGGCAGAGGGAGGCAGG - Intronic
1124887504 15:33700963-33700985 ACGGGGAGGCTGAGGGAGGAGGG - Exonic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125502505 15:40248338-40248360 CCTGGAGGAGAGGGGGAGGAAGG + Intronic
1125796110 15:42405078-42405100 TCTGGAAGACACAGGGAGCAGGG + Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1126694815 15:51317000-51317022 GTGGCAAGACAGAGGGAGCATGG + Intronic
1126771165 15:52057431-52057453 CCCAGAAGACAGAGGCAGGTTGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1128328555 15:66741075-66741097 GCCGGAAGGCAGAGGGATGAGGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128768475 15:70265303-70265325 CCAGGAAGACAGAGGCAGGCAGG - Intergenic
1129118240 15:73378341-73378363 GCGGGAAGACAGCGAGAGGGAGG + Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130029374 15:80297777-80297799 GAGGGAAGACAGAGAGAGGGAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132205588 15:99984118-99984140 CCGCGAATTCAGAGGAAGGAGGG - Intronic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1132326745 15:100976936-100976958 CCGGGAAGATGGAGGGAATATGG + Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132826129 16:1906563-1906585 CCGGGAGCACAGACGGAGGAGGG + Intergenic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1133534454 16:6687714-6687736 CGGGGAGGACAGAGGATGGAAGG + Intronic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133814087 16:9183206-9183228 CCAGGAAGCCAGAGGGAGTCGGG + Intergenic
1135186057 16:20316902-20316924 AAGGGAAGAGAGAGGGAGAAAGG - Intronic
1135975982 16:27109294-27109316 AGGGAAAGAGAGAGGGAGGAAGG + Intergenic
1136031194 16:27504301-27504323 AGGGGATGGCAGAGGGAGGAAGG + Intronic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137463268 16:48685432-48685454 GCTGGATGAAAGAGGGAGGATGG - Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138580949 16:57940103-57940125 CCCGCAGGACAGAGGGAGCAGGG - Intronic
1138653127 16:58473139-58473161 AAGGGAAGAGAAAGGGAGGAAGG - Intronic
1139283810 16:65792794-65792816 CAGGGAAGACAGAGCAAGCAAGG + Intergenic
1139670102 16:68486960-68486982 CCTGGCTGACAAAGGGAGGAGGG - Intergenic
1140219978 16:73036633-73036655 CCGGCAGGAGAGAGGGAGGAGGG + Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141128806 16:81420482-81420504 ACGTGAAGACAGAGGGTGAAGGG - Intergenic
1141677192 16:85524077-85524099 CCCGGAAGTCAGAGGGATGAGGG - Intergenic
1141678708 16:85531454-85531476 CGGGTAGGAGAGAGGGAGGAAGG + Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141798113 16:86288021-86288043 CGGGGATGACAGAGCCAGGAGGG + Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142251370 16:88993562-88993584 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1142251404 16:88993652-88993674 GAGGGAAGAGGGAGGGAGGAGGG - Intergenic
1142395477 16:89828988-89829010 CCGGGGAGGGAGAGGAAGGAGGG - Intronic
1142399756 16:89852633-89852655 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399781 16:89852713-89852735 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399796 16:89852753-89852775 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399811 16:89852793-89852815 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399841 16:89852873-89852895 CCGGGGGGTGAGAGGGAGGACGG - Intronic
1142399870 16:89852953-89852975 CCGGGGGGTGAGAGGGAGGATGG - Intronic
1142693576 17:1621250-1621272 CCGGGGAGACAAAGGGAGGGGGG + Intronic
1142884355 17:2903618-2903640 CCAGGAAGAAAGAAAGAGGAAGG + Intronic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143419665 17:6778936-6778958 CCTGGGGGACAGAGGAAGGATGG - Intronic
1143714251 17:8755786-8755808 CCGGGAAGTCGGAGGGAGGGAGG + Intronic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143989176 17:10942188-10942210 GGGGGAAGAGAGAGGGAGGTGGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144738189 17:17566543-17566565 TCAGGAAGGCACAGGGAGGAGGG + Intronic
1144764088 17:17723632-17723654 TCGGGAAGGGAGCGGGAGGAGGG - Intronic
1145218988 17:21073179-21073201 CCAGGAAGAGAGAAGGGGGAAGG + Intergenic
1145764114 17:27446208-27446230 GCGGGGAGAGAGAGGGAGGGAGG + Intergenic
1145866715 17:28246553-28246575 CCAGGGAGACAGTGGGAGGAGGG + Intergenic
1146033963 17:29390394-29390416 TCGGGGAGAGAGAGGGAGGGTGG + Intergenic
1146810329 17:35898156-35898178 CCTGGAGGACAGCGGTAGGAGGG + Intergenic
1147175850 17:38655763-38655785 CCTGGAGGTCAGAGGGAGAAGGG - Intergenic
1147266201 17:39236512-39236534 CCAGGAAGACGGGGAGAGGAGGG - Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147453850 17:40522348-40522370 GCAGCAAGACTGAGGGAGGAGGG + Intergenic
1147477787 17:40729844-40729866 CCTGGGAGACAGAGGCAGGGGGG + Intergenic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147919065 17:43905558-43905580 CCAGGAAGGCAAAGGGAAGAAGG - Intronic
1148236443 17:45972245-45972267 CCCTGAAGAAAGAGAGAGGAGGG - Intronic
1148467559 17:47874005-47874027 GAGGGAAGAAGGAGGGAGGAAGG - Intergenic
1148617709 17:49013514-49013536 CCGGGAAGCCAGGGAGAGGCTGG - Intronic
1148671246 17:49411947-49411969 TGGGGAAGACAGAGAGAAGAGGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149207664 17:54267206-54267228 CCCCAAAGACAGAGGGAGGCGGG + Intergenic
1149361368 17:55899062-55899084 GGGGGAAGAGAGAGAGAGGAAGG - Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149628196 17:58095419-58095441 GCTGGAAGACAGAGGTGGGAGGG - Exonic
1150129302 17:62658378-62658400 CTAGGATGTCAGAGGGAGGAGGG + Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150612988 17:66748818-66748840 CCGGAGAGAGAGAGGGAGGGCGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150783442 17:68142843-68142865 AGGGAAAGAAAGAGGGAGGAAGG - Intergenic
1151161690 17:72171265-72171287 CCTGGCAGTCAAAGGGAGGAGGG - Intergenic
1151180113 17:72321140-72321162 GGAGGAAGACAGAGCGAGGAGGG + Intergenic
1151345893 17:73500904-73500926 GGAGGAGGACAGAGGGAGGATGG - Intronic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1151930515 17:77229012-77229034 CCGGTCACACAGAGGTAGGAAGG - Intergenic
1152033900 17:77859943-77859965 CCAACAAGACAGAAGGAGGAAGG - Intergenic
1152045872 17:77935379-77935401 CCAGGAAGACTGAGGGATTATGG - Intergenic
1152112968 17:78367319-78367341 CCGGCAAGGGGGAGGGAGGAAGG - Intergenic
1152149223 17:78588711-78588733 CCCAGTAGACAGAGGGAGGTGGG - Intergenic
1152196768 17:78923251-78923273 CCAGGATGGCAGAGGGTGGAGGG - Intronic
1152372085 17:79894993-79895015 GAAGGAAGAAAGAGGGAGGAAGG - Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152653375 17:81507285-81507307 CCTGGATGACAGAGCCAGGATGG + Intergenic
1152811827 17:82386042-82386064 AGGGGAAGACGGAGGGAGGATGG - Intergenic
1152811851 17:82386113-82386135 CGGGGAAGGCGGAGGCAGGATGG - Intergenic
1152811912 17:82386322-82386344 AGGGGAAGGCGGAGGGAGGACGG - Intergenic
1152811966 17:82386513-82386535 AGGGGAAGGCGGAGGGAGGATGG - Intergenic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1152926234 17:83089034-83089056 CCAGGAAGAGGGAGGGAGAAAGG + Intronic
1153498090 18:5720948-5720970 CTAGGAAGACTGAGGCAGGAGGG - Intergenic
1153515051 18:5895030-5895052 CCAGGGAGACCGAGGGAGGTCGG + Exonic
1153917726 18:9760636-9760658 CCCGACAGACAGAGGGAGAAGGG - Intronic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1156341581 18:36214509-36214531 CAGGGAAGAGACAGGGAGGGTGG - Intronic
1156468300 18:37361898-37361920 CCGGGAAGAGAAAGGCAGGAGGG + Intronic
1156472597 18:37387198-37387220 CCGGGAAAAGGCAGGGAGGAAGG - Intronic
1156497937 18:37538113-37538135 CCGGGAGGCCAGAGGGATGGCGG + Intronic
1156704154 18:39859600-39859622 CTGGGATGACAGGGTGAGGAAGG + Intergenic
1156908683 18:42385064-42385086 GAGGGAAGAAAGAGGAAGGAAGG - Intergenic
1157386642 18:47263681-47263703 CCAGGAAGCCAGGGGAAGGACGG + Intergenic
1157575037 18:48738055-48738077 TGGGGAAGACAGAGGGAGTGGGG - Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158201411 18:54945897-54945919 CTTGGAAGCCAGAGAGAGGATGG + Intronic
1160001476 18:75028330-75028352 ACGTGAAGACACAGGGAAGACGG - Intronic
1160071887 18:75636193-75636215 CTGGGATGACAGAGGTGGGAAGG + Intergenic
1160318339 18:77868296-77868318 CCTTGAAGACAGAGTGAGAATGG + Intergenic
1160560737 18:79754354-79754376 CCAGGATGCCAGTGGGAGGACGG - Exonic
1160981225 19:1817487-1817509 CCAAGAAGACACAGGGAGGACGG + Intronic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161010377 19:1956973-1956995 CCTGGAAGAGAGAAGGAGGGAGG + Intronic
1161203569 19:3029000-3029022 GCCCGAAGAAAGAGGGAGGAGGG + Exonic
1161256101 19:3310677-3310699 AGGGGAAGAGAGAGGGAGGGAGG - Intergenic
1161322294 19:3646893-3646915 ACAGGAGGACAGAGGGAGGAAGG + Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161495542 19:4584118-4584140 CCTGGAGGACAGTGGCAGGATGG + Intergenic
1161642325 19:5432071-5432093 CAGGGAAGAAAGGGGTAGGATGG + Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1161927640 19:7313034-7313056 CCGGGAACAGGGAGGAAGGAAGG - Intergenic
1162087459 19:8257214-8257236 CCTGGAAGACAGAGGGGGCAGGG - Intronic
1162087468 19:8257246-8257268 CCAGGAAGACAGAGGGGGTGGGG - Intronic
1162088211 19:8261259-8261281 CCAGGAAGACACAGGGAGCAGGG - Intronic
1162357663 19:10196132-10196154 CCGGGGTGACAGAGTGAGGCAGG - Intronic
1162439220 19:10682434-10682456 CCGGGAAGCCATCTGGAGGAGGG - Intronic
1163092917 19:15033688-15033710 CCTGCAGCACAGAGGGAGGAGGG - Intergenic
1163143975 19:15368602-15368624 TGGGGAGGACAGAGGGAGCAGGG - Intronic
1163152510 19:15423582-15423604 CCAGGAAGACAGGAGGAGGTGGG - Intronic
1163521360 19:17793945-17793967 TCGGGAAGAAACAGGGATGAAGG + Intergenic
1163600911 19:18248436-18248458 CGGGGAGGGCAGAGGAAGGAGGG + Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163755738 19:19105343-19105365 CCCAGAAAACATAGGGAGGAAGG + Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164667592 19:30051762-30051784 CCTGGAAGACAGAGGCAAGGGGG + Intergenic
1164936819 19:32221155-32221177 GCTGGAAGACAGAGAGAGGCCGG - Intergenic
1165393344 19:35550643-35550665 CCTGGGAGAGAGAGGGAGAAAGG + Exonic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165824220 19:38696472-38696494 CCGGGTAGGGAGAGGAAGGATGG + Intronic
1165940023 19:39410281-39410303 GAGGGAAGTGAGAGGGAGGAGGG - Intergenic
1166293631 19:41878532-41878554 CCGGGAAGGCTGCGGGAGGAGGG + Intronic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1166421978 19:42643660-42643682 CCCGGAAGACAGAGGTTGTAGGG + Intronic
1166685365 19:44793358-44793380 TGGGGAAGACAGACAGAGGAAGG - Intronic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1166985718 19:46659276-46659298 CCGGGAGGACAGAGGGCTGAGGG + Intronic
1166988594 19:46677458-46677480 TCAGGAAGACAGATGGAGTATGG - Intronic
1167161890 19:47773320-47773342 TGGGGAAGACTGAGGAAGGAGGG + Intergenic
1167404266 19:49293953-49293975 ACCAGAAGACAGACGGAGGAAGG + Exonic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167688530 19:50971053-50971075 CTGGGAAGACTGAGGCGGGAGGG - Intergenic
1167698778 19:51030221-51030243 GCAGGGAGAGAGAGGGAGGAAGG - Intronic
1168250381 19:55138109-55138131 CCTGTAGGACTGAGGGAGGAGGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168452481 19:56477263-56477285 CCGGGAAGACCGAGGTAAGGGGG - Exonic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
924989071 2:295666-295688 CATGGAAGAAAGAGGGAAGAAGG + Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925439183 2:3869042-3869064 CCTGGAGGACAGAGGCAGGTGGG - Intergenic
925612977 2:5718682-5718704 CCTGAAGGACACAGGGAGGATGG - Intergenic
925613634 2:5724721-5724743 CCGGTAAGTCAGAGGAGGGATGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926398640 2:12471805-12471827 CCTGGAAGACAGAGGTTGCAAGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926759335 2:16263542-16263564 GGGGGAAGAAAAAGGGAGGAGGG - Intergenic
926939478 2:18119621-18119643 CGTGCAGGACAGAGGGAGGAAGG - Intronic
927042130 2:19240368-19240390 GCAGGCAGTCAGAGGGAGGAGGG - Intergenic
927091139 2:19713590-19713612 CCAGGAAGAAAGAGGAGGGAGGG + Intergenic
927780950 2:25939017-25939039 CCTGGGTGACAGAGTGAGGAAGG - Intronic
928098812 2:28422980-28423002 CCAGGAAGACAGAGGGGACAAGG + Intergenic
928294283 2:30069433-30069455 TCGGAATGACTGAGGGAGGATGG - Intergenic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928407639 2:31026837-31026859 CTGGGAAGACTGAGGAAGAAAGG - Intronic
928679132 2:33680872-33680894 CCAGGAAGGCAGTGGGAGGCAGG + Intergenic
929336664 2:40756438-40756460 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
929507539 2:42540017-42540039 CCAGCCAGAGAGAGGGAGGAAGG - Intronic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
929617777 2:43325624-43325646 GGAGGAAGACAGAGGGAGAAAGG + Intronic
929825977 2:45310071-45310093 CTGAGAAGACTCAGGGAGGATGG - Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930700422 2:54455108-54455130 GCGGGCATTCAGAGGGAGGAGGG - Intergenic
931866773 2:66421343-66421365 CCAAGAAGACAGAAGTAGGATGG + Intergenic
932296942 2:70632663-70632685 CCAGGAAAAGAGAGGGAGAAAGG - Intronic
932419266 2:71592071-71592093 CCGGGAAGGGAGAGGAAGCAAGG - Intronic
932591069 2:73068079-73068101 ACGGGCAGAAAGAGGGTGGAGGG - Intronic
933230926 2:79806472-79806494 CTGGGAAGAAAGGGAGAGGAAGG + Intronic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
933996946 2:87677093-87677115 CCTGGGAGACAGTGGGAGGTGGG + Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934765040 2:96875931-96875953 ACAGGGAGACAGAGGAAGGAGGG + Exonic
935280320 2:101511735-101511757 TGGGGACTACAGAGGGAGGAGGG + Intergenic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936296904 2:111273817-111273839 CCTGGGAGACAGTGGGAGGTGGG - Intergenic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936462263 2:112722336-112722358 GGGGGAGGACAGAGGGAGGGAGG + Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
937098966 2:119254122-119254144 CCAGGAAGACAGAGGGCTCAGGG + Intronic
937574993 2:123409317-123409339 CCTGGGAGACTGAGAGAGGATGG + Intergenic
937883827 2:126886832-126886854 TCGGGAAGAGAGAAGGAAGAGGG - Intergenic
938131042 2:128715734-128715756 TGGGGAAGACAGGGAGAGGAAGG + Intergenic
938181606 2:129189747-129189769 CAGGGAAGACTGTGGCAGGAAGG + Intergenic
938248919 2:129798809-129798831 CAGGGAGGACACAGGGAGTAAGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938762752 2:134440373-134440395 CCATGAAGACACAGGGAGAATGG - Intronic
938779825 2:134575091-134575113 ATGGGAGGCCAGAGGGAGGAAGG + Intronic
938797620 2:134731531-134731553 TCAGGAAGACAAAGGGAAGAAGG - Intergenic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
939219167 2:139280216-139280238 CTGTGAAGACAGGGAGAGGATGG + Intergenic
939696328 2:145329254-145329276 CCTGGAGGACAGAGGGATGGAGG + Intergenic
939950589 2:148468238-148468260 TCAGGAAGGGAGAGGGAGGATGG - Intronic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940421160 2:153479942-153479964 GCTGAAAGAAAGAGGGAGGAAGG - Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941395830 2:164971622-164971644 CTGGGAAGAAAGAGGAAGAAAGG - Intergenic
942013655 2:171789607-171789629 CCGAAAAGACAAAGGAAGGAAGG + Intronic
942037866 2:172028363-172028385 CCAGGAGGCCAGAGGGAGGTGGG + Intronic
942250997 2:174047776-174047798 CCAGGAAGTAAGAGAGAGGAGGG + Intergenic
942868176 2:180700179-180700201 CCAGGAAGCCAGAGGGAGCCAGG - Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
945225785 2:207530174-207530196 CCGGGGGGACGGAGGGGGGACGG + Intronic
945238352 2:207653583-207653605 AGGGGAGGAGAGAGGGAGGATGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946021683 2:216644449-216644471 CCAGGAAGTCAAAGGGAAGAGGG + Intronic
946193886 2:218022014-218022036 CCGGGAGGGCAGAGGGTGAAGGG + Intergenic
946971627 2:225099290-225099312 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947083396 2:226423680-226423702 CCTGCAAGACAGAGTGGGGAGGG + Intergenic
947107428 2:226681965-226681987 CCGGCAGGACAGAGAGTGGATGG + Intergenic
947521282 2:230848006-230848028 CCGGGAAGGAAGGCGGAGGAGGG + Intergenic
947636066 2:231681250-231681272 CCGGGAAGGCAGAGGGGAGCGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947820913 2:233068873-233068895 CCTGGAAGCCAGCAGGAGGAAGG + Intronic
948421491 2:237863170-237863192 CCAGGAAGACAGTGGGAGCTGGG + Intronic
948612049 2:239176183-239176205 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612078 2:239176267-239176289 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612086 2:239176286-239176308 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948723324 2:239917155-239917177 CCAGGAAGCCAGAGTGAGGTGGG + Intronic
948755198 2:240155380-240155402 CCAAAAAGTCAGAGGGAGGAGGG - Intergenic
948826954 2:240577496-240577518 CTGGGAAGCCAGGGGCAGGAGGG + Intronic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
1168749332 20:271060-271082 AGGGAAAGAAAGAGGGAGGAAGG + Exonic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1169736339 20:8841566-8841588 ACGGAAAGACAGAGGTAGGAAGG - Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1170939837 20:20839678-20839700 CCAGGAAGACAGGGGGAGATGGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171370872 20:24661321-24661343 GAGGGAAGAGAGGGGGAGGAAGG + Intronic
1171985615 20:31658906-31658928 CAAGGAAGAGAGAGGAAGGAAGG - Intergenic
1172061592 20:32190347-32190369 GCGGGAGGACAGTGGGAGGAAGG + Intergenic
1172080780 20:32338969-32338991 CCTGGGTGACAGAGGAAGGAAGG + Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172185699 20:33029800-33029822 CCAGGCAGAAAGAGGGAGGAAGG + Intergenic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1172840722 20:37901630-37901652 GCGCTAAGACAGAGGGAAGACGG + Intergenic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG + Intergenic
1173638568 20:44582591-44582613 CGGGGAAGAGACAGAGAGGAGGG + Exonic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1173998234 20:47356307-47356329 AGGGGAAGAGAGAGGGAAGAGGG + Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175059670 20:56230508-56230530 CAGGGAAGAAAGAGGGAGAGAGG + Intergenic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175902599 20:62366026-62366048 CCGGGAAGGCAGAGGTACCAGGG + Intronic
1175921420 20:62452096-62452118 GCGGGGAGAGAGAGGGAGAAGGG + Intergenic
1176004221 20:62850934-62850956 ACGTGAAGACAGTGGGAGCAGGG - Intronic
1176099902 20:63360212-63360234 CCAGGCAGGAAGAGGGAGGAAGG + Intronic
1176121148 20:63455115-63455137 GCGGGAAGACGATGGGAGGATGG + Intronic
1176165004 20:63668151-63668173 CCGGGCACACACTGGGAGGAGGG - Intronic
1178553959 21:33569727-33569749 ACTGGAAGCCTGAGGGAGGATGG + Intronic
1179030028 21:37712471-37712493 GAGGGAAGAGAAAGGGAGGAGGG - Intronic
1179030043 21:37712516-37712538 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030089 21:37712656-37712678 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030102 21:37712701-37712723 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179189581 21:39112009-39112031 CCGGGAAGGCAGATGGGGTAGGG + Intergenic
1179799809 21:43806047-43806069 GCGGGGAGACAGAGGGGCGATGG - Intergenic
1180107845 21:45631556-45631578 GCTGGAAGACACAGGGAGGGTGG + Intergenic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1180631474 22:17233094-17233116 GCGCTGAGACAGAGGGAGGAAGG + Intergenic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181022319 22:20109950-20109972 TCGGGAAGACACAAGGTGGAGGG - Intronic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1181921091 22:26320994-26321016 CCTGAAAGACAGAGAGAAGATGG + Intronic
1182083206 22:27543604-27543626 CAGGGAAGAAAGAGGAAGGGAGG - Intergenic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182897925 22:33873989-33874011 AGGGGAAGAGAGACGGAGGAGGG - Intronic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183443680 22:37838605-37838627 CCACCAAGACAGAGGGAGGAAGG + Intronic
1183560733 22:38570444-38570466 CTGGGATGACGGAGGGAGGGAGG + Intergenic
1183738804 22:39658847-39658869 AGAGGAAGACAGAGGGAGAAGGG - Intronic
1184106736 22:42371745-42371767 CCAGGCAGGAAGAGGGAGGAGGG - Intergenic
1184351708 22:43948567-43948589 TAGGGAAGACAGAGAGAGGTTGG - Intronic
1184420318 22:44378377-44378399 AGGGGAAGATAGAGGAAGGAGGG - Intergenic
1184563418 22:45276612-45276634 CAGGTAAGACACAGGGAGTAGGG - Intergenic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185190443 22:49433040-49433062 CCGGGCAGGGAGAGGGCGGATGG - Intronic
1185209694 22:49563741-49563763 CAAGGAAGAGAGGGGGAGGAGGG + Intronic
1185371974 22:50465129-50465151 CCTGGATGACAGAAGGAGGTCGG + Exonic
950106394 3:10391712-10391734 ACCGGAGGACAGAGGGAGGGAGG - Intronic
950364111 3:12471106-12471128 ACAGGAAGACACAGTGAGGAAGG + Intergenic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950488897 3:13290166-13290188 CCAGGAAGATGGAGGGAGGGGGG + Intergenic
950625802 3:14245987-14246009 GGGGGAAGACTGAGGGAAGACGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
952669455 3:35948536-35948558 GCGGGCAGAGAGTGGGAGGAGGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953602429 3:44379890-44379912 TAGGGAAGAGAGTGGGAGGAGGG + Intronic
953839128 3:46374661-46374683 TTGGGAAGACATGGGGAGGAAGG + Exonic
953907719 3:46876653-46876675 CCTGGAAGACCCAGGGAGGGGGG + Intronic
954314942 3:49795905-49795927 CCTGGAACAGTGAGGGAGGAAGG - Intronic
954437480 3:50503705-50503727 CCGGGAAGAGAGAGGGAGGGAGG - Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955041176 3:55319162-55319184 CCAGGAAGACAGGAGCAGGAAGG - Intergenic
955830485 3:62996390-62996412 ACGGACAGACAGAGGGAGGGAGG + Intergenic
956557618 3:70540368-70540390 TCTGGAAGTCAAAGGGAGGAAGG - Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956761163 3:72446784-72446806 ACTGGAAGAGAGAGCGAGGAAGG + Exonic
956972051 3:74537640-74537662 TAGGGAAGGCAGAGGAAGGATGG + Intergenic
957624926 3:82644302-82644324 TCTGGAAGTCAAAGGGAGGAAGG + Intergenic
959117018 3:102190508-102190530 CCGGTAAGAAGGAGGTAGGAAGG + Intronic
960254832 3:115500967-115500989 TCTGGAAAACAGTGGGAGGAAGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961013390 3:123449789-123449811 GCGGGGAGGCAGCGGGAGGAGGG - Intergenic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
962906607 3:139809137-139809159 CTTGGAAGACCGAGGGAGGAGGG + Intergenic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
963590692 3:147254349-147254371 CCTGGAAGTCAGAGTCAGGAGGG - Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964563963 3:158029403-158029425 CTGGGAAGGAAGAGGGAGGGAGG + Intergenic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965528572 3:169747495-169747517 TGGGGAAGACAGAGTAAGGAGGG + Intergenic
965612871 3:170563297-170563319 CCAGTAAGAGAGAGGGAGGGAGG - Intronic
966080735 3:175997008-175997030 CCTGAAAGACACAGGGAGAATGG + Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966670536 3:182521180-182521202 GTGGGAAGACAAAGGCAGGATGG - Intergenic
967332342 3:188303533-188303555 CCTGGAAGAGAGAGTGTGGAGGG + Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968074308 3:195808174-195808196 CTGGGAAGACGGGGGAAGGAGGG - Intronic
968499399 4:940487-940509 TCAGGAAGAAAGAGGGAGGGTGG + Intronic
968570301 4:1336839-1336861 CCTGGAAGACAGAGAGCAGAGGG - Exonic
968803883 4:2760198-2760220 GCGGAAAGAAAGAGGGAGGGAGG - Intergenic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969359178 4:6650839-6650861 CCATGAAGACAAAGGGAAGAAGG - Intergenic
969425911 4:7123699-7123721 GCGGGAAGAAACAGGGAGGGAGG - Intergenic
969572051 4:8014861-8014883 CCGGAAGGAGAGAGGGAGGGAGG - Intronic
970044853 4:11840577-11840599 CAGGGAAGAAAGAGAGGGGAAGG - Intergenic
970581454 4:17477608-17477630 CCTGGTAGAGAAAGGGAGGATGG - Intronic
971394347 4:26214675-26214697 GAGGGAGGAGAGAGGGAGGAAGG + Intronic
971703200 4:30007259-30007281 CAGGGAGGAGAGTGGGAGGAGGG + Intergenic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972565522 4:40265676-40265698 GAGGGAAGGGAGAGGGAGGAGGG + Intergenic
972568719 4:40291766-40291788 CGGGGAAGACACATGCAGGATGG - Intergenic
972944491 4:44237323-44237345 ATGGGAAGAAAGAGAGAGGAAGG - Intronic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
976611396 4:87034259-87034281 CAGGGAGGATAGGGGGAGGAAGG + Intronic
978973044 4:114834133-114834155 CAAACAAGACAGAGGGAGGAGGG + Intronic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981043937 4:140249028-140249050 TCAGGAACAAAGAGGGAGGAGGG + Intergenic
981886140 4:149675311-149675333 TAGGGAAGACAAAGGGAGAATGG + Intergenic
982736642 4:159013550-159013572 AGGTGAAGACAGAGAGAGGAAGG + Intronic
983527835 4:168778245-168778267 ACTGGGAGACAGTGGGAGGATGG + Intronic
983906892 4:173192675-173192697 ACAGGAAGACTGAGGGAGAAAGG - Intronic
984436278 4:179714010-179714032 AGAGGAAGACAGAGGGAAGAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985671594 5:1209574-1209596 AGAGGAAGAGAGAGGGAGGAGGG - Intronic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986016406 5:3761370-3761392 CCAGGGAGATGGAGGGAGGAGGG - Intergenic
986530115 5:8727034-8727056 GAGGGAAGAAAGAGCGAGGAAGG + Intergenic
986636481 5:9827161-9827183 CCAGGAAGACTGGAGGAGGAAGG - Intergenic
986922891 5:12709216-12709238 TCTGGAAGAGAGAAGGAGGATGG + Intergenic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
988080238 5:26404908-26404930 CCGGGGAGAAAGATGCAGGATGG + Intergenic
988514892 5:31895760-31895782 GGGAGCAGACAGAGGGAGGAAGG - Intronic
990308291 5:54515303-54515325 ACCGGAAGACAGAGGGAGCCTGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
991507339 5:67339148-67339170 GGAGGAAGACAGAGGGAGGGAGG - Intergenic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992768668 5:80027097-80027119 CCAGGAAGAAAGAAGGAGAAGGG - Intronic
993227397 5:85184549-85184571 CCTGGAAGACTGAGAGAGTAAGG + Intergenic
993899905 5:93578450-93578472 CCAGGAAGGCAGAGGAAGGAAGG + Intergenic
993939895 5:94046015-94046037 ACAGGAAGACAGATGGAGGTGGG + Intronic
994642926 5:102432879-102432901 CCTGAAAGAGATAGGGAGGATGG - Intronic
994899785 5:105757077-105757099 CCTGGAAGGCTGAGGCAGGATGG + Intergenic
995337770 5:111021649-111021671 AGGGGACGAGAGAGGGAGGAAGG + Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
996338037 5:122406261-122406283 CAAGAAAGACAGGGGGAGGAGGG - Intronic
996423882 5:123291776-123291798 CTAGGAAGACAGAGGGCTGAAGG + Intergenic
996614371 5:125422734-125422756 CATGGAAGGCAGAGGGAGGTGGG - Intergenic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
997293550 5:132755045-132755067 CCAGGAAGCCAGGGGGAGGAGGG - Intronic
997425319 5:133799025-133799047 AGGGGAGGAGAGAGGGAGGAAGG + Intergenic
997578911 5:135005047-135005069 CCAGGACCACACAGGGAGGAGGG + Intronic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
999985702 5:157003346-157003368 CCTGAAAGACAGAGGGCTGATGG - Intergenic
1000343285 5:160294204-160294226 CGGGGCAGAGAGAGGAAGGAGGG - Intronic
1000751681 5:165102844-165102866 CCTGGAACACAGAGGCAGGGGGG - Intergenic
1001295469 5:170495890-170495912 CCAGGAAGAGGGAAGGAGGAAGG - Intronic
1001333937 5:170782705-170782727 CCGGGAAGGGAGAGAGAGAAAGG - Exonic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003004267 6:2366418-2366440 AAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003183387 6:3810710-3810732 CCGGGAAGGCTGAGGGAGAATGG - Intergenic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003754414 6:9100576-9100598 GAAGGAAGAAAGAGGGAGGAAGG - Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004412366 6:15392491-15392513 AGGGGACGACAGAGGGATGAGGG + Intronic
1004725648 6:18308917-18308939 AAGGGAAGAGAGAGAGAGGAAGG - Intergenic
1004735718 6:18404404-18404426 CCTGTAAGACGGAGGGAGGGAGG + Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1006152379 6:31996407-31996429 CCTGGAAGAAAACGGGAGGAGGG - Exonic
1006158680 6:32029145-32029167 CCTGGAAGAAAACGGGAGGAGGG - Exonic
1006320971 6:33319252-33319274 ACGGGAAGACTGAGGCTGGAGGG + Intronic
1006514387 6:34538026-34538048 CCTGGAGGACAGAGGGAGACAGG - Exonic
1006798318 6:36744526-36744548 CCTGGAGGAGAGAGGGAGGGTGG + Intronic
1006938198 6:37733041-37733063 TCTGCAAGACAAAGGGAGGAAGG - Intergenic
1007292744 6:40799585-40799607 AAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1007342705 6:41201546-41201568 CCTGGGAGAGAGAGAGAGGAAGG - Intergenic
1007346017 6:41229846-41229868 GCGGGAGGACAGGGGCAGGAGGG - Intronic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007989905 6:46244304-46244326 AAGGAAAGAAAGAGGGAGGAAGG - Intronic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008824834 6:55681282-55681304 TGTGGAAGACAGAGGAAGGAGGG + Intergenic
1008917114 6:56800173-56800195 CCGAGTAGACAAAGGGAAGAAGG + Intronic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010767651 6:79794710-79794732 CCTGGAAAACTGAGGCAGGAAGG + Intergenic
1010921013 6:81680637-81680659 GCTAGAGGACAGAGGGAGGAAGG + Intronic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1012051943 6:94357831-94357853 ACAGAAAGAGAGAGGGAGGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012258999 6:97065870-97065892 CCAGGGAGACAGTGTGAGGAAGG + Intronic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1014575017 6:123059044-123059066 CCTGGAGGAGAGAGGGAGGCAGG - Intronic
1015190231 6:130464239-130464261 CCGGGGAGAGTGAGGGAGGCAGG - Intergenic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1016532545 6:145074939-145074961 AAAGGAAGAGAGAGGGAGGAAGG + Intergenic
1016866630 6:148773946-148773968 CGGGGAGGACAGAGGGAAGCTGG - Intronic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017081481 6:150673591-150673613 ACAGGAAGAGAGAGGAAGGAAGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017622639 6:156315023-156315045 TCGGGGAGACAGACAGAGGAGGG + Intergenic
1017869082 6:158470929-158470951 AGGGGAAGGCAGAGAGAGGATGG + Intronic
1018317458 6:162570809-162570831 TTGGGAAGGTAGAGGGAGGATGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1019315134 7:380668-380690 GCAGGAGGACAGAGGGAGGGAGG + Intergenic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019917941 7:4145243-4145265 CAGGGAAGACAAAGGAGGGAAGG + Intronic
1020029133 7:4920674-4920696 GAGGGAGGAGAGAGGGAGGAGGG - Intronic
1020238631 7:6375024-6375046 CCGGGAAGAAAGCCGGAGGGTGG - Intronic
1020595920 7:10207426-10207448 CCGAGAGGGCAAAGGGAGGAAGG - Intergenic
1021413447 7:20354689-20354711 CCAGGCAGAAAGAGGCAGGATGG + Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022335426 7:29417257-29417279 AAAGGAAGAGAGAGGGAGGAAGG + Intronic
1023333690 7:39146339-39146361 GCAGGAAGGCAGAGGGAGGCAGG + Intronic
1023741879 7:43288309-43288331 CCGGGAGCAGGGAGGGAGGAAGG + Intronic
1023747586 7:43336052-43336074 AGGGGAAGAAAGAGAGAGGAAGG - Intronic
1023795437 7:43788245-43788267 ACTGGAAGACAGAGGCAGGAGGG + Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024356824 7:48422097-48422119 GAAGGAAGAAAGAGGGAGGAAGG + Intronic
1026866889 7:73829619-73829641 CCTGGAAGATAGAGGGAGGGTGG - Exonic
1027049077 7:75010318-75010340 AGGGGAAGACAGAGGTAGGCAGG + Intronic
1029383942 7:100231341-100231363 AGGGGAAGACAGAGGTAGGCAGG - Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1031830755 7:126622408-126622430 CCGGAATGACAGGGGAAGGAAGG - Intronic
1032231684 7:130079965-130079987 CCTGGGCGACAGAGGGAGGGAGG - Intronic
1032240097 7:130153601-130153623 CCAGGCAGGGAGAGGGAGGAAGG - Intergenic
1032467161 7:132153355-132153377 CCAGGGAGACAGAGCGGGGAGGG + Intronic
1033685488 7:143636569-143636591 AGGGGATGACAGAGGGAGGGAGG - Intronic
1033688658 7:143715787-143715809 AGGGGATGACAGAGGGAGGGAGG - Intronic
1033699126 7:143821051-143821073 AGGGGATGACAGAGGGAGGGAGG + Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034070440 7:148179582-148179604 CGGGGGAGAGAGAGGGAGGGAGG + Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034434314 7:151055849-151055871 CTGGGAGGAGAGAGGGAGAAGGG + Intronic
1034499516 7:151440559-151440581 GCAGGAAGAGAGCGGGAGGAGGG - Intronic
1034625164 7:152487154-152487176 AAGGGAAGAGAGAGGAAGGAAGG - Intergenic
1034900044 7:154902533-154902555 TCAGGAACCCAGAGGGAGGAGGG - Intergenic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1036057915 8:5280376-5280398 CCTGAATGTCAGAGGGAGGAGGG - Intergenic
1036154173 8:6326261-6326283 AAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1036926978 8:12916400-12916422 GAGGGAGGACAGAGAGAGGATGG - Intergenic
1036942569 8:13065612-13065634 CGGGGAAGAGAAATGGAGGATGG + Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037425187 8:18747936-18747958 CTGGCAAGAGAGAGGGAGAAAGG + Intronic
1037581644 8:20249149-20249171 CCGGCAAGCCACAGGAAGGAGGG - Exonic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038577347 8:28716623-28716645 CCGGGAAGCCAGAGGTGAGAGGG - Exonic
1038579974 8:28739432-28739454 CCCAGGAGACAGAGGCAGGAGGG - Intronic
1038650848 8:29401998-29402020 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039708517 8:40032029-40032051 ACAGGAAGAGAGAGAGAGGAAGG + Intergenic
1039845089 8:41320473-41320495 GGGGGAAGAGAGAGGGAGGGAGG - Intergenic
1039854307 8:41399131-41399153 CCTGGAAGCCAGGTGGAGGAAGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1041255705 8:55978295-55978317 CAGGGATGAGGGAGGGAGGATGG + Intronic
1041714426 8:60921441-60921463 CCGGGAGGGCAGGGGGAGGAGGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1041910797 8:63086373-63086395 GAAGGAAGAGAGAGGGAGGAAGG - Intergenic
1042029428 8:64459651-64459673 CTCGGAAGACTGAGGAAGGAGGG - Intergenic
1042413340 8:68490488-68490510 CCGGGAAGAGAGAGGGTGTGAGG - Intronic
1042810992 8:72824779-72824801 CTGGGAAGAGAGAGAGTGGATGG + Intronic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1043529327 8:81132630-81132652 CCAGCAAGACAGAAGGGGGAAGG - Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044119951 8:88382473-88382495 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1044628821 8:94260106-94260128 CCAGGAAGAAAGAGTGAGGGTGG - Intronic
1044731032 8:95228926-95228948 TCGGGAAGAAAGAGGGCTGAGGG - Intergenic
1044900298 8:96936973-96936995 GAGGGAGGAGAGAGGGAGGAAGG - Intronic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1044933179 8:97269713-97269735 GCAGGAAGAAAGGGGGAGGAGGG - Intergenic
1045425990 8:102066250-102066272 TCAGGAAGACTGAGTGAGGAGGG - Intronic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048194820 8:132323622-132323644 ATGGGAAGTCAGAGAGAGGATGG - Intronic
1048207135 8:132424270-132424292 GCAGTGAGACAGAGGGAGGAAGG - Intronic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049199795 8:141334475-141334497 CCTGGAGGACAGAGAGGGGATGG - Intergenic
1049337418 8:142093804-142093826 CGGGGTAGACAGGGAGAGGAAGG + Intergenic
1049343340 8:142125565-142125587 CCGGGGAGGCCGAGGGAGGGAGG - Intergenic
1049441760 8:142612842-142612864 CCGGAAAGACAGACGGAGGGAGG + Exonic
1049591590 8:143465291-143465313 CCAGGAAGGCAGGGGGTGGACGG - Intronic
1049726190 8:144147590-144147612 CGGGGCAGACAGAGGGCGGGCGG + Intergenic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1050305342 9:4300018-4300040 GGGGGAAGAGGGAGGGAGGAAGG + Intronic
1051454389 9:17237710-17237732 CCAGGAATACTGAGGGACGATGG + Intronic
1051675542 9:19554709-19554731 CCAGCAAGAAAGAGGAAGGAAGG - Intronic
1052016646 9:23476079-23476101 CCAGGAACCCAGAGGCAGGAAGG - Intergenic
1052376260 9:27721157-27721179 CCAGGAACACAGATGTAGGAGGG + Intergenic
1053225435 9:36351636-36351658 ACGGGGAGAGAGAGGAAGGAAGG + Intronic
1053388127 9:37711485-37711507 CGGGGAAGGCAAAGGGTGGAGGG + Intronic
1053786212 9:41654605-41654627 TAGAGAAGACAGTGGGAGGAGGG + Intergenic
1054158839 9:61659593-61659615 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054174927 9:61868550-61868572 TAGAGAAGACAGTGGGAGGAGGG + Intergenic
1054478613 9:65590598-65590620 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054662612 9:67712243-67712265 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054775664 9:69121733-69121755 CCGGGGAGGGAGAGAGAGGAGGG - Intronic
1054793099 9:69274142-69274164 CGAGGAAGTCAGAGGGAGGAAGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056545111 9:87606659-87606681 ACAGGGAGAGAGAGGGAGGAAGG - Intronic
1056706505 9:88956460-88956482 GGGGGAAGACAGAGGTAGAAGGG - Intergenic
1057045454 9:91882789-91882811 ACGTGAAAACAGAGGGAGAAAGG + Intronic
1057714119 9:97476042-97476064 CCTGGAAGACACAGACAGGAAGG - Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1059856317 9:118401624-118401646 CCAGGAAGAAAGAGGGAGGAAGG - Intergenic
1060147957 9:121268278-121268300 CCGGGAAGGAAGGGAGAGGAAGG - Intronic
1060150759 9:121286655-121286677 CCGGGAAGTCAGAGAAAGAAAGG + Intronic
1060549134 9:124476964-124476986 AGGGGAGGACAGAGGGAGGCAGG - Intronic
1060596996 9:124854345-124854367 CCGGGAAGACCGAGGCACAAGGG + Intronic
1060975607 9:127763150-127763172 CCCTGAATAAAGAGGGAGGAGGG - Intronic
1060997931 9:127885593-127885615 CCAGGACGACAGAGGGTCGAGGG + Exonic
1061015843 9:127980558-127980580 CCGGTAAGGCTGAGGGCGGAGGG + Intergenic
1061220306 9:129246695-129246717 CCGGGAAGGCAGAGGGACAGAGG + Intergenic
1061257345 9:129460422-129460444 GCGGGAGGGCGGAGGGAGGAAGG - Intergenic
1061308703 9:129748390-129748412 CCTGGAGGTCAGAGGTAGGAGGG + Intronic
1061315947 9:129795856-129795878 CTGGGAGGTCAGAGGAAGGAGGG + Intergenic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061669968 9:132183144-132183166 CCAGGAAGCCAGAAGGAGGATGG - Intronic
1061738872 9:132684572-132684594 GCGGGAGGACAAAGGGAGGAAGG - Intronic
1061970233 9:134040985-134041007 CAAGGAAGACAGAGGGCGGGTGG + Intronic
1062328247 9:136023061-136023083 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062328259 9:136023091-136023113 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062453808 9:136626580-136626602 CCGGGAAGCCAGAGCCACGACGG + Intergenic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186681388 X:11877800-11877822 CCAGGAAGAGAGAGAGAGGAAGG - Intergenic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1187137159 X:16559195-16559217 CCAGGGAGAGAGAGGGAGGGAGG - Intergenic
1187257217 X:17654348-17654370 CCCGGAAGACAGAGTGTGGCTGG - Intronic
1187524413 X:20041095-20041117 CCAGCAAGACAGAGAGAGGGTGG + Intronic
1188004853 X:25010222-25010244 GAGGGAAGAGGGAGGGAGGAGGG - Intronic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1188819749 X:34760508-34760530 CATGTAAGACAGAGGGAGAAAGG - Intergenic
1190243818 X:48677307-48677329 CCTGGAAGCCTGAGGGAGGAAGG + Intronic
1190308819 X:49102061-49102083 CCTGGAAGTCTGAGGGAGGAGGG + Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1192553327 X:72070681-72070703 CCACCAAGACAGAGGGAGGAGGG - Intergenic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1196705461 X:118713533-118713555 GCGGGAAGACTGAGGGGGGGAGG - Intergenic
1197666394 X:129228708-129228730 CTGGGAAGCCAGAGGTGGGATGG - Intergenic
1197952199 X:131909576-131909598 AGAGGAAGAGAGAGGGAGGAAGG + Intergenic
1198562980 X:137871405-137871427 CCAGGGATACAGAGAGAGGATGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199474535 X:148231076-148231098 AGGGGAAGAGAGAGGGAAGAGGG - Intergenic
1200128398 X:153828969-153828991 CCGGGAACTGAGAGGGAAGAAGG + Intronic
1201652652 Y:16307413-16307435 AGAGGAAGACAGAGAGAGGAGGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202116013 Y:21469325-21469347 CCGGGAAGACTGAGGCTAGAGGG + Intergenic