ID: 1018381452

View in Genome Browser
Species Human (GRCh38)
Location 6:163261490-163261512
Sequence CAAATTGCTGCTGGTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018381452 Original CRISPR CAAATTGCTGCTGGTGATAA TGG (reversed) Intronic
901624656 1:10617184-10617206 CACATTGCTGCTGCTGTGAAGGG - Intronic
901678519 1:10900385-10900407 TAATTTGATGGTGGTGATAAAGG + Intergenic
902062838 1:13659317-13659339 CATATGGCTGCTTGAGATAATGG - Intergenic
902564456 1:17301800-17301822 CATATGGCTGCTTGAGATAATGG - Intergenic
902920429 1:19663398-19663420 CCACTTGCTGCTGGTGATCTGGG + Intergenic
903432316 1:23315744-23315766 CAAATTGTTGCTTCAGATAAAGG + Intronic
903610717 1:24610010-24610032 AAAGTTGCTGATGGTTATAAAGG - Intergenic
905035428 1:34915134-34915156 CAAATTGCTCATGGGCATAAAGG - Intronic
907384269 1:54115871-54115893 CCCATTGCTGCTGCTGTTAATGG + Intergenic
908024953 1:59940241-59940263 TGTATTGCTGCTGGTTATAAGGG + Intergenic
908533919 1:65060636-65060658 CAATTTGCTGCTTGTTATTAGGG - Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909411239 1:75354432-75354454 CATATGGCTGCTTGAGATAATGG - Intronic
911315921 1:96356684-96356706 CAAATTGTTACTGCTGACAATGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912189847 1:107325078-107325100 CAAATTACTGCTGAGGATGAGGG - Intronic
914994593 1:152531623-152531645 CATATGGCTGCTTGAGATAACGG + Intronic
915781214 1:158552604-158552626 CAAATTGCTCCTGGTAATGGAGG + Intergenic
916828003 1:168462379-168462401 CACAGTGCTGCTGTTGCTAATGG + Intergenic
917878739 1:179312316-179312338 GAAATTGGTGGTGGTGATAAGGG + Intronic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
1062954007 10:1528467-1528489 CAAAGTACTGCTGATGATAATGG + Intronic
1065875589 10:29994764-29994786 CAAATTGCTGTTCTTGAGAAGGG + Intergenic
1066792691 10:39083313-39083335 CATATTTCTGCTTGAGATAATGG + Intergenic
1067217791 10:44316848-44316870 CACTTTGCTGCTGGTGAGCACGG + Intergenic
1067255680 10:44636771-44636793 CAAAGTGCCACTGGTGATACTGG - Intergenic
1068063746 10:52102490-52102512 CAAATTTCTGCTGGAGGAAACGG + Intronic
1070393716 10:75993285-75993307 CTCATTGCTGCTGATGATGATGG + Intronic
1070534021 10:77361900-77361922 CAAATGGGAGCTGGTGATATGGG + Intronic
1071512079 10:86268336-86268358 CCAAATGCTGTTGGTGATACCGG - Intronic
1072366694 10:94718617-94718639 CAAATTGCTGCTCCTGATAGTGG - Intronic
1072586459 10:96787149-96787171 CATATGGCTGCTTGAGATAACGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073637347 10:105213473-105213495 AATAATGCTGCTGGTGATGATGG + Intronic
1077825558 11:5805151-5805173 TAAACTGCTGCTGATTATAATGG + Intronic
1079535579 11:21511405-21511427 CAGATTGCCGTTGGTGAGAATGG - Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1080775074 11:35378504-35378526 CAAATTGCTGATGTGAATAAGGG - Intronic
1082692999 11:56328077-56328099 CACATGGCTGCTTGAGATAATGG + Intergenic
1085038208 11:73312030-73312052 CAGTTTTCTGCTGGTGCTAATGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1087926861 11:103928957-103928979 AAATCTGCTGCTTGTGATAATGG + Intronic
1088938569 11:114430298-114430320 CAAATAGCTGTTGGTAAGAATGG - Intronic
1089033925 11:115364959-115364981 CAAATAGCTACAGGTGAAAATGG - Intronic
1090780998 11:130006430-130006452 TAAGTTGCTCCTGGTGACAAGGG + Intergenic
1093947808 12:25130183-25130205 CAAATACCTGCTATTGATAAGGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095521804 12:43075559-43075581 CAAATTGCTGATGCTGCTAGAGG - Intergenic
1096019360 12:48309581-48309603 CAAATTGCTTCTGGTGGTGATGG + Intergenic
1097605741 12:61751373-61751395 AAAAATGCTGCTTGTGAAAATGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1102380358 12:112460233-112460255 CAAATTGCTGCTGGGCACAGTGG - Intronic
1102798579 12:115711357-115711379 GGAATTGGTGTTGGTGATAATGG - Intergenic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1104698325 12:130881554-130881576 CAAAGTGCTGCTGGGAATACAGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107799364 13:44089858-44089880 CAAATTTCTCCTGGTTATGAGGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1111126987 13:83923130-83923152 CCAAGTGATGCTGGTAATAATGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111697868 13:91648004-91648026 GTAATTGCTGCTGCTGCTAAAGG + Intronic
1111789472 13:92835833-92835855 CATATTGCTGATGGGGATACAGG - Intronic
1112893166 13:104264056-104264078 TAAATTTCTGCTAATGATAATGG - Intergenic
1113233538 13:108242135-108242157 CAAAATGCTGCTGATGATCGAGG - Intergenic
1113618898 13:111699992-111700014 CAAAGTGCAGCAGGTGGTAAAGG - Intergenic
1113624427 13:111785253-111785275 CAAAGTGCAGCAGGTGGTAAAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1118480967 14:66165264-66165286 CAAATTGCTGTTGAAAATAATGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120764199 14:88313577-88313599 CAAATTGCTGCTGGTTGTTGGGG - Intronic
1121044983 14:90781299-90781321 GAGGTGGCTGCTGGTGATAATGG + Intronic
1121194635 14:92059349-92059371 CAAAAAGATGCTGGTTATAAAGG + Exonic
1121630502 14:95418509-95418531 AAATTTGATGCTGGTGATGATGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124781514 15:32640834-32640856 AAAATTGCTGTAGATGATAATGG + Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126944809 15:53807784-53807806 AAAATTGCAGCTGGTGAGATTGG - Intergenic
1127557903 15:60106186-60106208 CAAATGTCTGTTGGTGATGATGG + Intergenic
1128139916 15:65292045-65292067 CAAAGTGCTGCTGGGGTTACAGG + Intronic
1128532225 15:68462223-68462245 CCACTTCCTGCTGGTGATACTGG - Intergenic
1128859099 15:71050474-71050496 CAAATTCATGCTGGTGAGAAGGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137022230 16:35440235-35440257 CAAATTGCTCCTAGGGTTAATGG - Intergenic
1139642180 16:68299771-68299793 CAAGTTGCTGCCTGTTATAACGG + Exonic
1143969981 17:10788486-10788508 CAAATTTCTGCTGGTCATAGTGG - Intergenic
1144817227 17:18043606-18043628 CAGTTTGGTGCTGGTGACAAAGG - Intronic
1145399348 17:22518381-22518403 CAAAGTGCTGCTGGGAATACAGG - Intergenic
1147285044 17:39395685-39395707 CAAATTGGTGCATGTGAAAATGG - Intronic
1148170330 17:45514102-45514124 CACATTGTTGTTGGGGATAAGGG + Intergenic
1148170807 17:45518095-45518117 CACATTGTTGTTGGGGATAAGGG + Intergenic
1148278879 17:46331725-46331747 CACATTGTTGTTGGGGATAAGGG - Exonic
1148301094 17:46549587-46549609 CACATTGTTGTTGGGGATAAGGG - Exonic
1149562868 17:57621243-57621265 CAGATTGCTGTTGGTGAGGATGG - Intronic
1150401418 17:64859676-64859698 CACATTGTTGTTGGGGATAACGG + Exonic
1153883496 18:9441212-9441234 CAAACTGCTGTTGGTGCTATTGG - Intergenic
1154139328 18:11809359-11809381 AAAATTGATGGTGGTGATGAAGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156254770 18:35384422-35384444 CAAATTTCTGTTGGAGAAAATGG - Intergenic
1156443965 18:37220730-37220752 CAAATTAATGGTGGTGACAATGG - Intronic
1157869231 18:51214626-51214648 TAGGCTGCTGCTGGTGATAACGG - Intronic
1157897929 18:51486229-51486251 CAATTTGCTGCTTGTAATAGAGG + Intergenic
1159011083 18:63058925-63058947 AAAATTGCTGCTCATGAAAATGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166454552 19:42929683-42929705 GAAATTGCTGCTGGAGATGGAGG + Exonic
1168214026 19:54912155-54912177 CAAGTGTCTGCTGATGATAAGGG - Exonic
927140507 2:20127171-20127193 CAAAATTCTGATGGTGTTAATGG + Intergenic
928819791 2:35346530-35346552 AAAATTGATTCTGGTAATAATGG + Intergenic
928844995 2:35660850-35660872 GAATTTCCTGCTGGAGATAAAGG + Intergenic
929014792 2:37483374-37483396 CAAAATGCTACTGGTGGTTATGG - Intergenic
929622400 2:43368657-43368679 CAAAGTGCTGCTGGGGTTAAAGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931002382 2:57801660-57801682 AATATTGCTGCTGTTGGTAAAGG - Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
935358390 2:102226200-102226222 CCAAATGATGCTGGTGATTAGGG - Intronic
935600205 2:104914831-104914853 CAGATTGCAGCTTGTGCTAATGG - Intergenic
935717398 2:105951491-105951513 CAAATCACTGGTTGTGATAAAGG + Intergenic
936415047 2:112299597-112299619 CAAACTTCGGCTGCTGATAATGG + Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
936952093 2:117987974-117987996 AAACTTGCTGATGGTGAAAAAGG + Intronic
939257241 2:139759785-139759807 CATATTGCTGCTGGTTATTCAGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940738466 2:157480182-157480204 CATATTGCTGCTGGTTATTCAGG - Intronic
942931189 2:181494782-181494804 CAAATTGATGCAGATAATAATGG + Exonic
943540748 2:189210982-189211004 CTAATTGCTAATGGCGATAAAGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945623819 2:212174826-212174848 TAAATTGCTGCTGTTGACTAAGG + Intronic
945652367 2:212579128-212579150 TTAATAACTGCTGGTGATAATGG + Intergenic
946586128 2:221189726-221189748 AAAAATACTGCTGGTGAAAACGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947697073 2:232200385-232200407 CAAATTCCTTCTGGTGGGAATGG - Intronic
948158348 2:235802621-235802643 CAAAATGATGGTGGTGATGATGG + Intronic
1169792266 20:9423886-9423908 AAAATTGTTGGTAGTGATAATGG - Exonic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173399075 20:42708559-42708581 AAAATTGCAGCTTGTGTTAAGGG + Intronic
1173725663 20:45295672-45295694 CAAATTGCAGCTGGGCATGATGG - Intronic
1175112462 20:56658217-56658239 CAAAATGAAGATGGTGATAATGG + Intergenic
1176518578 21:7806823-7806845 CTAAATGGTGGTGGTGATAATGG - Intergenic
1176957657 21:15124751-15124773 AAAAGTGGTGCTGGTAATAACGG + Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177774735 21:25555439-25555461 CAAATTTCTGTTGGTGATTAGGG - Intergenic
1178652606 21:34436836-34436858 CTAAATGGTGGTGGTGATAATGG - Intergenic
1179075076 21:38113415-38113437 CAAAATGCTGCTGGTGTGACTGG - Intronic
1182184023 22:28383331-28383353 CATATTGCTGCTGCGGACAAAGG - Intronic
1182491564 22:30675665-30675687 CATATGGCTGCTTGAGATAATGG + Intergenic
1182492079 22:30679816-30679838 CATATAGCTGCTTGAGATAATGG + Intergenic
1184810612 22:46829059-46829081 CACATTTCTGCTGGTGGTCAGGG + Intronic
949700303 3:6749014-6749036 CAAATTGCTTCTTTTAATAATGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
953158766 3:40398958-40398980 CAAAATGCTGCTGGTATTACAGG - Intronic
953812140 3:46122036-46122058 CAAAGAGCTGTTTGTGATAATGG - Intergenic
955753711 3:62206984-62207006 CACTTTGCTGAAGGTGATAAGGG - Intronic
956124325 3:65997202-65997224 CACAGTGCTGCTGGTGGTCAGGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959867253 3:111284992-111285014 TAAATTGCTCCTGCTGAAAACGG - Intergenic
959875026 3:111372779-111372801 CAAGTGGCTGCAGGTGAAAATGG - Intronic
960396601 3:117145200-117145222 CACAAAGCTGCTGGTGATACTGG - Intergenic
962124470 3:132601206-132601228 CATGTTGCAGCTGGTGATCAGGG - Exonic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965690734 3:171354249-171354271 CAAATTGCTGATTGTAAAAAGGG + Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
968316580 3:197730744-197730766 CATATGGCTGCTTGAGATAATGG + Intronic
968895943 4:3403418-3403440 GAAAGTGCTGCTGGGGATACCGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970879564 4:20912914-20912936 CTCATTACTGCTGGTGAGAATGG + Intronic
970915095 4:21322903-21322925 CAAATTGCTGTTAGATATAATGG - Intronic
971147356 4:23993578-23993600 CAAAATGGGGCTGATGATAATGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
975023744 4:69522915-69522937 AAATTTGCTCCTGGTGAAAATGG - Intronic
975969545 4:80016884-80016906 CAAATTGGAGATGGTGAGAAGGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
981109065 4:140914710-140914732 CAAAATGCTTCTGATAATAAAGG + Intronic
981249838 4:142586507-142586529 CAAAATGCTGTTGGGAATAATGG - Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
986268578 5:6211680-6211702 AAATTTGCTGCTTGTGATATAGG - Intergenic
986319579 5:6618148-6618170 CAGATTGCAGTTGGTGAAAATGG - Intronic
987355981 5:17063152-17063174 CAAATTGCCGCTGGTGAGTCGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989097729 5:37796597-37796619 CAAATTGCTCCTGGAGAAAAAGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991477506 5:67038542-67038564 CAAATTGATGATGGTGTTGATGG + Intronic
991661257 5:68953062-68953084 GGAACGGCTGCTGGTGATAAAGG + Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994776559 5:104041964-104041986 CAAATTTCTGCTTTTCATAAAGG - Intergenic
995896941 5:117025044-117025066 CCAATTGTTGCTGGTGATGATGG + Intergenic
997916573 5:137932663-137932685 CTCACTGCTGCTGCTGATAAAGG + Intronic
999003918 5:147955083-147955105 CAAATTCCTGAATGTGATAATGG + Intergenic
999141095 5:149362674-149362696 CAAAGTGCTGCTGGAGAAAATGG - Exonic
999309006 5:150539372-150539394 CCCATGGCTGCTGGTGAGAAGGG + Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1001579991 5:172791793-172791815 CAGCTTGGTGCTGGTGATCATGG - Intergenic
1002073380 5:176693987-176694009 CAAATTGCTCTGGGTGATGATGG + Intergenic
1002792044 6:444043-444065 CAAATTGCAGCTGATGATGTGGG + Intergenic
1004521204 6:16362484-16362506 CGAAGTGATGATGGTGATAATGG - Intronic
1004988204 6:21106885-21106907 CAAATTGCTTATGGTGGTTATGG + Intronic
1006105696 6:31715125-31715147 CAGACTGCTGCTGAGGATAAAGG + Intronic
1006610721 6:35292762-35292784 CAAGTTGCTGCTGCTCATAGAGG - Exonic
1006709077 6:36049705-36049727 CAAATTTATGCTGATGAGAATGG + Intronic
1008156829 6:48025956-48025978 CAAATTGCTGTTGGAGAGAGTGG - Intronic
1008520335 6:52356912-52356934 CAAATTTCTGCTGGAGAATAAGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1014492924 6:122084214-122084236 CTGATTGCTGCTTCTGATAATGG + Intergenic
1015134758 6:129855028-129855050 CAAATAGCTACTGGGGATATAGG + Intronic
1015569391 6:134605316-134605338 CATATGGCTGCTTGAGATAATGG + Intergenic
1015933586 6:138386181-138386203 CAAAGTGCTGCTGGTATTACAGG + Intergenic
1015979379 6:138823555-138823577 CATGTTGCAGCTGGTGATCAGGG - Intronic
1016611761 6:145998205-145998227 TAAATTCCTAATGGTGATAAAGG + Intergenic
1017657831 6:156646811-156646833 CAAATTGGTGCAGGAGAGAAGGG + Intergenic
1018029339 6:159829902-159829924 CACATTGCTGCTGCTGAAGATGG - Intergenic
1018381452 6:163261490-163261512 CAAATTGCTGCTGGTGATAATGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019560682 7:1655030-1655052 CACATTGCTGCTAGTGAATATGG + Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022577717 7:31514399-31514421 TTAAATGCTGTTGGTGATAAAGG + Intronic
1026399886 7:69998879-69998901 CAAATGGTTGCTGGAGGTAAGGG + Intronic
1026516099 7:71073924-71073946 CATATGGCTGCTTGAGATAATGG - Intergenic
1029068466 7:97875634-97875656 CAAGTTGCTGCTGCTGCTCATGG + Intergenic
1030079689 7:105766780-105766802 CAAATTGCTTCTGGTTTTAAAGG + Intronic
1031217675 7:118917429-118917451 CAATTTGCTGATGGTTACAATGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1034883486 7:154779768-154779790 TAAAATGCTGCTGCTGAGAAGGG - Intronic
1036007030 8:4676615-4676637 CAGATTGCTGCAGGTGCGAAAGG - Intronic
1036464175 8:8980762-8980784 CCCATTGCTGCATGTGATAAAGG + Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038002357 8:23403114-23403136 CAAATTTGGGCTGGTGAGAAGGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039017247 8:33164808-33164830 CAAAGTGGTGATGGTGATGATGG + Intergenic
1040456837 8:47606565-47606587 CAAACTCCTGATGGTGAGAATGG + Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1041207997 8:55517932-55517954 CAAATTGCAGCTGGTGAGAAGGG - Intronic
1041397978 8:57411347-57411369 GAACTTGCTGCTGGTGCCAAAGG - Intergenic
1043291320 8:78605318-78605340 GAGAGTGCTGCAGGTGATAAAGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044105969 8:88207523-88207545 CAAAGTGCTGCTAGTGATGCTGG + Intronic
1044336574 8:90990763-90990785 CAAAGTGCTGCTGGGATTAAAGG - Intergenic
1044959130 8:97512829-97512851 CACATGTCTGGTGGTGATAATGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1047198331 8:122742059-122742081 CAAATTGCTGCCTGTGCAAACGG + Intergenic
1047950813 8:129933198-129933220 CAACTTGGTGCTGGTAATCAAGG - Intronic
1048054516 8:130850616-130850638 CAAACTGATGCAGGTGTTAAAGG + Intronic
1048735059 8:137489974-137489996 CAAATTGCTGCGGTTTATAATGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1048948999 8:139477499-139477521 CAAATTGCTGCTTGTGACAGTGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052941375 9:34134019-34134041 CAGGTCGCTGCCGGTGATAATGG + Intergenic
1055100966 9:72465189-72465211 CAGATTGCTGCTGGGGATAAGGG - Intergenic
1056829246 9:89901264-89901286 CATATTGCTGCTGGTACTGATGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057329268 9:94097607-94097629 CAAATTGCTGCTGGACTTAGCGG + Exonic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1061490112 9:130939764-130939786 AAAAGTGCTGCTGGTGGGAAGGG - Intergenic
1061607654 9:131723369-131723391 GAGATGGCTGCTGGTGATGATGG - Intronic
1187744467 X:22393529-22393551 CAACTTCCTGCTGATGTTAAAGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189077784 X:37936106-37936128 AAAATTGTTGCTAGAGATAAAGG + Intronic
1189203173 X:39215333-39215355 AAAATTGTTGCTGTGGATAAAGG + Intergenic
1190476972 X:50838045-50838067 AAATTTAATGCTGGTGATAATGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193565123 X:83066262-83066284 CATATGGCTGCTTGAGATAACGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194444055 X:93965886-93965908 CATATTGCTGCTTGAGATAATGG - Intergenic
1196663506 X:118293300-118293322 CATATGGCTGCTTGAGATAATGG + Intergenic
1198465227 X:136898868-136898890 CATATGGCTGCTTGAGATAATGG - Intergenic
1198956412 X:142136393-142136415 GAAATTGCTGCTGGTTATTCAGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201279327 Y:12327518-12327540 CATATGGCTGCTTGAGATAATGG - Intergenic
1201643935 Y:16206462-16206484 CAAAATGCTGGTGGTGTTACTGG - Intergenic
1201658880 Y:16378859-16378881 CAAAATGCTGGTGGTGTTACTGG + Intergenic
1202134040 Y:21641988-21642010 CCAATTGCTGCTTCTGATTATGG - Intergenic