ID: 1018383884

View in Genome Browser
Species Human (GRCh38)
Location 6:163285318-163285340
Sequence ATGTGTCAGGGGAAGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018383884_1018383900 20 Left 1018383884 6:163285318-163285340 CCCTCCCGCTTCCCCTGACACAT 0: 1
1: 0
2: 0
3: 22
4: 290
Right 1018383900 6:163285361-163285383 CACCCCGCCAGCCCCAGTCCAGG 0: 1
1: 0
2: 8
3: 63
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018383884 Original CRISPR ATGTGTCAGGGGAAGCGGGA GGG (reversed) Intronic
901757697 1:11451272-11451294 CTGGGGCTGGGGAAGCGGGAGGG + Intergenic
901847838 1:11995719-11995741 ATGTGTAAGGAGGAGCGTGATGG + Intronic
902435765 1:16397366-16397388 TTGTGTCGGGGGAGGCGGGAGGG + Exonic
902536274 1:17120684-17120706 ATGTGAGTGGGGAAGAGGGAAGG + Intergenic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903320038 1:22537585-22537607 GTGTGTGATGGGAAGTGGGAGGG - Intergenic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
904190358 1:28737997-28738019 ATGGGGGAGGGGAAGCGGGAGGG + Intronic
905295695 1:36953188-36953210 ATGAGGCAGGGGCAGGGGGAGGG - Intronic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
905370171 1:37478867-37478889 ATGTGGCAGAGGGACCGGGAAGG + Intronic
905796289 1:40818409-40818431 ATGTGGCAGGGGACTGGGGAGGG - Intronic
905892569 1:41526508-41526530 ATGTGTGAGGGCAAGTGTGACGG - Intronic
906110468 1:43318893-43318915 AGGTCTCTGGGGAAGCTGGAGGG + Intronic
908146238 1:61247614-61247636 ATGTGTGAGGGGAGGTGAGAGGG + Intronic
909266436 1:73564655-73564677 ATGACTCAGGGGAAACGGAACGG + Intergenic
912379926 1:109241849-109241871 AGGACTCAGGGGAAGCAGGATGG - Intergenic
913449493 1:118983557-118983579 TTGTGTGAAGGGAAGCGAGAGGG - Intronic
915463249 1:156081917-156081939 ATGTTTCGGGGGAAGCGCTAAGG - Exonic
917638120 1:176956649-176956671 ATGGGTCAGGGGAGGCAGGGAGG - Intronic
917712364 1:177698510-177698532 TGGTGTGGGGGGAAGCGGGAGGG + Intergenic
917754803 1:178088431-178088453 AGGTGGCAGGGGAAGGAGGACGG + Intergenic
920039005 1:203084030-203084052 ATCTGTAAGGGGAGGTGGGAAGG + Exonic
920913381 1:210237807-210237829 ATGTTTCAGGGTAAAGGGGAGGG + Intronic
922292886 1:224223407-224223429 ATGTGTCAGCGGAATCCTGAAGG - Intergenic
922412138 1:225387236-225387258 ATGTGTGGGGGGGAGGGGGAGGG + Intronic
923041470 1:230322946-230322968 AGGTGTCAGGGGAGGCCGGAGGG - Intronic
1067346645 10:45442945-45442967 ATGTGCCAGGGGAGGCGAGGAGG - Intronic
1067815878 10:49476623-49476645 ATGGGTCATGGGAGGTGGGATGG - Intronic
1070965749 10:80529274-80529296 TTGTGTCAGGGGAAATCGGATGG + Exonic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072785882 10:98282052-98282074 ATGGGTCAAGGGAGGCTGGATGG - Intergenic
1073148433 10:101295513-101295535 ATGTGTGTGGGGCAGCTGGAGGG - Intergenic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1074881708 10:117664832-117664854 GTGTGCCAGGGGAGGAGGGATGG - Intergenic
1075379990 10:122011234-122011256 GTGTGGCTGGGGAAGTGGGAAGG + Intronic
1075574409 10:123568491-123568513 ATCTGGCAGGGCATGCGGGACGG + Intergenic
1077801782 11:5546482-5546504 ATGTGTCGGGGGAAGATGGGAGG - Intronic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1078147333 11:8730721-8730743 ATGTGTGGAGAGAAGCGGGAGGG - Exonic
1078153464 11:8778421-8778443 AGCTGTCAGGGGCAGGGGGAGGG - Intronic
1080954578 11:37078359-37078381 ATGTTTCAGGGGCTGAGGGAGGG + Intergenic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082940895 11:58703999-58704021 AAGTCTCAGGGGAAGGGGAAGGG - Intronic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083326049 11:61873601-61873623 ATGGGACAGGGGTAGAGGGAAGG - Exonic
1084274293 11:68043806-68043828 ACGTGGCAGTGGAAGCTGGAGGG - Exonic
1084918418 11:72449259-72449281 ATCTGTGAGGAGAAGCGGGAGGG + Intergenic
1085398095 11:76217799-76217821 AGGTGGCCGGGGAAGGGGGAGGG + Intergenic
1087343057 11:96933693-96933715 AATTCTCAGGGAAAGCGGGATGG - Intergenic
1089538173 11:119173435-119173457 ATGTGTCAGGGAAAGGGGCCTGG - Intronic
1089539576 11:119181831-119181853 GGGAGTCAGGGGAAGAGGGAAGG + Intronic
1089689982 11:120181115-120181137 ATGTGTCTGGGGGAGCAGGATGG + Intronic
1089753756 11:120670651-120670673 AAGTGTCAGGGGCAGAGGCAGGG - Intronic
1091668931 12:2438624-2438646 ATGTGGCTGGGGAACGGGGAGGG + Intronic
1091749711 12:3014760-3014782 AGGGGTCAGAGGAAGTGGGAAGG - Intronic
1094011250 12:25812395-25812417 ATCTGTCAGGGGATGCCGAATGG - Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095376418 12:41534437-41534459 AGGAGTGAGGGGAAGGGGGAAGG - Intronic
1099207315 12:79743570-79743592 AGGTGAGAGGGGAAGCGGGCAGG - Intergenic
1099662464 12:85581875-85581897 ATGTGTAAGTGAAAGGGGGAAGG - Intergenic
1099920967 12:88956714-88956736 AAGTCTCAGGGGAGGTGGGAGGG - Intergenic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1100382377 12:94073760-94073782 ATGTGGCAGAGGAAGAGGGCAGG + Intergenic
1104178000 12:126351487-126351509 AGGTGTGAGGGGTAGGGGGATGG - Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104765152 12:131325675-131325697 ATGTGTGAGGGGGAGCTGGCAGG - Intergenic
1106100798 13:26694177-26694199 ACCTGTCGGGGGAAGAGGGAAGG - Intergenic
1107425742 13:40291086-40291108 ATCTCTCAGGAGAAGCAGGAGGG + Intergenic
1111336987 13:86837746-86837768 ATGTGTCAAGGAATGTGGGAGGG + Intergenic
1112912995 13:104511751-104511773 ATAGGTCAGGGGAAGGGGGAGGG - Intergenic
1113225807 13:108158544-108158566 AGGTTTCTGGGGCAGCGGGAAGG + Intergenic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1114320522 14:21543612-21543634 GTGTTTTAGGGGAAGAGGGAGGG + Intergenic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1117218632 14:53578703-53578725 ATGTGGCAGGGGGATGGGGAAGG + Intergenic
1118077131 14:62311704-62311726 ATATCTCAGGGGCAGCTGGAAGG + Intergenic
1118158662 14:63266972-63266994 CTGTGTCAGGGGTAGTGTGAGGG - Intronic
1118743519 14:68758128-68758150 ATGAGCCAGGGGAAGAGGGGTGG + Intergenic
1119513838 14:75232609-75232631 ATGTGTCAGGGGTACAGGTATGG + Intergenic
1120429926 14:84400944-84400966 ATGTGTCAGGGGTAGGGAGCAGG + Intergenic
1121105253 14:91275096-91275118 GTGTGTCAGGGGTACCAGGAGGG + Intronic
1122319070 14:100842531-100842553 ATTTGTCAGGGGAAGTTGTAAGG + Intergenic
1122383129 14:101324363-101324385 ATGAGTCAGTGGCAGTGGGATGG - Intergenic
1122461942 14:101903320-101903342 ATGTGACAGGGCAAGGAGGAAGG + Intronic
1124824233 15:33077505-33077527 TGGAGTCAGGGGAAGGGGGAGGG - Intronic
1124835788 15:33194866-33194888 AGGTGGCAGGGGAGGCGGGGCGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125754170 15:42051112-42051134 ATATGTCAGTGGGAGAGGGAGGG + Exonic
1126100630 15:45116315-45116337 GTGTGTCAGGGATAGCTGGAGGG + Intronic
1126379503 15:48031379-48031401 AGGAGTGAGGGGAAGTGGGAGGG + Intergenic
1126653887 15:50955633-50955655 GTGTGTCAGTGGAAGCCTGATGG - Intronic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1127863735 15:63014842-63014864 AGGGGTCAGGGAAAGGGGGATGG + Intergenic
1128005297 15:64234001-64234023 ATTTGAGAGAGGAAGCGGGAGGG - Intronic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1128451057 15:67806110-67806132 ACATGTCAGGGGAAGTGGGGAGG - Intronic
1129119682 15:73388447-73388469 ATGGGGCAGGTGAAGAGGGAGGG + Intergenic
1130691980 15:86089625-86089647 ATTGGTCAGGGGAAGGGTGAGGG - Intergenic
1131256474 15:90865935-90865957 GAGTGCCTGGGGAAGCGGGAGGG - Intergenic
1131406141 15:92166542-92166564 GTGAGTGAGGGGAAGCTGGAGGG - Intronic
1132113648 15:99120282-99120304 ATGTGTCGGGTGCAGTGGGAGGG + Intronic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1135736210 16:24933739-24933761 AAGTGTCAGGGGGAGGGGGCTGG + Intronic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1137558221 16:49486508-49486530 ATTTGGCAGGTGAGGCGGGATGG - Intergenic
1137603554 16:49772465-49772487 ATGTGTCAGGGCAGGTGTGATGG - Intronic
1141916006 16:87097571-87097593 GTGTGTCAGGGGGGGCGGGGGGG + Intronic
1142332838 16:89466328-89466350 AGTTGTCAGGGAAAGGGGGAAGG + Intronic
1143202962 17:5124478-5124500 ATGTGTCAGTGGAAACCAGAGGG - Intronic
1143565481 17:7717834-7717856 GTGTGTCGGGGGCAGAGGGAAGG + Exonic
1143617861 17:8064275-8064297 ATGGGTCAGGGGAGGGGGGCTGG + Intergenic
1144764747 17:17726212-17726234 ATGGGTCTGGGGTAGAGGGAAGG + Intronic
1146845832 17:36181717-36181739 ATGTGTCAGTGGAAACCAGAGGG + Intronic
1147992487 17:44343681-44343703 ATGAGGCAGGGGCAGGGGGATGG - Intergenic
1148677202 17:49452319-49452341 TTCAGTCAGGGGAAGCAGGAAGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149849035 17:60024658-60024680 ATGTGTCAGTGGAAACCAGAGGG + Intergenic
1149861133 17:60121866-60121888 ATGTGTCAGTGGAAACCAGAGGG - Intergenic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151859056 17:76745695-76745717 GTGTCTCAGGAGAAGAGGGAGGG - Intronic
1157226631 18:45871776-45871798 GGGTGTCAGGGGAAAAGGGAGGG + Intronic
1158642350 18:59214305-59214327 ATGTGACAGGGGAAGAGCTAGGG + Intergenic
1158976835 18:62716891-62716913 AGCCGTCTGGGGAAGCGGGAGGG - Exonic
1160506073 18:79427494-79427516 GTGGGTCGGGGGAAGCTGGACGG + Intronic
1160878361 19:1308354-1308376 ATGTGTCGGGGGGGGGGGGAGGG + Intergenic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161990651 19:7682197-7682219 AGGTGTCAGGGGCAATGGGAAGG - Intronic
1163628678 19:18405244-18405266 AGGTGGCTGGGGAAGGGGGAGGG - Intergenic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1165164500 19:33842047-33842069 CTGTTTCAGGGGTAGCTGGAGGG - Intergenic
1165941457 19:39416665-39416687 ATGGGTCGGGGGTAGAGGGAGGG - Intronic
1166961004 19:46495737-46495759 CTGTGTCAGGGAGAGAGGGAGGG - Exonic
1167689795 19:50978325-50978347 AGCTGTCAGGGGATGTGGGATGG - Intronic
1167813042 19:51851929-51851951 ATGTGGCAGGTGATGCGTGAGGG - Intergenic
924982301 2:235341-235363 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982328 2:235420-235442 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982362 2:235521-235543 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982442 2:235770-235792 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982482 2:235893-235915 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982508 2:235978-236000 ATGGGTCAGGGGAGGCAGCATGG + Intronic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926731380 2:16038280-16038302 CTCTGTCAGGGGAGGAGGGAGGG + Intergenic
926865716 2:17356162-17356184 ATGTGTCGGGGGTAGGGTGAGGG - Intergenic
927681976 2:25145802-25145824 ATGTGTCAGGGGAGGGGAGGGGG - Intronic
934300958 2:91775803-91775825 ACGTGTTCTGGGAAGCGGGAAGG + Intergenic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
935943939 2:108269358-108269380 ATGGGTCAGGGCCAGCTGGATGG - Intergenic
936767318 2:115868594-115868616 ATATTTCAGGGGCAGGGGGAGGG + Intergenic
937011468 2:118566554-118566576 ATGTGACAGAGGAAGAAGGAGGG + Intergenic
937814416 2:126235501-126235523 ATGTGTCAGGGCAAGGGAGTTGG + Intergenic
941252588 2:163184825-163184847 CTGTGTCAGGGAAACTGGGAGGG - Intergenic
942504613 2:176628384-176628406 AGGTGGCAGGGGGAGCGGGGTGG + Intergenic
943523601 2:188988092-188988114 ATGTACCAGGGGGACCGGGAGGG - Exonic
944314848 2:198273177-198273199 CTGTGTCTGCGGAGGCGGGATGG + Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948162778 2:235838713-235838735 ATGTGCCAGGGGAACCCCGAAGG + Intronic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
1168902702 20:1378364-1378386 AGGAGTCAGGGGTAGAGGGAGGG + Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169560079 20:6790395-6790417 AAGTCTCAAGGGAAGTGGGAAGG + Intergenic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171232495 20:23498855-23498877 CTGTGTCTGGGGTAGAGGGACGG - Intergenic
1172479746 20:35264017-35264039 ATGGGGCAGGGGACGAGGGAGGG + Intronic
1174487636 20:50871237-50871259 ATGTCTCAGGGGTCCCGGGAGGG - Intronic
1176298422 21:5086630-5086652 ATGGGGCAGGGGAAGTGGGGTGG + Intergenic
1176422798 21:6529827-6529849 AGGTGTCAGGGGCTGAGGGAAGG - Intergenic
1177091541 21:16775290-16775312 ATGTGTCTGAGGCAGAGGGAAGG + Intergenic
1177173516 21:17679696-17679718 ATGTGTAAGGGGAAGCGTCAGGG - Intergenic
1177376297 21:20274533-20274555 ATGTGTCTGGGAAGGAGGGAAGG + Intergenic
1177572859 21:22909614-22909636 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1179698291 21:43138144-43138166 AGGTGTCAGGGGCTGAGGGAAGG - Intergenic
1179858604 21:44175319-44175341 ATGGGGCAGGGGAAGTGGGGTGG - Intergenic
1181112927 22:20612413-20612435 ATGGGTCAGGGGAACTGGCAAGG - Intergenic
1181164661 22:20976846-20976868 ATCTGTCAGGGCAAGTGGGCAGG - Exonic
1181293847 22:21819103-21819125 ACATGACAGGGGAAGCTGGAGGG + Intronic
1181474733 22:23161201-23161223 ATGTGTCAGGAGAACAGGGAGGG - Intronic
1182757777 22:32694284-32694306 ATGTGGCAGGGGAAGGGATATGG - Intronic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1184430150 22:44437799-44437821 ATGAGTCAGGAGAATCTGGAAGG + Intergenic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1185419985 22:50729815-50729837 CTGTGTCAGGGGAAGCCTCAAGG - Intergenic
949740294 3:7224790-7224812 ATGTGTCATGTGTAGTGGGAGGG + Intronic
949895183 3:8763165-8763187 ATGTGTCCGGGGAGGCTGGGAGG - Intronic
951581236 3:24166047-24166069 ATGTGTCATGGGAAGATGGTTGG - Intronic
953033109 3:39190778-39190800 GTGGGTCAGGGGCAGCAGGAGGG - Intronic
953118749 3:40018626-40018648 AGGTGGCAGTGGAAGCAGGAAGG - Intronic
953813017 3:46130529-46130551 ATATGTCAGGGGATGAGGGTAGG + Intergenic
955180737 3:56666863-56666885 ATGGGTAATGGGAAGAGGGAAGG - Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
957008593 3:74979928-74979950 ATGCTTCAGGGAAAGCGGGAGGG - Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957373744 3:79330159-79330181 ATGTGGCAGTGGAGGCGGGGAGG + Intronic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
958880285 3:99661941-99661963 ATGTGCCAGGGGATGAGGGAAGG + Intronic
962906100 3:139804415-139804437 GTGGGGCAGGGGAAGAGGGAAGG + Intergenic
962978846 3:140469806-140469828 GTGAGGCAGGGGAAGAGGGAGGG + Intronic
963044946 3:141095453-141095475 AAGTCTCAGGGGAGCCGGGAAGG - Intronic
963725330 3:148913885-148913907 TTAGGTCAGGGGAAGCGGGTGGG - Intergenic
963982328 3:151552492-151552514 TTATGTTAGGGGAAGAGGGAGGG + Intergenic
964720158 3:159762987-159763009 AGGAGACAGGGGAAGCGGGTAGG - Intronic
966069900 3:175863058-175863080 ATATGTTAGGGGAAAGGGGAGGG - Intergenic
967422878 3:189293288-189293310 GTGTGACAGCGGAAGTGGGAGGG - Intronic
967873032 3:194248106-194248128 ATATGCCACGGGAAGAGGGAGGG - Intergenic
968943300 4:3650605-3650627 AGGTGCCAGGGGCTGCGGGAAGG - Intergenic
969853107 4:9977557-9977579 AGGTGTCAGGAGCAGGGGGAGGG - Intronic
972980996 4:44701157-44701179 ATCTGACTGGGAAAGCGGGAAGG - Intronic
974901871 4:68009117-68009139 AGGTGTCAGGGTAAGAGTGAAGG + Intergenic
975885341 4:78958416-78958438 ATTTGTCAGGGGTAGGGGGATGG - Intergenic
976225560 4:82793199-82793221 ATGAGTCAAAGGAAGAGGGAGGG + Intronic
977027270 4:91834860-91834882 AGGTGTCAGGAGAATCGGAATGG + Intergenic
978285114 4:107068398-107068420 TTGTGTGGGGGGAAGAGGGAAGG - Intronic
979508922 4:121529398-121529420 GTGTGTCAGGGGTAGTGGGTAGG - Intergenic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
980407626 4:132374032-132374054 ATCTGTCAGTGGGAGGGGGAAGG - Intergenic
980427946 4:132651366-132651388 ATGTGTCAAAGCAAGTGGGAGGG - Intergenic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
984210390 4:176840203-176840225 ATTTGTCGGGGGATGGGGGAGGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
986122794 5:4857610-4857632 ATGTGTCAGAGGGTGCTGGATGG - Intergenic
986130393 5:4924546-4924568 ATGTGTAAAGGGAAGAGGGTGGG + Intergenic
987385713 5:17327296-17327318 AGGTGTCAGCGGAGGCGGGGGGG + Intergenic
987466733 5:18280694-18280716 AGGTGTGATGGGAACCGGGATGG + Intergenic
987529962 5:19105029-19105051 ATGTGTCAGGGGAGGTGTGACGG + Intergenic
990611350 5:57460041-57460063 TGGGGTCAGGGGAAGGGGGAGGG - Intergenic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
995989824 5:118223928-118223950 ATGTGTCGAGGGAAGTGGGGAGG - Intergenic
996646878 5:125827521-125827543 ATGAGCCAGGGAAAGTGGGATGG - Intergenic
996904531 5:128583157-128583179 ATGGGTTTGGGGAAGCAGGAAGG - Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
999400307 5:151259097-151259119 ATGTGGCATGAGAAGAGGGATGG + Intronic
1002070856 5:176678284-176678306 AGGTGTCAGGGGAACAGAGAGGG + Intergenic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006369623 6:33635832-33635854 AGGGGTGAGGGGAAGGGGGATGG + Intronic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1009656145 6:66546920-66546942 ATGTGTTGGGGGCAGAGGGAGGG + Intergenic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1010570003 6:77464229-77464251 AGGTGTCTGGGGGAGCTGGAGGG + Intergenic
1011002479 6:82606620-82606642 TTGTTTGAGGGGAAGTGGGATGG + Intergenic
1011112672 6:83854980-83855002 ATCTGTCAGTGGTAGGGGGAAGG + Intronic
1011511211 6:88103355-88103377 ATGTGGGTGGGGAAGCAGGATGG - Intergenic
1011654823 6:89542505-89542527 CTGTGTCTCGGGAAGCGGGGGGG - Intronic
1011674251 6:89715937-89715959 ATGTGCCTAGGGAAGCGAGAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015175039 6:130296930-130296952 AAGTGTCAGGGGAAGGGGCTGGG - Intronic
1015675765 6:135746497-135746519 GTGGGTCGGGGGAAGGGGGAGGG + Intergenic
1015778574 6:136839948-136839970 ATTTGTCTGGGGAAGGGGCAGGG + Intronic
1017229832 6:152062189-152062211 AATTGTTAGGGGAAGCGGGAAGG - Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018825654 6:167406270-167406292 ATGGGGCAGGGGCAGCGGCAGGG + Intergenic
1019061053 6:169258638-169258660 ATATTTCAGTGGAAGCCGGATGG + Intergenic
1019440174 7:1041952-1041974 ATGCGGCAGGGGAAGGGGAAGGG + Intronic
1020115902 7:5476243-5476265 ATGTGTCTGGGGTGGAGGGAGGG - Intronic
1022185815 7:27967294-27967316 ATGTCTCAGGGGTAGGGGTATGG - Intronic
1022290734 7:29000301-29000323 ATGTGTCAGGGGAAGCTTCTTGG + Intronic
1022393641 7:29965397-29965419 ACGAGTCAGGGGCAGCGGGGAGG + Intronic
1022755251 7:33280713-33280735 ATGTGTCAGGGGAAGAGCTGTGG + Intronic
1023634309 7:42194543-42194565 ATTTGTCAGGTTAAGCTGGAGGG - Intronic
1024977326 7:55125945-55125967 GAGTGTGAGGGGAAGTGGGATGG - Intronic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1028716718 7:93979515-93979537 ATGTGTCATGGGGAGAAGGAAGG - Intronic
1030505622 7:110418259-110418281 ATGTGTCAAGGGAAGAAGCAAGG - Intergenic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1035336759 7:158134289-158134311 GTGTGTGAGAGGGAGCGGGAGGG - Intronic
1036653775 8:10662583-10662605 CCGAGTCAGGGGAAGCGGGAGGG - Intronic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1038493322 8:27985200-27985222 AAGAGTCAGGGAAAGGGGGATGG + Intronic
1038746645 8:30260709-30260731 ATGTGTCAGGGCAAGAGGGGTGG + Intergenic
1039868715 8:41528326-41528348 CTGTGTCAGGGTCACCGGGAGGG + Intergenic
1040518085 8:48150769-48150791 ATGTGTCCGGGGAAGTGAGGGGG + Intergenic
1041435549 8:57836561-57836583 AAGTGATAGAGGAAGCGGGAAGG + Intergenic
1041474341 8:58247419-58247441 GTGTGTCAGGGGGGGCGGGGTGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1049347513 8:142146681-142146703 ATGTGGCTGGAGAAGTGGGAGGG + Intergenic
1050123221 9:2330033-2330055 ATCTGTCAGGGGCAGGGGGAGGG - Intergenic
1051765961 9:20524018-20524040 AGGGGTCAGGGGAAGTGGCAGGG + Intronic
1052482826 9:29053411-29053433 ATGGGTGGGGGGAAGGGGGAGGG + Intergenic
1056458648 9:86788080-86788102 ATGTGTCAGCAGTGGCGGGAGGG + Intergenic
1057410189 9:94811018-94811040 ATGTGACAGGGGTAGGGGGCAGG - Intronic
1059453751 9:114387103-114387125 ATGTGTCAGGGAGATGGGGAAGG + Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059965130 9:119606254-119606276 ATGTGTCAGGGGTGGGGGGCTGG - Intergenic
1060230071 9:121819590-121819612 AGGCGTCAGGAGGAGCGGGAAGG + Intergenic
1060301126 9:122375198-122375220 ACGTGGCGGGGGAGGCGGGAGGG + Intronic
1061388300 9:130303253-130303275 ATGTGTCAGGGCAGGAAGGATGG + Intronic
1062361451 9:136190214-136190236 ATGAGGCAGGGGGAGGGGGAGGG - Intergenic
1062457456 9:136646364-136646386 ATGGGTCAGGGGCAGCGGGGTGG - Intergenic
1188589599 X:31817784-31817806 GTGGGTCAGGGGAAGTGTGATGG - Intronic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189208271 X:39260668-39260690 AGGTGTAAGGGGAAGGGGCATGG - Intergenic
1190976101 X:55402504-55402526 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1192576251 X:72245594-72245616 ATCTCCCAGGGGAAGCAGGAAGG + Intronic
1192588685 X:72341290-72341312 ATGTGTCAGGGGATGAGGGTGGG + Intronic
1195604338 X:106785492-106785514 ATGTGACAAGGGAAGCAAGAGGG + Intronic
1196387367 X:115173189-115173211 TTGGGTCAGGGTCAGCGGGATGG - Intronic
1197774786 X:130111631-130111653 ATGAGTCAGGGGAAGGGCTAGGG + Intergenic
1199140479 X:144305982-144306004 TTGTGTTCGGGGAGGCGGGAAGG + Intergenic
1200230198 X:154440136-154440158 ATGAGTGAGGGGAAGCTGGGTGG + Exonic
1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG + Intergenic
1201434154 Y:13938951-13938973 ATGGGTGAGGGGGAGAGGGAAGG - Intergenic
1201861251 Y:18599628-18599650 ATGTATCATGGGTAGGGGGAGGG + Intergenic
1201872072 Y:18720752-18720774 ATGTATCATGGGTAGGGGGAGGG - Intergenic