ID: 1018384342

View in Genome Browser
Species Human (GRCh38)
Location 6:163289677-163289699
Sequence ACTCCCTCCTGGACTAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018384342_1018384347 18 Left 1018384342 6:163289677-163289699 CCTGTACTAGTCCAGGAGGGAGT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1018384347 6:163289718-163289740 ACCTATGAGGAAATGAAGACCGG 0: 1
1: 0
2: 2
3: 26
4: 241
1018384342_1018384350 24 Left 1018384342 6:163289677-163289699 CCTGTACTAGTCCAGGAGGGAGT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1018384350 6:163289724-163289746 GAGGAAATGAAGACCGGGAGTGG 0: 1
1: 0
2: 4
3: 65
4: 679
1018384342_1018384344 5 Left 1018384342 6:163289677-163289699 CCTGTACTAGTCCAGGAGGGAGT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1018384344 6:163289705-163289727 TGCTCCCTGCTTTACCTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 199
1018384342_1018384349 19 Left 1018384342 6:163289677-163289699 CCTGTACTAGTCCAGGAGGGAGT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1018384349 6:163289719-163289741 CCTATGAGGAAATGAAGACCGGG No data
1018384342_1018384352 26 Left 1018384342 6:163289677-163289699 CCTGTACTAGTCCAGGAGGGAGT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1018384352 6:163289726-163289748 GGAAATGAAGACCGGGAGTGGGG 0: 1
1: 0
2: 4
3: 25
4: 293
1018384342_1018384351 25 Left 1018384342 6:163289677-163289699 CCTGTACTAGTCCAGGAGGGAGT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1018384351 6:163289725-163289747 AGGAAATGAAGACCGGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018384342 Original CRISPR ACTCCCTCCTGGACTAGTAC AGG (reversed) Intronic
900947072 1:5837093-5837115 ACTCCCTCCTGCAGAAGTCCTGG + Intergenic
903685733 1:25130652-25130674 ACTCCCTCCTGGAGGTGTGCAGG + Intergenic
906101549 1:43267095-43267117 CCTACCTCCTGGAATAGGACTGG - Intronic
908252245 1:62274409-62274431 GCTCCCTCCTGGACCAGCTCTGG + Exonic
910377997 1:86594443-86594465 ACAGCCTCCTGGAGTAGCACAGG + Intergenic
920655155 1:207868998-207869020 ACTCCCACCTGGCCGAGTCCCGG + Intergenic
921887835 1:220324249-220324271 GCTTCCTCCTGGACTATTCCTGG + Intergenic
924488934 1:244515632-244515654 ACTCCCTCCTGCTCTATTAATGG - Intronic
1066784871 10:38992309-38992331 ACTCCCTCCTGGTTTAGTCTTGG + Intergenic
1069298645 10:66878730-66878752 ACACCCTACTGGACCAGTAGAGG + Intronic
1076040093 10:127239054-127239076 ACACCCTGCTGGACAGGTACAGG + Intronic
1076369089 10:129940381-129940403 ACCCCATCCTGGACTAGCCCAGG - Intronic
1081258626 11:40930125-40930147 ACTACCTTCTGGACTAGAAGTGG - Intronic
1089566260 11:119373253-119373275 CCTCCCTCCTGGACTATGACCGG - Exonic
1092417231 12:8299602-8299624 ACTCCCTCCTGCACTTGTCGGGG - Intergenic
1092897784 12:13030035-13030057 ACTCCCTCCTTCACTAATAGAGG - Intergenic
1093631675 12:21417890-21417912 ACTCCCCTCTGAACTAATACTGG - Intronic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1106504559 13:30360021-30360043 ACTCCTTCCTGGCCGAGTTCTGG - Intergenic
1107604812 13:42047710-42047732 ACTTCCTCCTGCTCTAGTCCGGG + Intronic
1114859528 14:26497738-26497760 ACTCCTTACTTGACTAGTTCAGG - Intronic
1120907586 14:89633750-89633772 GCTCCATCCTGGTCTAGTTCTGG - Intronic
1122198689 14:100108776-100108798 ACTCCCTCCTGCACTCCCACGGG + Intronic
1132359673 15:101201869-101201891 ACCCCCTCCTGGACACCTACTGG - Intronic
1132684879 16:1158159-1158181 CCTGCCTCCTGGGCTAGTACAGG + Intronic
1141162533 16:81638872-81638894 ATTTCCTCATGGACTAGAACAGG - Intronic
1147958086 17:44148779-44148801 ACTCCCTCAAGGACTAGCTCTGG + Exonic
1149267655 17:54945030-54945052 ACTCCCTCCACAACTATTACGGG + Intronic
1160466173 18:79078494-79078516 ACTCCATCTTGGTCTAGAACTGG + Intronic
1161109259 19:2460124-2460146 ACTTCCTCCTGACCTAGAACTGG + Intergenic
1162007912 19:7791612-7791634 AAGCCCTCCTGGCCTAGTGCAGG - Intergenic
1165784917 19:38455717-38455739 TCTCCCTCCTGGACAAGCATGGG + Exonic
927891780 2:26755276-26755298 ACTTCCTCCTGGGCAAGGACTGG - Intergenic
937827542 2:126383045-126383067 TCTCACTCCTGGTCTAGCACAGG + Intergenic
938207877 2:129439295-129439317 ACTCCCACCTGGACACTTACAGG - Intergenic
939268589 2:139909030-139909052 ACTCCCTGCTGGATCAGAACTGG - Intergenic
941303004 2:163827733-163827755 ACTCCCTTCTGGCCCAGGACAGG + Intergenic
944268216 2:197751580-197751602 ACTTCTTCCTGGATTAGTATTGG - Intronic
947444984 2:230156596-230156618 AGTCCCTCCTGGACTGGAGCTGG - Intergenic
948580527 2:238984973-238984995 ATTCCCTCCAGGACTCCTACGGG + Intergenic
1169896785 20:10513061-10513083 ACCTCTTCCTGGACTAGGACAGG - Intronic
1174034497 20:47660066-47660088 ACTCCCTCCTGCACTTGGTCAGG - Intronic
1175835935 20:61994495-61994517 AATCCCTCCTGGGACAGTACAGG - Intronic
1178007258 21:28235264-28235286 ACTCCCTTCTGGCCTAGGGCAGG - Intergenic
1179554904 21:42166389-42166411 ACTCTCTCCTGGACAGGCACGGG - Intergenic
1181060111 22:20278363-20278385 ACTACCACCTGAACTAGTCCTGG + Intronic
954216696 3:49128758-49128780 ACTCCATCCTGGACTGGCTCAGG - Exonic
958080856 3:88744257-88744279 GCTACCTCCTGTATTAGTACAGG + Intergenic
967918359 3:194596288-194596310 ACTTCCTCCTGGACTGGGGCAGG - Intronic
969004881 4:4011146-4011168 ACTCCCTCCTGCACTTGTCGGGG - Intergenic
969809022 4:9633540-9633562 ACTCCCTCCTGCACTTGTTGGGG + Intergenic
970055029 4:11961983-11962005 ACTTCTTCCTGGATTAGTCCTGG + Intergenic
978193417 4:105942625-105942647 AATCCCTCCTGGAGGTGTACTGG - Exonic
982629401 4:157812749-157812771 ACTCCCCTCTGGCCTAGGACTGG - Intergenic
987241279 5:16002698-16002720 ACTGCCTGCTGGAATATTACTGG - Intergenic
998118962 5:139560992-139561014 CCTCCTCCCGGGACTAGTACGGG + Intronic
1005135748 6:22569003-22569025 ATTTCCTCCGGGACTAGCACTGG - Intergenic
1006162416 6:32046329-32046351 ACTCCTTCGTGGTCCAGTACAGG - Intronic
1006162933 6:32048517-32048539 ACTCCTTCCTGGTACAGTACAGG - Intronic
1008001854 6:46368766-46368788 ACTCACTCCCTGACTCGTACAGG - Intronic
1016031611 6:139344092-139344114 ACTGCTTCCTGGAATATTACCGG + Intergenic
1017608431 6:156158150-156158172 CCTCCCTCCTGAGCTACTACAGG - Intergenic
1018384342 6:163289677-163289699 ACTCCCTCCTGGACTAGTACAGG - Intronic
1018681640 6:166270294-166270316 CCTCCCACCTGGACAAGTCCGGG - Intergenic
1022844317 7:34194301-34194323 ACTTTCACCTGGAATAGTACTGG - Intergenic
1023984543 7:45087194-45087216 TCTGCCTCCTGGACTCTTACTGG + Intronic
1025993824 7:66515481-66515503 ACTCCCTCCTGGCATAGAGCAGG - Intergenic
1030299731 7:107963002-107963024 ATTCCCTCCTGGACTGGAGCCGG - Exonic
1032402230 7:131631315-131631337 TCTCTCTCCTGGACCACTACAGG + Intergenic
1033914397 7:146306182-146306204 ACTCCTTCCTGGTTTAGTCCTGG - Intronic
1037102868 8:15069010-15069032 ACTCCCTACTGGACAAAAACGGG + Intronic
1038040201 8:23717789-23717811 AGTCCCTCCTGGAATAAGACAGG - Intergenic
1039451088 8:37675579-37675601 ACTCCCGCCTGGCCCAGGACCGG + Intergenic
1039548032 8:38423726-38423748 ACTCCCTCCAGGACTGGAGCAGG + Intronic
1041153692 8:54962054-54962076 AGTTCTTCCTGGACCAGTACAGG - Intergenic
1044836803 8:96303496-96303518 TGGCTCTCCTGGACTAGTACAGG + Intronic
1045407902 8:101885496-101885518 ACTCCCTGCTTGACTACTAGTGG - Intronic
1046384064 8:113486294-113486316 AATCCCTCATGGACTAGTGATGG - Intergenic
1048919079 8:139211410-139211432 ACCTCCTCCTGGTCTAGTAGAGG - Intergenic
1057632069 9:96727530-96727552 TCCCTCTCCTGGGCTAGTACAGG + Intergenic
1060890796 9:127186862-127186884 TCTCCCTCCAGGACTAGGCCTGG - Intronic
1061856068 9:133442639-133442661 ACTCCTTCCTGGCCTGGTCCAGG - Exonic
1062288788 9:135785513-135785535 ACTCCCTCCTGCACTGGTGGTGG + Intronic
1188248272 X:27859714-27859736 ACTCCCACCTGGACACATACAGG + Intergenic
1188446512 X:30258160-30258182 ACTCCCACCTGGACACATACAGG + Intergenic
1195502611 X:105619654-105619676 TCTCTCTCCTGGACAACTACTGG - Intronic
1197149813 X:123207891-123207913 ACTCCCTCCTGGAACACAACAGG + Intronic