ID: 1018385113

View in Genome Browser
Species Human (GRCh38)
Location 6:163296057-163296079
Sequence GAGTCTCCTAACACCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018385113_1018385119 16 Left 1018385113 6:163296057-163296079 CCCTGGGGGGTGTTAGGAGACTC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1018385119 6:163296096-163296118 CTTTATTCTTCAGGAAATATAGG No data
1018385113_1018385117 7 Left 1018385113 6:163296057-163296079 CCCTGGGGGGTGTTAGGAGACTC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1018385117 6:163296087-163296109 CCCATTTTACTTTATTCTTCAGG 0: 1
1: 0
2: 4
3: 34
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018385113 Original CRISPR GAGTCTCCTAACACCCCCCA GGG (reversed) Intronic
900171340 1:1270619-1270641 GAGCCTCCCAACTCCCCCCGTGG + Intronic
904380142 1:30105077-30105099 GAGTCTCCCAGCATCCCACAGGG + Intergenic
904462395 1:30687906-30687928 GAGCCACTCAACACCCCCCATGG + Intergenic
904870294 1:33613405-33613427 GAGTCTCCTAAGACTGCCGAGGG + Intronic
920249736 1:204615613-204615635 GACACTCCTAGCACCCCACAGGG - Intergenic
921341457 1:214138444-214138466 GAGGCTCCTAACACACCCATGGG + Intergenic
921381055 1:214524977-214524999 GGGTTTCCTGACACCCTCCATGG - Intronic
922903975 1:229159840-229159862 GAGTCTCCTGACACCATGCAGGG + Intergenic
923497994 1:234541513-234541535 GATTCTCCCAACACCCGGCAAGG - Intergenic
924518051 1:244782405-244782427 TAGTGTCCTAACAGGCCCCACGG + Intergenic
924949275 1:248867532-248867554 CAGTCTCCAGACACACCCCAGGG + Intergenic
1064183291 10:13138440-13138462 GAGTCCCCTACCACACCTCAGGG + Intergenic
1067115701 10:43434216-43434238 AAGTCTCCTAAGACACCCCATGG - Intergenic
1074872958 10:117591753-117591775 CAGTGTCTTCACACCCCCCAGGG - Intergenic
1075400760 10:122159840-122159862 GACTCTCCAAACACCACCAATGG - Intronic
1077636016 11:3841420-3841442 GAGTCTCCCCACCCTCCCCAGGG - Intergenic
1079959393 11:26904326-26904348 GAGTCCCCTAGGAGCCCCCAAGG + Intergenic
1080929520 11:36794167-36794189 GAGTCTCATAACAACCCTCTGGG + Intergenic
1081872739 11:46390929-46390951 GAGTCTCCTCTCCCGCCCCAGGG - Intergenic
1085503896 11:77044872-77044894 CTGTCTCCTATCACCCCCGATGG - Intergenic
1091664744 12:2411163-2411185 GAGGCTCCTGATACCCCACAGGG - Intronic
1096714064 12:53480631-53480653 CAGTCTCCTAACCTCCCCCTGGG + Intronic
1113507211 13:110825613-110825635 GACTCTCCCAACTCCACCCATGG + Intergenic
1118171091 14:63389385-63389407 AATTCTCCTAACACCCTGCAAGG - Intronic
1119651434 14:76386853-76386875 AGGTCTCCTAACAGCACCCAGGG + Intronic
1122843103 14:104476291-104476313 GAGTCTCCACAGAGCCCCCAAGG + Intronic
1129409192 15:75339481-75339503 GGGTCTCCTGACTCCCCACAAGG + Intronic
1132683144 16:1152106-1152128 CAGGCTCCTGACTCCCCCCAGGG - Intergenic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1135140586 16:19918013-19918035 CACTCTCCTAATGCCCCCCAAGG + Intergenic
1138766429 16:59610674-59610696 GAGTCTCCTAACAGACCCCCTGG + Intergenic
1140944234 16:79752867-79752889 GAGCCTCCTAAGACCTCCCTGGG - Intergenic
1142243050 16:88955885-88955907 AAGTCTCCTGACCCCGCCCAAGG + Intronic
1145102586 17:20089164-20089186 GAGTTTGCTAACTCCCCCAACGG - Intronic
1147262044 17:39214410-39214432 GTGTCCCCTCACAGCCCCCAGGG - Intronic
1149683226 17:58519906-58519928 GAGTCTCCCATCACACCTCAGGG - Intergenic
1152044787 17:77928906-77928928 GAGTCTCCTTTCACCCTCCCTGG + Intergenic
1156121703 18:33850948-33850970 GAATATCCTAAGATCCCCCAGGG - Intergenic
1157475595 18:48021542-48021564 CAGTCTGCCAGCACCCCCCAGGG + Intergenic
1160563415 18:79772630-79772652 GCGTCTCCTCACTTCCCCCATGG - Intergenic
1161318508 19:3630401-3630423 GTGTGTCTTAACTCCCCCCAGGG - Exonic
1164615661 19:29665564-29665586 GAGTCTCCCATCACCACCCCCGG + Intronic
1166300100 19:41908260-41908282 GGGTCTCCCGGCACCCCCCAAGG - Intronic
926009166 2:9394908-9394930 GAGTCTCTTCACGCCCCCCGTGG + Intronic
929414785 2:41736444-41736466 GAGACTCCAAACAGCACCCAGGG + Intergenic
932850937 2:75185899-75185921 AAATCTCAAAACACCCCCCAGGG + Intronic
934652808 2:96101971-96101993 GGGTCTCTTAACAGCCTCCAGGG + Intergenic
1169354929 20:4898162-4898184 GGGTCTCCTCAAACCCCCCAGGG - Intronic
1171202949 20:23256415-23256437 CAGTCTCCTAACAGGCTCCAGGG + Intergenic
1171815591 20:29783406-29783428 GAGACTCCCAACTCCCTCCATGG - Intergenic
1173656770 20:44704894-44704916 GAGTTGCCTAACATCCCTCAGGG + Intergenic
1173667025 20:44770361-44770383 GAGTCCCCTAAAACCATCCATGG - Intronic
1174861883 20:54098893-54098915 GAGTCCCCTGACATCCCCCCTGG - Intergenic
1175966787 20:62663980-62664002 GAGCCTCCATTCACCCCCCAGGG + Intronic
1176410771 21:6448366-6448388 CACTCCCCTAACACCCCGCAGGG + Intergenic
1177323840 21:19557398-19557420 TAGTCTCCTAACCTCCCACAGGG + Intergenic
1179686264 21:43056688-43056710 CACTCCCCTAACACCCCGCAGGG + Intronic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1181703204 22:24632379-24632401 GGGTCCCCCAACCCCCCCCAGGG - Intergenic
1181925428 22:26354872-26354894 GTGTCTCCTGACACCCCGCGTGG - Intronic
1184900717 22:47444898-47444920 GAGCCTCCTAGCACCCAACAGGG + Intergenic
1185320561 22:50198604-50198626 GAGGCCCCTGCCACCCCCCATGG + Exonic
949788181 3:7764379-7764401 GAGTCTCTTCACACTGCCCAGGG - Intergenic
949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG + Intronic
953911094 3:46893430-46893452 GTGACTCCCAAGACCCCCCAGGG + Intronic
956259038 3:67316746-67316768 GGCTCTCCTAACACCTCTCAGGG + Intergenic
961454113 3:127015897-127015919 TAGTCTCCTCACAGCCCCCTGGG + Intronic
961623926 3:128246296-128246318 GATGCTCCTAACACCCCAGAAGG + Intronic
964495136 3:157280506-157280528 CAGTAACCTAACACCCCTCAGGG - Intronic
969675261 4:8610918-8610940 GAGTCTCATGACCCCCACCAGGG + Intronic
979459115 4:120960254-120960276 GAGTCTGCAAACACCCACAAAGG + Intergenic
980397077 4:132227840-132227862 GAGTCTTCTCTAACCCCCCAGGG + Intergenic
999730580 5:154474000-154474022 GTGTCTCCCAACAGCTCCCATGG - Intergenic
1003234214 6:4281630-4281652 GCGTCTCCGAACACTCCCCTTGG + Intergenic
1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG + Intronic
1008547976 6:52600096-52600118 GAGTCTCCCAACACCTGCAAAGG - Intergenic
1011918156 6:92536002-92536024 GAGTTTCCTAGCTCCCCTCAGGG - Intergenic
1018385113 6:163296057-163296079 GAGTCTCCTAACACCCCCCAGGG - Intronic
1018457437 6:163964468-163964490 GAGTCTCCTAACCCCTGCCCTGG - Intergenic
1019480537 7:1264716-1264738 CACTCTCCTGACACCTCCCATGG - Intergenic
1019934568 7:4245896-4245918 GAGTCTCATAACATCCCCACAGG + Intronic
1022137859 7:27466303-27466325 CCGTCTCCTACCATCCCCCATGG - Intergenic
1022381222 7:29861771-29861793 GAGTCTCCCAACAACCCTGAGGG - Intronic
1023055360 7:36286021-36286043 AAGCCTCCTAACACCACCCTGGG + Intronic
1023853338 7:44163061-44163083 GATTCTCCTAACCCCTCCCTAGG - Intronic
1033593089 7:142831057-142831079 GAGTCCCCCACCACCCACCAGGG + Intergenic
1033593294 7:142833222-142833244 CAGTCCCCTAACACCCATCAGGG + Intergenic
1040311905 8:46241115-46241137 GAGGCTCCCAGCACTCCCCACGG - Intergenic
1043363511 8:79503483-79503505 GAGTGTCCTCACCCCTCCCAGGG + Intergenic
1043805703 8:84669984-84670006 TAGTCTCAAAACACCCCCAAGGG + Intronic
1046110903 8:109723048-109723070 GAGTGTTGTAACACCCCCAAAGG + Intergenic
1047404297 8:124572512-124572534 GACTCTCCTAACACTGCCGATGG - Intronic
1047959765 8:130002668-130002690 AAGTCTCCTCACAGCCTCCATGG + Intronic
1049237794 8:141521151-141521173 GAGTCTCCTCACATGACCCATGG + Intergenic
1049408666 8:142462815-142462837 CAGTCTCCTCACCACCCCCAAGG - Intronic
1049828398 8:144685088-144685110 GGGTCCCCTCACACCCCCCTCGG + Intergenic
1056294323 9:85176318-85176340 GAGTCTTCTAGCCACCCCCAGGG + Intergenic
1058529045 9:105887922-105887944 GACTCTCCCCACAGCCCCCAAGG - Intergenic
1060589997 9:124810636-124810658 GATTCTCCTAGCACCTCCCTTGG + Exonic
1062538502 9:137031353-137031375 GAGTCTCCTAGCCACACCCACGG - Exonic
1187782418 X:22842920-22842942 AAGTCTCCTCTCACTCCCCAAGG + Intergenic
1191237391 X:58145104-58145126 GAGTCTCCTAGCTGACCCCAGGG + Intergenic