ID: 1018385769

View in Genome Browser
Species Human (GRCh38)
Location 6:163301535-163301557
Sequence GACAGCAGGACATTGTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018385769_1018385772 -8 Left 1018385769 6:163301535-163301557 CCAGATAACAATGTCCTGCTGTC 0: 1
1: 0
2: 1
3: 4
4: 122
Right 1018385772 6:163301550-163301572 CTGCTGTCCCTCATGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018385769 Original CRISPR GACAGCAGGACATTGTTATC TGG (reversed) Intronic
901278828 1:8015344-8015366 GACTGTAGGCCATGGTTATCGGG + Exonic
901450045 1:9330551-9330573 GCCAGCTGGACCTTGTGATCTGG + Intronic
906465802 1:46078067-46078089 TACAGAAGGAATTTGTTATCGGG - Intronic
906750410 1:48253616-48253638 TCCAGCAGGACCTTGTTCTCAGG + Intergenic
908055663 1:60284016-60284038 GTCAGCAGGTCATCCTTATCAGG - Intergenic
908995032 1:70141144-70141166 GATAAGAGGACATTGTTAACTGG + Intronic
911484088 1:98483726-98483748 GAAAGCAGCACAATGTTGTCAGG + Intergenic
912396356 1:109347443-109347465 GACAACAGGACATTATTTTCTGG + Intronic
916373952 1:164130835-164130857 GAAAGCAGGCTATTGTTATGTGG - Intergenic
917489033 1:175481855-175481877 GGCAGCAGGACAGTGCTTTCTGG - Intronic
917601364 1:176577607-176577629 GACAGCAGGACTGTGTGAGCAGG - Intronic
918757239 1:188354436-188354458 GAAAGCAGGAAATTGTTTTATGG - Intergenic
918807733 1:189071206-189071228 GAGAGCACAACATTGTTAGCTGG - Intergenic
921867377 1:220099938-220099960 GAAAGGAGGAAATTGTTTTCTGG + Intronic
921876940 1:220207879-220207901 GACAGCAGGTCATTCGTTTCAGG - Intronic
922448108 1:225714544-225714566 GACAGCAGGATACTGTAATAAGG - Intergenic
1063378986 10:5572486-5572508 GACAGCAGGACCTTCTTAGAGGG + Intergenic
1063701958 10:8393700-8393722 GCCAGCAGGGCATTGTTTTCAGG - Intergenic
1066327023 10:34371076-34371098 AACAGCATGGCATTGTTATAGGG - Intronic
1069415851 10:68200361-68200383 GACAACAAGACATTGTCATCTGG + Intronic
1081400672 11:42638494-42638516 GACAGCAGATCATTGTTTTTTGG - Intergenic
1082262910 11:50091002-50091024 GAAACCAGGACATTGGAATCAGG + Intergenic
1084620080 11:70263753-70263775 AACAGCGGGACATTTTTATTAGG + Intergenic
1091435814 12:472027-472049 GACAGCAGGCTGTTGTTATTCGG + Intronic
1092457923 12:8661152-8661174 GGCAGCAGGGCTTTGTTCTCAGG - Intronic
1097234976 12:57533246-57533268 GACAGCTGTACGTTGTGATCAGG - Exonic
1097479790 12:60108529-60108551 TACAGCAGGATATTATTAACTGG - Intergenic
1098163554 12:67670767-67670789 GACACATGGACATTGTTTTCAGG + Intergenic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1103441857 12:120968929-120968951 GACAGCAGGAGATTCTGACCAGG + Intergenic
1108315907 13:49237285-49237307 AAAAGCAGGACATTGTTAAAGGG + Intergenic
1110676507 13:78252655-78252677 GAGACCAGTAAATTGTTATCTGG + Intergenic
1112946797 13:104938212-104938234 GAGAGCAGAATGTTGTTATCGGG + Intergenic
1113026246 13:105944484-105944506 GACAGAAGTACATTTTTAACGGG - Intergenic
1113185007 13:107678225-107678247 GACAGGAGGACATGGTGAACGGG + Intronic
1113545895 13:111150040-111150062 AAGAGCAGCACATTGTGATCTGG + Intronic
1113791650 13:113032185-113032207 GACAGCAGGACAGGGTGCTCAGG - Intronic
1117536643 14:56709023-56709045 GACAACAGGACAATGTTTGCTGG - Intronic
1121266319 14:92604599-92604621 CCCAGGAGGAAATTGTTATCGGG - Intronic
1123116225 14:105895289-105895311 GACAGCAGGAGATGGTAATGTGG + Intergenic
1124035506 15:26050328-26050350 GAGAGCAGGGCAGTGTTAGCAGG - Intergenic
1125512932 15:40302551-40302573 TTCAGCAGGAAACTGTTATCAGG + Exonic
1130647582 15:85742393-85742415 GACAGCAGGAAATGGCTCTCAGG + Intronic
1136003058 16:27310864-27310886 GAAAACAGGGCATTGTTCTCGGG - Intergenic
1155591461 18:27432670-27432692 GCCAGCAGGACACAGTTCTCAGG + Intergenic
1163739038 19:18999489-18999511 CACAGCAGGACCTTGGTGTCAGG - Intronic
1164808212 19:31134139-31134161 GAGAGCAGGACATTTATGTCAGG + Intergenic
1167809244 19:51814227-51814249 AACATCAGGACATTGTCCTCCGG - Intronic
927621367 2:24663447-24663469 CACAGTAGTACATGGTTATCTGG + Intronic
929177350 2:38993759-38993781 GGCAGCATGACATTATTATGGGG - Intronic
930952593 2:57161362-57161384 GAAAGCAGGACAGTCTTATATGG - Intergenic
931160985 2:59690002-59690024 GACAGCAGAACACTCTTCTCTGG + Intergenic
936013163 2:108938545-108938567 TACAGCAGGACATTGGGATGAGG - Intronic
936483831 2:112909675-112909697 GGCAGCAGGCCATTGCTCTCAGG - Intergenic
937368442 2:121281833-121281855 GACAACTGGACACTGTTTTCAGG + Intronic
938342657 2:130545973-130545995 GGCAGCAGGCCCTTGTAATCAGG + Intronic
938347176 2:130574749-130574771 GGCAGCAGGCCCTTGTAATCAGG - Intronic
941676153 2:168345378-168345400 GACAGCAGGAAGTTGTTCTGGGG - Intergenic
942718068 2:178917481-178917503 TACACCAGGACATTGTATTCAGG + Intronic
943076358 2:183200365-183200387 AACAGTAGGACAGTGGTATCAGG + Intergenic
947725002 2:232392163-232392185 GACAGCAAAACATTGTAATGTGG - Intergenic
948176669 2:235948917-235948939 GACAGCATTCCAGTGTTATCTGG + Intronic
948714754 2:239853839-239853861 CACAGCAGGACATTTTGCTCGGG - Intergenic
1171391124 20:24802464-24802486 GAGACCATGCCATTGTTATCTGG + Intergenic
1171950716 20:31418993-31419015 GAAAGCAAGACATTGATCTCAGG + Intergenic
1174646823 20:52093437-52093459 GCCATCAGGAGATTTTTATCTGG + Intronic
1178123841 21:29496456-29496478 GACAGCAGGCCTCTGTTCTCAGG - Intronic
1179464229 21:41561125-41561147 GCCAGCAGGACACTGCTACCTGG - Intergenic
1182158569 22:28099078-28099100 AACAGCTGGACATTGGTTTCTGG - Intronic
1183606575 22:38870021-38870043 GATAGTAGGACTTTTTTATCTGG - Intronic
949844837 3:8358759-8358781 GAAAGCAGAACATTTTCATCTGG - Intergenic
949986343 3:9544305-9544327 GACAGCAGTTCATTGTTAAAGGG - Intronic
951411412 3:22372056-22372078 GACAGCAGGACGTCCTTACCGGG + Intronic
954082813 3:48222364-48222386 GACAGCAGGAGAGTGGCATCAGG + Intergenic
954286797 3:49625144-49625166 GACAGCAGGACACAGAGATCAGG + Exonic
954999636 3:54915475-54915497 GACAGAAGGACATTTTTATAAGG + Intronic
960032213 3:113065609-113065631 CACATCAGGACTTTGTTTTCAGG + Intergenic
964329720 3:155588953-155588975 GATATCAGGACATTTTTACCTGG - Intronic
964470095 3:157043430-157043452 CACAGAAGGACATTTTCATCTGG - Intronic
965804053 3:172524169-172524191 GACAGCGAGACATTGTGATGGGG - Intergenic
967035190 3:185643729-185643751 GACACCAGGATCTTGTTAGCTGG + Exonic
969292469 4:6248779-6248801 CTCAGCAGGACATTCTTCTCTGG + Intergenic
970558984 4:17264232-17264254 CACAGCAGGGCCTTGTTATTAGG + Intergenic
971236704 4:24848989-24849011 GACAGCAGTCCTTTCTTATCTGG - Intronic
977466988 4:97394906-97394928 GACAGCAAAACAATGTTTTCTGG - Intronic
977489715 4:97697143-97697165 TACAGCAAGACCTTATTATCTGG + Intronic
983358642 4:166699217-166699239 GACAGCAGGACATATTATTCTGG + Intergenic
987118518 5:14745281-14745303 GACAGCAGGACAGTGCTGACTGG + Intronic
989116798 5:37962619-37962641 GACAGCAGGACATGCTGTTCGGG - Intergenic
997534691 5:134610140-134610162 GACAGAAGGAAATTAATATCAGG + Intronic
1003877410 6:10450850-10450872 GAGAACAGGACATTGTTTTTGGG - Intergenic
1004285912 6:14320566-14320588 GACAGCATGACATTTTTAAAGGG - Intergenic
1008544861 6:52575994-52576016 GACACCAGGACATTGCTGTTGGG + Intronic
1011714714 6:90093126-90093148 GACAGCAGGTCTTTATTAACTGG + Intronic
1011903528 6:92331949-92331971 GAAAGAAGGACATTGTCTTCTGG + Intergenic
1016488893 6:144574064-144574086 GTCAGCAAGACATTTTTATGTGG + Intronic
1017075420 6:150613191-150613213 GACAGCAAGACTCTGATATCTGG - Intronic
1017077035 6:150628836-150628858 GACAGCACTACATTCTTACCTGG - Intronic
1018385769 6:163301535-163301557 GACAGCAGGACATTGTTATCTGG - Intronic
1022839892 7:34153774-34153796 GACAGCAGGAGATTGGTGACCGG + Exonic
1023502530 7:40865673-40865695 GAGAGCATGACAGTGTGATCGGG + Intergenic
1024200572 7:47102103-47102125 AACAGCGGCACATTGTTATATGG - Intergenic
1024661031 7:51495201-51495223 AACAGTGTGACATTGTTATCAGG - Intergenic
1028121488 7:87059946-87059968 GACATCAGGACATTGTTTTCTGG + Intergenic
1033268451 7:139909016-139909038 GACAGCAGGTTTTTTTTATCAGG - Intronic
1034391251 7:150789335-150789357 CACAGCAGGACATGGTAGTCGGG + Intergenic
1034473674 7:151270270-151270292 GACAGCAGGACAAGGTTGGCAGG + Intronic
1034685125 7:152963855-152963877 CACAGCAGTACATAGTTATAAGG - Intergenic
1036590712 8:10165536-10165558 GACAGCAGCACGTTGGTACCTGG + Intronic
1036747800 8:11422505-11422527 GACAGCAGTACATGGTCCTCAGG + Exonic
1038076235 8:24078095-24078117 AACAGCAAGACATTCTTAGCTGG + Intergenic
1039042356 8:33419729-33419751 GACTGCAGAACAATGTTTTCTGG + Intronic
1039166543 8:34687637-34687659 GTCAGAGGGACATTGTTCTCAGG + Intergenic
1040049531 8:42999339-42999361 TACAGCAAGACATTGGCATCTGG - Intronic
1046375949 8:113380851-113380873 CACATCAGGACATGGTTTTCTGG - Intronic
1047689013 8:127331545-127331567 GACACCAGGATATAGTTACCAGG + Intergenic
1048932866 8:139329587-139329609 GACAGCATGATATTGGTATAAGG - Intergenic
1049544326 8:143222386-143222408 GACATCAGGACATTATTTCCTGG - Intergenic
1049664401 8:143836645-143836667 GACACCAGGACATAGATGTCCGG + Intronic
1050756974 9:9016568-9016590 CACAGCAGGATATTCTTATGAGG + Intronic
1056838835 9:89981269-89981291 GAAATCAGGAAATTTTTATCTGG + Intergenic
1060870293 9:127034543-127034565 GACAGCAGCAGATTGCTCTCTGG - Intronic
1185572470 X:1145486-1145508 GCCAGAAGGACACTCTTATCAGG - Intergenic
1192092905 X:68179790-68179812 AAGAGCATGACATTGTCATCTGG + Intronic
1194262385 X:91712791-91712813 GACAGCTGGACATTTTTACTGGG - Intergenic
1195640392 X:107168444-107168466 GAGAGCAGGACATTCTAATAGGG - Intronic
1195726535 X:107923499-107923521 TCCAGGAGCACATTGTTATCTGG - Intronic
1200581678 Y:4957626-4957648 GACAGCTGGACATTTTTACTGGG - Intergenic