ID: 1018398056

View in Genome Browser
Species Human (GRCh38)
Location 6:163395959-163395981
Sequence CAGGGTCTGATGGGCTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018398046_1018398056 -5 Left 1018398046 6:163395941-163395963 CCCTGGGCCCTTCCGGACCAGGG No data
Right 1018398056 6:163395959-163395981 CAGGGTCTGATGGGCTGCTTGGG No data
1018398048_1018398056 -6 Left 1018398048 6:163395942-163395964 CCTGGGCCCTTCCGGACCAGGGT No data
Right 1018398056 6:163395959-163395981 CAGGGTCTGATGGGCTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018398056 Original CRISPR CAGGGTCTGATGGGCTGCTT GGG Intergenic
No off target data available for this crispr