ID: 1018400605

View in Genome Browser
Species Human (GRCh38)
Location 6:163415526-163415548
Sequence AGGGGGCGTCCGGCACCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018400605_1018400628 29 Left 1018400605 6:163415526-163415548 CCCGCCGGTGCCGGACGCCCCCT 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1018400628 6:163415578-163415600 CCAAGTTGGCGCGTTGCGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 13
1018400605_1018400618 3 Left 1018400605 6:163415526-163415548 CCCGCCGGTGCCGGACGCCCCCT 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1018400618 6:163415552-163415574 CGGCCGGGACCCCGCGCCGCTGG No data
1018400605_1018400625 25 Left 1018400605 6:163415526-163415548 CCCGCCGGTGCCGGACGCCCCCT 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1018400625 6:163415574-163415596 GCGTCCAAGTTGGCGCGTTGCGG 0: 1
1: 0
2: 0
3: 3
4: 20
1018400605_1018400623 15 Left 1018400605 6:163415526-163415548 CCCGCCGGTGCCGGACGCCCCCT 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1018400623 6:163415564-163415586 CGCGCCGCTGGCGTCCAAGTTGG 0: 1
1: 0
2: 0
3: 1
4: 36
1018400605_1018400626 28 Left 1018400605 6:163415526-163415548 CCCGCCGGTGCCGGACGCCCCCT 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1018400626 6:163415577-163415599 TCCAAGTTGGCGCGTTGCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018400605 Original CRISPR AGGGGGCGTCCGGCACCGGC GGG (reversed) Intronic
900166626 1:1246609-1246631 CGGGGGCGTCGGGGCCCGGCGGG - Exonic
900583975 1:3423607-3423629 AGCGGGCCACCGGCACCGGTCGG + Intronic
901696746 1:11013122-11013144 AGGCGACGGCCGGCACCGCCAGG + Intronic
902251018 1:15154140-15154162 CGGGAGCGTCCCGCGCCGGCGGG - Intronic
906653866 1:47533697-47533719 AGGGGGCGGCGGGCCGCGGCAGG + Intergenic
907069209 1:51519010-51519032 AGGGGGGCTCCGGCTCCGGAGGG + Intronic
912800790 1:112718806-112718828 AGAGGACATCCGGCACCCGCAGG - Intergenic
914803027 1:150974380-150974402 AGGGAGCGGCCGGGGCCGGCGGG - Intronic
917817336 1:178724898-178724920 GTGGGGCGTCCGCCACCGCCTGG - Intergenic
920002062 1:202807437-202807459 AGGGGGCGGCCAGCGCTGGCTGG - Intronic
1065019983 10:21495833-21495855 CGGAGGCGCCCGGCACCTGCAGG + Exonic
1069753199 10:70757979-70758001 AGAGGGCATCCAGCAGCGGCAGG + Exonic
1073578281 10:104642352-104642374 AGGGGGAGCCCGGCAGCCGCAGG - Intronic
1077360771 11:2139338-2139360 AGGGGGGGGCCGGGGCCGGCCGG + Intronic
1079284494 11:19116974-19116996 GGGGAGCGACCGGCACGGGCGGG + Intergenic
1083272825 11:61580747-61580769 CTGGGGCGCCCCGCACCGGCGGG - Intronic
1083635020 11:64116235-64116257 TGGGGGCGTCCGGCCCCACCTGG - Exonic
1084150427 11:67285623-67285645 AGAGGGCGCCGGGCAGCGGCTGG - Exonic
1097855769 12:64460537-64460559 AGGGGGCGGCCGGCTGCGGCTGG + Intronic
1100391562 12:94149312-94149334 AGGGGGCGGCCGGCCTCGGGGGG + Exonic
1101640065 12:106581400-106581422 AGGCGGCGCGCGGTACCGGCTGG - Intronic
1104862300 12:131929941-131929963 TGGGGGCATGCGGCTCCGGCGGG - Exonic
1104906321 12:132215362-132215384 ACGCGGCGCCCGGCACCGCCTGG + Intronic
1104943326 12:132404899-132404921 AGGGGGCGTGCAGAGCCGGCGGG + Intergenic
1111396263 13:87672520-87672542 GGGGGGCGTTCTGCAGCGGCGGG - Intergenic
1113494010 13:110713890-110713912 AGGGGGCCTGCGCCGCCGGCCGG + Intronic
1120810025 14:88793202-88793224 AGGGACCGTGCGGAACCGGCAGG - Intergenic
1122153606 14:99737703-99737725 AGGCAGCGTCCCGCCCCGGCCGG - Intronic
1122716413 14:103699249-103699271 AGGTGGCCTCCGGCTCCTGCGGG - Intronic
1123921250 15:25071337-25071359 TGGGGCCATCCGGCAACGGCGGG - Intergenic
1128648671 15:69395138-69395160 AGGGGGCGGCCTGCCGCGGCAGG + Intronic
1129644713 15:77419759-77419781 AGGGGGCGCGCGGCACCGGCGGG + Intronic
1129885140 15:79032102-79032124 AGGTGGCGTCCGGCCCTGCCTGG - Exonic
1132741451 16:1415099-1415121 AGGGGGAGCCAGGCACCGGGCGG + Intergenic
1141968135 16:87461091-87461113 TGGGGGCGGCCGTCACCTGCAGG - Intronic
1147392907 17:40121568-40121590 AGGGGCCGCCCGGCGCAGGCCGG + Intergenic
1147648822 17:42050506-42050528 AGGGGGCGTCCAGCCCGGCCTGG + Intronic
1152627406 17:81393889-81393911 AGCGGGCGGCCGGCCCCGGCCGG - Intergenic
1160223829 18:76997328-76997350 AGGTGGCGTCAGGCCCGGGCTGG - Intronic
1160930379 19:1567360-1567382 GCGGGGCGTCCGGCGCGGGCTGG + Intronic
1161153465 19:2721119-2721141 AGGGGCCGGCCGGGCCCGGCGGG + Intronic
1161324255 19:3655883-3655905 AGGGTGCGTCAGGCCCCGGGAGG - Intronic
1161343298 19:3754169-3754191 AGGGGGCGGCCGGGGCCGGGCGG - Intronic
1162031722 19:7920489-7920511 CGGTGGCGTCCGGCTCCGGCTGG - Exonic
1162125636 19:8498348-8498370 TGAGGGCGGGCGGCACCGGCAGG - Intronic
1163677057 19:18660514-18660536 AGGGGGCGGCCGGCACGGCGGGG - Intronic
1165157041 19:33795465-33795487 AGGGGGCGTCCAGGCCCGGCCGG + Intergenic
1165468606 19:35989966-35989988 AGGGGCCATCCGGCACATGCAGG - Intergenic
1168401678 19:56088976-56088998 AGGGGGCGGGCGGCCGCGGCCGG + Exonic
925036731 2:692708-692730 CTGGGGCCTGCGGCACCGGCTGG + Intergenic
932440369 2:71731081-71731103 CAGGGGCGCCCGGCGCCGGCCGG - Intergenic
933593628 2:84260801-84260823 AGTGGGCTTCCTGCACCGGATGG - Intergenic
946024536 2:216664112-216664134 CAGGGGCGCCAGGCACCGGCTGG - Exonic
1171517204 20:25747165-25747187 AGGGGGCGTCCTGCCCAGGAGGG - Intergenic
1174343838 20:49915304-49915326 AGGGGGCGCCAGACAGCGGCAGG - Intronic
1176289490 21:5036585-5036607 AGGGGGCTTCAGGGACCAGCAGG - Intronic
1179867740 21:44227002-44227024 AGGGGGCTTCAGGGACCAGCAGG + Intronic
1181166245 22:20984771-20984793 AGGGGGCACCCAGCACAGGCTGG + Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183386647 22:37519086-37519108 CGAGGGCGTCCGGCATCGGCTGG - Exonic
1183715765 22:39532648-39532670 AGGGGACGTCCGGCGCGGGCAGG - Intronic
1183862427 22:40679630-40679652 AGCAGGCGACCGGCACTGGCTGG + Exonic
1184033374 22:41907460-41907482 AGGGTGCGCCAGGCACCGGAAGG - Intergenic
1185057376 22:48588020-48588042 AGGGGGCTCCTGGCACCTGCAGG - Intronic
950108951 3:10406211-10406233 AGGGGGCATCCAGCCCAGGCTGG + Intronic
952866003 3:37855564-37855586 AGGGGGCGGGCTGCACCTGCTGG + Intergenic
964743229 3:159988750-159988772 ACGGGGCGTCCGGCTAAGGCCGG + Exonic
968551366 4:1225394-1225416 AGGTGGCGTCCGGCGCTGCCAGG - Exonic
968756362 4:2418253-2418275 GGGGGGCGTCCGGCCCGAGCGGG + Intronic
968920005 4:3517620-3517642 AGCGGGCGTCCTGCCCCTGCCGG + Intronic
969912168 4:10457087-10457109 GGTGGGCGTGGGGCACCGGCTGG - Intronic
972726792 4:41751810-41751832 AGGGGGCGCCCGGCAGCAGGGGG - Intergenic
976178000 4:82373755-82373777 AGCGGGCGCGCGGCAGCGGCGGG - Exonic
984246285 4:177278737-177278759 AGGGGGCGTGGGGCACAGGATGG - Intergenic
985678636 5:1244835-1244857 ATGGGTCGTCGGGCACCGGATGG - Intronic
992866358 5:80960619-80960641 AGGGGGCGCCCTTCGCCGGCCGG + Intergenic
993386552 5:87268574-87268596 AGGGGGCGGCTGCCACAGGCAGG - Exonic
1003603897 6:7542340-7542362 AGGGGGCGTCGGGCCCGCGCGGG + Intronic
1006336986 6:33425979-33426001 CGGGGGCGTCGGGGAGCGGCGGG + Intronic
1006447637 6:34088803-34088825 AGGGGGTGTCTGGCCCAGGCAGG + Intronic
1006706317 6:36024427-36024449 GGGCTGCGTCCGTCACCGGCAGG - Intronic
1006803604 6:36774805-36774827 AGGGGGTGCCCTGCACAGGCTGG - Intronic
1012245762 6:96924421-96924443 AGGGTACTTCCGGGACCGGCGGG + Intergenic
1015843924 6:137498132-137498154 AGTGGGCGTCGGGCACCGAGCGG - Intergenic
1018400605 6:163415526-163415548 AGGGGGCGTCCGGCACCGGCGGG - Intronic
1019122598 6:169814640-169814662 AGGGGTCCTCCTGCACCTGCAGG + Intergenic
1019313242 7:372935-372957 AGGTGGTGTCCGGCACCTTCTGG - Intergenic
1022363317 7:29684848-29684870 CGGCGGCGGCCGGCACCGGCCGG - Intergenic
1022428008 7:30285729-30285751 CGGCGGCGGCCGGGACCGGCCGG + Exonic
1022698069 7:32728912-32728934 CGGCGGCGGCCAGCACCGGCCGG + Intergenic
1029729783 7:102431874-102431896 AGGGACCGTCTGGCACCGCCGGG + Intergenic
1034468887 7:151245473-151245495 CGGGGGCGGTGGGCACCGGCTGG + Exonic
1035021635 7:155804128-155804150 AGGGTGCGCCCGGCGCCCGCGGG - Intronic
1039996720 8:42541178-42541200 AGGAGGCGCCCGGCACTCGCAGG + Exonic
1049356278 8:142190103-142190125 AGGCAGCTTCAGGCACCGGCTGG + Intergenic
1049738823 8:144224770-144224792 AGGGGGTGAGCGGCAGCGGCAGG + Intronic
1060222770 9:121773317-121773339 GGGGGGCGTCCGGCCGCGGGGGG - Exonic
1061004734 9:127922044-127922066 TGGGGGCGTCGGGCAGCAGCCGG + Exonic
1061996674 9:134189720-134189742 AGTGGGCGTCCGGCGCAGGGTGG + Intergenic
1062580582 9:137227618-137227640 AGGAGGCGTCTGGCACTGTCTGG + Exonic