ID: 1018401684

View in Genome Browser
Species Human (GRCh38)
Location 6:163428090-163428112
Sequence ATGTTCTCCTTTAAATTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018401683_1018401684 -10 Left 1018401683 6:163428077-163428099 CCAGAATAGGAAAATGTTCTCCT 0: 1
1: 0
2: 0
3: 14
4: 239
Right 1018401684 6:163428090-163428112 ATGTTCTCCTTTAAATTGTAAGG 0: 1
1: 0
2: 1
3: 16
4: 319
1018401681_1018401684 -2 Left 1018401681 6:163428069-163428091 CCCTTTTGCCAGAATAGGAAAAT 0: 1
1: 0
2: 3
3: 23
4: 453
Right 1018401684 6:163428090-163428112 ATGTTCTCCTTTAAATTGTAAGG 0: 1
1: 0
2: 1
3: 16
4: 319
1018401682_1018401684 -3 Left 1018401682 6:163428070-163428092 CCTTTTGCCAGAATAGGAAAATG 0: 1
1: 0
2: 2
3: 108
4: 1076
Right 1018401684 6:163428090-163428112 ATGTTCTCCTTTAAATTGTAAGG 0: 1
1: 0
2: 1
3: 16
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018401684 Original CRISPR ATGTTCTCCTTTAAATTGTA AGG Intronic
900904591 1:5544522-5544544 TTGTTGTTCTTTAAGTTGTAGGG - Intergenic
903284272 1:22267405-22267427 ATGTGCTCCTGGAAATTGTCCGG - Intergenic
904191086 1:28744309-28744331 ATCTTCTGCTTTAATTTCTATGG - Intronic
905681837 1:39878440-39878462 TTGTCCTGCTTTAAAATGTAGGG - Intronic
906422487 1:45681998-45682020 ATCTACTTCTTTAAATAGTAAGG + Intronic
909224713 1:73004723-73004745 ATATTCTCTAGTAAATTGTAAGG - Intergenic
909279845 1:73735903-73735925 ATATTCTCCCTTAGATTTTATGG + Intergenic
909443538 1:75724144-75724166 AAATTCTCTTTTAAATTTTAAGG + Intergenic
911701278 1:100954985-100955007 AAGTTTTCCTATATATTGTAGGG - Intronic
912075271 1:105866659-105866681 ATCATCTACTTGAAATTGTAAGG - Intergenic
914226841 1:145727525-145727547 ATCTTTTCCTTTAAGTTGTCTGG - Intronic
914359023 1:146914293-146914315 ATATTTTCCTTTAGATTCTATGG + Intergenic
914494722 1:148185583-148185605 ATATTTTCCTTTAGATTCTATGG - Intergenic
914870272 1:151467865-151467887 ATGTCAACCTTTAAATTGAAGGG - Intergenic
916523861 1:165590916-165590938 CTCTTCTCCAATAAATTGTAAGG + Intergenic
916551598 1:165855062-165855084 ATTTTCAGCCTTAAATTGTAAGG + Intronic
917040983 1:170806196-170806218 ACATTCTCCTTTCCATTGTAGGG - Intergenic
917116835 1:171611814-171611836 ATTTTGTCCTTTAATTTGCAGGG + Intergenic
917382910 1:174434465-174434487 ATGTTTTCCTTTCTATTGGAAGG + Intronic
918597730 1:186311418-186311440 ATTTTCTCTTTTAAATTATCAGG + Exonic
918982293 1:191578725-191578747 AGGTTTTCCTTTAAAATGAAAGG - Intergenic
919618041 1:199831782-199831804 ATGTTTTTTTTTAAATTGGAAGG + Intergenic
920766996 1:208842961-208842983 TTGCTCTCCTTTTGATTGTAAGG - Intergenic
921229435 1:213053414-213053436 ATGTTTTCCTCTTCATTGTACGG + Intronic
1063162936 10:3432793-3432815 ATTTTCCCCTTTAATTTGTCAGG + Intergenic
1063238506 10:4144100-4144122 ATTTTCTCATATAAATTTTATGG + Intergenic
1066976921 10:42377639-42377661 ATGTTCTTCTATACAATGTAAGG + Intergenic
1068304991 10:55197253-55197275 TTTTTCTCTTTTAATTTGTAAGG - Intronic
1068553156 10:58428306-58428328 TTATTATCCTTTAAATTCTAGGG + Intergenic
1068877627 10:62013821-62013843 ATTTTCTCTTTTAATTTTTATGG + Intronic
1072906086 10:99455396-99455418 CTGTTCTCCTTTAATTTGGGTGG - Intergenic
1072939577 10:99748545-99748567 CTGTTCTGCACTAAATTGTAAGG - Intronic
1073392188 10:103188439-103188461 ATATTCTTCTGTAAATTGTATGG - Intronic
1073719180 10:106146897-106146919 ATGTTTTCCTTTTTGTTGTATGG - Intergenic
1078295820 11:10069175-10069197 ATATTCTACTTTAAGTTCTAGGG + Intronic
1079916384 11:26372951-26372973 ATGTTATCCTTTATATTTTTGGG - Intronic
1079952431 11:26821672-26821694 ATATTTTCCTTAAAATTTTATGG - Intergenic
1081928037 11:46846787-46846809 AACTCCTCCATTAAATTGTAAGG - Intergenic
1082641556 11:55667234-55667256 ATGTTCTCCTTTGATAAGTAAGG + Intergenic
1083383309 11:62286736-62286758 ATGTTCTTCTATACAATGTAAGG + Intergenic
1085240442 11:75049652-75049674 ATGTTCTTCTATACAATGTAAGG + Intergenic
1086781469 11:90911611-90911633 ATGTTCTTCTGGAAGTTGTATGG + Intergenic
1086842297 11:91701890-91701912 ATTTTCTTTTTTAAATTGGAAGG - Intergenic
1087128458 11:94648639-94648661 ATTTTCTCCTCAAAATTCTAGGG + Intergenic
1087659766 11:100973539-100973561 GTTTTCTTCTTTACATTGTATGG + Intronic
1088181372 11:107116328-107116350 ATATGCTCATATAAATTGTAAGG - Intergenic
1089829354 11:121311911-121311933 ATTTTCACCTTAAAATTGGAGGG + Intergenic
1090069991 11:123535721-123535743 ATGTTCATCTTTACACTGTATGG - Intronic
1090180942 11:124698900-124698922 AAGTTCTCTTTTAAACTTTATGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1093770127 12:23008607-23008629 ATATACTCTTTTAAATTGAAAGG - Intergenic
1094095218 12:26696436-26696458 AAGTTATCATTTAAAATGTAAGG + Intronic
1094251958 12:28371942-28371964 ATTTTCTTCTTCAAATTTTATGG + Intronic
1097479325 12:60101404-60101426 ACCTTCTGCTTTAAATTCTAGGG + Intergenic
1097566592 12:61277943-61277965 ATTTTCTCTTTGAAATTGTGGGG - Intergenic
1097768612 12:63553765-63553787 ATGTTCTCATTTAACAGGTAAGG + Intergenic
1097875446 12:64638620-64638642 ATGTTTTCTTTTAAACTGGATGG - Intronic
1098131169 12:67351925-67351947 ATGTTCCCCTTTGAATGGGAAGG + Intergenic
1098759960 12:74410947-74410969 ATGTCCTCCTTTAACTTTTTAGG - Intergenic
1099943161 12:89214265-89214287 ATGTTGTACTTTAAATGTTATGG - Intergenic
1101450841 12:104777477-104777499 TTTTCCTCCATTAAATTGTAAGG + Intergenic
1102715247 12:114965297-114965319 CTGTTCTTTTTTAAATTTTAGGG + Intergenic
1103069041 12:117925486-117925508 ATCTTCTCCTTTAAAGAGTAAGG - Intronic
1106908454 13:34435459-34435481 ATGTCCTTATTAAAATTGTATGG - Intergenic
1108983482 13:56551058-56551080 ATTTTCTTCTGTAAATTTTAAGG + Intergenic
1109580480 13:64325747-64325769 ATGTTCTCTAGTAAATTATATGG + Intergenic
1109730374 13:66405466-66405488 ATGTTCTCCTTGAAATCCTTTGG - Intronic
1111310125 13:86473238-86473260 ATATTTTCCATTAAATTGAAGGG + Intergenic
1111546412 13:89742976-89742998 ATGTTCTCCCATAAATTGAAGGG - Intergenic
1111627102 13:90802709-90802731 ATGTTCTTCTTTAGACTGCATGG + Intergenic
1111952721 13:94722527-94722549 ATGTCCTCATTTAAAATGTTTGG - Intergenic
1112130013 13:96513059-96513081 ATCTTTTCCTTGAAATTCTATGG + Intronic
1112728438 13:102331793-102331815 CTTTTCTCATTTATATTGTAAGG - Intronic
1112888389 13:104202451-104202473 TTGCTCTTCTTTAAATTTTATGG + Intergenic
1114976008 14:28100209-28100231 ATGTAGTCCTTTATATTATATGG + Intergenic
1116296168 14:43113271-43113293 ATTTTCTTTTTTAATTTGTAAGG - Intergenic
1116373815 14:44171734-44171756 ATGTTATGCTTTAAGTTCTAGGG + Intergenic
1117665637 14:58053232-58053254 ATGTTCTCCTTGAATTTTAAAGG - Intronic
1117748439 14:58895647-58895669 AAGTTCTCCTTGAACTTGGAAGG - Intergenic
1119108326 14:71945950-71945972 ATTTTCTCCTTAAACTTCTATGG + Intronic
1119128841 14:72153307-72153329 ATGTTCTGCTTTAAACTCTGTGG - Intronic
1202846865 14_GL000009v2_random:185749-185771 TTGTTATACTTTAAGTTGTAGGG - Intergenic
1124012820 15:25852334-25852356 GTGTTCTTATTTAAATTGGAGGG - Intronic
1125319022 15:38462431-38462453 TTGTTCAGCTTTAATTTGTAGGG - Intronic
1125865825 15:43047785-43047807 ATATTCTCCTTTTACATGTAAGG - Intronic
1126658409 15:51006192-51006214 ATGTTCTGCTTTAAATGCTCTGG - Intergenic
1127860610 15:62990414-62990436 ATGTGCTCCATTAAATAGGAAGG - Intergenic
1129218363 15:74115328-74115350 TTGTTTTCCTTTAAATAGTGAGG - Intronic
1129405981 15:75318249-75318271 TTGTTTTCCTTTAAATAGTGTGG + Intergenic
1130791217 15:87158181-87158203 CTCTACTCCTTTTAATTGTAAGG + Intergenic
1131896796 15:97042015-97042037 TTGTTCTTTTTTAATTTGTATGG - Intergenic
1135907631 16:26527775-26527797 ATGAGCTCCTTTAACCTGTAAGG - Intergenic
1137902647 16:52285794-52285816 ACGTTCTCCTCTATAATGTATGG + Intergenic
1138366113 16:56479089-56479111 ATGTTCACCTGTAAAATATATGG + Exonic
1139068360 16:63347877-63347899 ATGTGCACCTTTAAATCATATGG + Intergenic
1140019951 16:71229285-71229307 TTATTCTCCTTTAAGTTCTAGGG - Intronic
1140248065 16:73269194-73269216 ATTCTCCCCTTTAAAGTGTATGG + Intergenic
1140574858 16:76155943-76155965 ATTTTCTCCTTAAAATTTTGGGG + Intergenic
1140771555 16:78209681-78209703 ACATTCTCCTTTAACCTGTAAGG - Intronic
1144765165 17:17728600-17728622 AGCTTCTCCTTTGAATTTTAGGG + Intronic
1144798657 17:17910517-17910539 AGGTTCTACTTTGAATGGTATGG + Intronic
1150537500 17:66058235-66058257 ATATTCTAGTTTAAATTGTCAGG - Intronic
1153152803 18:2113776-2113798 ATGTTCTCCTGTGAATTGGGGGG + Intergenic
1153401306 18:4686637-4686659 TTATTATACTTTAAATTGTATGG - Intergenic
1153402921 18:4700780-4700802 ATATTATACTTTAAATTCTAGGG - Intergenic
1155107010 18:22677084-22677106 AGGATCTCCTTTAAATTTAATGG + Intergenic
1155220747 18:23683485-23683507 CTATTCTCTTTTAAATTGCATGG - Intergenic
1155660130 18:28239589-28239611 ATTTTCTTCATTAAATTGAAGGG - Intergenic
1155688566 18:28586761-28586783 ATGTTCTACTTTAAATTAATAGG - Intergenic
1156147056 18:34195581-34195603 ATGTTTTCCTTTAAGTTTCAAGG + Intronic
1156555568 18:38063855-38063877 CTGTTCTCCTTTATGTTGTATGG - Intergenic
1158879071 18:61759090-61759112 ATGTTCTCCTTTATTTTACAGGG - Intergenic
1158955809 18:62537017-62537039 ATTTTCTCCTTTTTAGTGTACGG + Intronic
1159314223 18:66750503-66750525 ATGTTCTCCCTTATATTAAAAGG + Intergenic
1159848746 18:73500280-73500302 ATGTTCTGATTTAAAATGGAGGG - Intergenic
1160124768 18:76161639-76161661 AGGTGCTCCTATAAATTGTATGG - Intergenic
1164190244 19:22909233-22909255 ATGTTGACCTTAAAATTTTAGGG + Intergenic
1164876146 19:31691757-31691779 ATGTTCACCTTTAAACTCAAGGG + Intergenic
926350066 2:11986132-11986154 ATGTTCTCATTTGAAAAGTAAGG + Intergenic
927492214 2:23528147-23528169 ATGTTTCCTTTTAAATTGTAGGG - Intronic
927774694 2:25893455-25893477 ATGTCCTCATATAAATTGTCTGG - Intergenic
928604959 2:32937038-32937060 ATGTGCTCATGTAAATTGTCTGG + Intergenic
928747181 2:34428850-34428872 ATTCCCTCCTTTAATTTGTAAGG - Intergenic
930286268 2:49432048-49432070 TTTTTATCCTTTAAGTTGTAAGG - Intergenic
931196508 2:60057008-60057030 ATGTCCTCATTTATAATGTAAGG - Intergenic
933116020 2:78472790-78472812 AAATACTCCTTTAAATTTTAGGG + Intergenic
933448082 2:82408429-82408451 ATGTTCTGCTTTAAATATTGAGG + Intergenic
933848220 2:86343511-86343533 ATTTTCTCCTTCAAGTTGAAAGG + Intergenic
933976211 2:87513728-87513750 ATGTTCAACATTGAATTGTATGG + Intergenic
935517589 2:104061368-104061390 TTGTTGTACTTTAAGTTGTAGGG + Intergenic
936317611 2:111437078-111437100 ATGTTCAACATTGAATTGTATGG - Intergenic
936694859 2:114934045-114934067 AAGTTCACCATTAAAATGTAGGG + Intronic
936717818 2:115210032-115210054 ATATTATACTTTAAATTCTAGGG + Intronic
937575922 2:123421975-123421997 ATTTTCTCCTTTAACATGAATGG + Intergenic
937775347 2:125769388-125769410 TTGTTATACTTTAAATTTTAGGG - Intergenic
937817534 2:126269458-126269480 ATGATCTCATTTATATTGAATGG + Intergenic
938508234 2:131909650-131909672 ATGCTCTCCTTTCAATTTTAAGG - Intergenic
939323675 2:140658105-140658127 ATGTTTTACTTAAAATAGTATGG - Intronic
939539520 2:143475897-143475919 TTATTTTCCTTTAAATTGCAAGG + Intronic
939706783 2:145464617-145464639 CTGTTAACCTTTAAAATGTATGG + Intergenic
939903277 2:147877497-147877519 ATGTTCTTCATGAATTTGTATGG - Intronic
940463705 2:154001793-154001815 ATGTTTTCCTTTCAAATGGAAGG + Intronic
940959074 2:159761944-159761966 ATGAGCCCCTTTAAATTGTCAGG + Intronic
941127370 2:161600804-161600826 ATATTCTGATTTAAATGGTAAGG + Intronic
942125490 2:172821148-172821170 AAGTTCTCAGGTAAATTGTATGG + Intronic
943453041 2:188069764-188069786 ATGGTCTCATTTAATTTTTATGG + Intergenic
944355010 2:198777411-198777433 ATATTTTCATTTAATTTGTATGG - Intergenic
944462766 2:199969088-199969110 ATGTTTTCCTTTAACTTGCTGGG + Intronic
945649659 2:212541306-212541328 ATATTTTCGCTTAAATTGTAGGG + Intergenic
945855404 2:215063524-215063546 ATGTTCTACTTTATGGTGTAAGG - Intronic
946538224 2:220655331-220655353 ATGTTCTACTTTTAATTCCAGGG - Intergenic
946630213 2:221658996-221659018 ATCTTCTTCTATAAATTCTAAGG - Intergenic
946920267 2:224573309-224573331 CTTTGCTACTTTAAATTGTAAGG - Intronic
947177818 2:227385064-227385086 ATGATCTCATTTAAATGGTACGG + Intergenic
1169509757 20:6250688-6250710 ATGTCCACCTCTAGATTGTAAGG + Intergenic
1172987256 20:39001792-39001814 ATGTTCTCCCTTCCACTGTAAGG - Exonic
1173546050 20:43899089-43899111 GTGTTCTCTTTTATACTGTATGG - Intergenic
1177294162 21:19153366-19153388 ATGTTTTTTTTTAAATAGTACGG - Intergenic
1177357243 21:20024646-20024668 ACCTCCTCTTTTAAATTGTATGG - Intergenic
1177875146 21:26623893-26623915 AGGGTTTCCTTTCAATTGTAAGG - Intergenic
1178202955 21:30428769-30428791 ATTTTCTCAATTAAAATGTATGG - Intergenic
1179324793 21:40331648-40331670 ATGTCCTCCTTCAAATTGAAGGG - Intronic
1180237844 21:46475164-46475186 AAGTTCTCCTTTCAGTTGCAAGG + Intronic
1182901849 22:33904919-33904941 CTGATGTCCTTTAAATTTTATGG + Intronic
1184619847 22:45668787-45668809 ATGATCTCCTTTAAATGATCGGG + Intergenic
1203289363 22_KI270735v1_random:18489-18511 ATGTTTTGCTTTAAGTTGTTAGG + Intergenic
950260432 3:11539484-11539506 CTGTTCTCCTTAAAATGGTTGGG + Intronic
950291726 3:11790013-11790035 TTGTTCTCCACTAAAGTGTATGG - Intergenic
951737295 3:25882103-25882125 ATATTCTTCTTTCACTTGTAAGG + Intergenic
953301412 3:41780394-41780416 ATGTTATCTTTTATATTTTAGGG + Intronic
954987440 3:54808185-54808207 TTATTATACTTTAAATTGTAGGG - Intronic
955008000 3:54987737-54987759 ATGGGCTCCTTTAAAAGGTAAGG + Exonic
955828645 3:62977297-62977319 AGAGTCTCCTTTAGATTGTATGG - Intergenic
957695611 3:83635298-83635320 ATGTTTTAATTTAAAATGTATGG - Intergenic
957872759 3:86109802-86109824 ATCTGGTCCTTTAAATTGTTGGG - Intergenic
957931984 3:86891857-86891879 ATGTTCTCTTTAAAATTATTGGG + Intergenic
958189646 3:90168950-90168972 ATGTCTTCCTTCAAATTCTATGG - Intergenic
958411964 3:93828511-93828533 ATGTCTTCCTTCAAATTCTATGG - Intergenic
958672543 3:97223086-97223108 AAGATCTCCTTTAATTTCTATGG - Intronic
958725342 3:97898701-97898723 ATTTTTTCCTTTAAACTATATGG + Intronic
959433248 3:106281783-106281805 ATGTTATCATCTAAATAGTAAGG - Intergenic
962304039 3:134270248-134270270 ATGCTCTCCTTAAATGTGTAAGG + Intergenic
962390129 3:134964510-134964532 AGCTTCTCATTGAAATTGTATGG + Intronic
962447765 3:135483475-135483497 ATATCGTCCTTTAAATTGCAAGG + Intergenic
963136156 3:141906756-141906778 CTTTTGTCATTTAAATTGTATGG - Intronic
963367856 3:144362044-144362066 ATTTTCCCATTTAAATTCTAAGG - Intergenic
964042365 3:152276905-152276927 ATGTCCTCCTTTTCATTCTAGGG - Intronic
964923141 3:161922951-161922973 ATGTTCTGATTTAATTTGTTTGG + Intergenic
965513964 3:169600730-169600752 TTGCTCTCCTTTAAAAAGTATGG + Intronic
965853032 3:173053742-173053764 TTGTTCTCTTCTAAATTGTCAGG - Intronic
970251500 4:14121026-14121048 GTGTTCTCATTTACATTGTCAGG - Intergenic
970916908 4:21346595-21346617 GTGTTATCTTTTAAATTTTAAGG + Intronic
972052852 4:34761937-34761959 TTGTTCTCTTTTAAAACGTATGG - Intergenic
972225704 4:37008736-37008758 GAGTTCTCCTTTAAGTTGTTGGG - Intergenic
973034126 4:45384182-45384204 ATGTACTCCGTTAAATTATGTGG - Intergenic
975105121 4:70559168-70559190 ATTTTCTCCTTTAAACTTTCTGG + Intergenic
975738088 4:77401313-77401335 ATGTTCTCCTTGAGTATGTAGGG + Intronic
975844247 4:78508165-78508187 GTGTTTTCCTCTTAATTGTAAGG - Intronic
975919609 4:79369579-79369601 ATATTGTCCCTTAAATTCTAAGG + Intergenic
975970527 4:80029343-80029365 TTTTTCTGCTTTAAATAGTATGG + Intronic
976976526 4:91171916-91171938 ATGTTCTCTTTTAAATATTCAGG + Intronic
977813917 4:101391321-101391343 ATTTTCTCCTAGAATTTGTATGG - Intergenic
978235752 4:106457244-106457266 ATGTTCTCTTTGGACTTGTAGGG - Intergenic
979101965 4:116629138-116629160 ATGTTTTCCTATAAATTATTAGG - Intergenic
979862939 4:125717098-125717120 ATATATTCCTTTAACTTGTATGG - Intergenic
980718321 4:136657919-136657941 ATCTTCACATTTAAAGTGTAGGG - Intergenic
981156579 4:141443828-141443850 ATAATCACCTTTAAATTGTTTGG - Intergenic
981164933 4:141546419-141546441 AAGTACTCCTTTAAATGGAAGGG + Intergenic
981815987 4:148831054-148831076 GTGTTCTCCTATAAATTCTGTGG + Intergenic
981849413 4:149211400-149211422 GTTTTCTCCTAAAAATTGTATGG - Intergenic
983148883 4:164252133-164252155 AAACTCTCCTTTTAATTGTATGG - Intronic
983156871 4:164358941-164358963 ATGTTTTTCTTTAAAATATATGG + Intronic
983440465 4:167777217-167777239 TTATTATCCTTTAAATTCTAGGG + Intergenic
983963392 4:173781087-173781109 ATGTTATACTTTAAGTTTTAGGG - Intergenic
983973227 4:173899917-173899939 ATGTTTTCCTTTAGAGTGTAAGG + Intergenic
986483796 5:8215196-8215218 ATGTTTTCCTTTAAAAGTTAAGG + Intergenic
986724825 5:10586559-10586581 ATGTCCTCTTATAAACTGTATGG - Intronic
987576464 5:19734654-19734676 ATGTTCTCCTTTAATGTTTAGGG + Intronic
987856809 5:23429983-23430005 ATGTTTTCCTTTCTATTGTGGGG + Intergenic
989023105 5:37033599-37033621 AAGTTCTCCTTTAATCTATATGG - Intronic
989791791 5:45412883-45412905 TTGTTCTCCTTTTAATTGGAGGG - Intronic
990103568 5:52225770-52225792 ATATTTTCCTTTAAAATGTAAGG - Intergenic
990773156 5:59273785-59273807 ATTTTTTGTTTTAAATTGTATGG - Intronic
990918740 5:60938817-60938839 ATGTCCTTCTTTAAAATGTTTGG + Intronic
991112981 5:62922863-62922885 ATCTTTTCCTTTAATTTGGAGGG + Intergenic
991523402 5:67527630-67527652 AAGTTCTCCTATTAATTTTAAGG + Intergenic
991938840 5:71830600-71830622 TTGTTCTCCTTTGTATTATAAGG - Intergenic
993335038 5:86646534-86646556 AAGGTCTCCTTGAAAGTGTATGG + Intergenic
993372109 5:87105605-87105627 ATTTTCTCCTTACAAATGTATGG + Intergenic
993835166 5:92810982-92811004 ATTTTCTCCTTAAAAGGGTATGG + Intergenic
994835219 5:104843494-104843516 ATGTTATCTTTTAATTTCTATGG - Intergenic
995219535 5:109632585-109632607 ATATTCTCCTTAATATGGTAGGG - Intergenic
995542010 5:113194889-113194911 ATGTTCTCTTTTTGATTTTATGG - Intronic
995690106 5:114816261-114816283 ATGTTATACTTTAAGTTCTAGGG + Intergenic
995860654 5:116636998-116637020 ATGTACTCATTTAAATTTTACGG + Intergenic
995984226 5:118148672-118148694 TTATTCTACTTTAAATTCTAGGG - Intergenic
996260677 5:121463902-121463924 ATGTTTTTCTAAAAATTGTATGG + Intergenic
997722024 5:136086479-136086501 ATTTTCTCCTAGAAGTTGTATGG - Intergenic
998921356 5:147071697-147071719 GTGTTCTCTTTTAAATAGGATGG - Intronic
1000690432 5:164312061-164312083 ATATGCTGTTTTAAATTGTATGG + Intergenic
1002818893 6:704406-704428 ATATCCTACTTTACATTGTAGGG - Intergenic
1002818979 6:705889-705911 AATTTCTACTTTAAAATGTAAGG - Intergenic
1003028662 6:2581009-2581031 ATGTACCCCATTAAGTTGTAAGG + Intergenic
1004067174 6:12259115-12259137 CTGTATTTCTTTAAATTGTATGG + Intergenic
1004150164 6:13111051-13111073 ATGTTCTTATTTGAATTGTGGGG - Intronic
1005079981 6:21947063-21947085 ATGCTGTCCTATACATTGTAGGG - Intergenic
1005514836 6:26544131-26544153 ATTCTCTTCTTTAAACTGTAGGG - Intronic
1007186951 6:39979886-39979908 TTGGTCTCCTTTTAATTGTCAGG - Intergenic
1008198945 6:48562329-48562351 ACTGTCTCCTATAAATTGTATGG - Intergenic
1008920600 6:56840994-56841016 ATGTTCTCATTTAAACTTAAAGG - Intronic
1009507825 6:64507197-64507219 TTGTTATACTTTAAATTCTAGGG + Intronic
1009766083 6:68077454-68077476 ATGTTCTTATCTAAATTGCATGG + Intergenic
1009814137 6:68709111-68709133 ATCTTCTGTTTTAAATTGAAAGG - Intronic
1010112477 6:72255022-72255044 ATGCTCTCCTTTAATTTATGAGG - Intronic
1010528651 6:76938633-76938655 ATTTTCTTCTAAAAATTGTATGG - Intergenic
1010972348 6:82276274-82276296 ATGTTCTCCTTTATAAAATAGGG - Intergenic
1011021364 6:82816737-82816759 ATATTCTACTTTAAATTCTGGGG - Intergenic
1011265841 6:85518047-85518069 ATGTTTTACTTTTAATTGCAGGG - Exonic
1012107637 6:95184397-95184419 ATTTTCTCCTTAGAATTTTAAGG + Intergenic
1012107638 6:95184404-95184426 GTGATCTCCTTAAAATTCTAAGG - Intergenic
1012322838 6:97872807-97872829 ATCTTCACATATAAATTGTATGG - Intergenic
1013362617 6:109408375-109408397 TTGTTCTGCTTCAAATTGTCAGG + Intronic
1014564269 6:122929770-122929792 TTGTTTTCCTTTTAATTGTCAGG + Intergenic
1016796125 6:148119492-148119514 ATGTTTACCTTTTAATTGTTTGG + Intergenic
1017202622 6:151772474-151772496 CAGTTCTCCTTTAGATTTTAAGG + Intronic
1017406908 6:154129291-154129313 ATGTTCTTCTATACAATGTAAGG + Intronic
1017751989 6:157496688-157496710 ATGTTCTTTCTTAAACTGTAGGG - Intronic
1018401684 6:163428090-163428112 ATGTTCTCCTTTAAATTGTAAGG + Intronic
1018997790 6:168723614-168723636 ATGTTCTCCTGTGAATGGTGGGG + Intergenic
1021305171 7:19023176-19023198 ATGTTATAATTTAGATTGTAGGG - Intronic
1021456945 7:20839825-20839847 ATGTTATCCTTCAAATAGAAGGG + Intergenic
1023228341 7:37996482-37996504 TTGTTATACTTTAAATTCTAGGG + Intronic
1023919668 7:44618265-44618287 ATTCACTCATTTAAATTGTAAGG + Intronic
1023920108 7:44622417-44622439 TTGTTTACCTTTAATTTGTAAGG + Intronic
1025518609 7:61688996-61689018 TTATTTTACTTTAAATTGTAGGG + Intergenic
1025542934 7:62117643-62117665 TTATTTTACTTTAAATTGTAGGG + Intergenic
1026664068 7:72326905-72326927 CTCTTCTCCTTTAAATTCCATGG + Intronic
1027969519 7:85060782-85060804 ATGTTCTCCTTTCATGTGGAAGG + Intronic
1031199048 7:118654433-118654455 ATGTACTCCTTTAAAATGTTAGG + Intergenic
1032831611 7:135632823-135632845 ATGTACTTCTGTAAATTGCAGGG + Intronic
1033172754 7:139098240-139098262 ATGTACCCATTTAAAGTGTATGG - Intronic
1033722017 7:144070591-144070613 AATTTCTTGTTTAAATTGTAAGG + Intergenic
1035096080 7:156356854-156356876 ACGTTCTCTTTTAAAATGAAAGG - Intergenic
1035195242 7:157213723-157213745 ATGTTCTCAGTTGAATTTTAAGG + Intronic
1035840565 8:2808474-2808496 ATTTTTTCCTTTAATTTCTAAGG + Intergenic
1036392001 8:8331698-8331720 AGGTTCTGCTTTAGACTGTATGG + Intronic
1036997975 8:13681348-13681370 ATATTATGCTTGAAATTGTATGG - Intergenic
1037087120 8:14866075-14866097 TTTTTCTGCTTTACATTGTAAGG - Intronic
1037695038 8:21216166-21216188 TTGTTCTCCCTTGAAGTGTATGG - Intergenic
1038736022 8:30170326-30170348 ATGATCAGCTTTAAATTGTGAGG - Intronic
1039202349 8:35109898-35109920 ATGTTCACCTGTTAATAGTAAGG - Intergenic
1039281092 8:35985732-35985754 ATATTATACTTTAAGTTGTAGGG + Intergenic
1040712212 8:50202681-50202703 AAGTTTTCATTTAATTTGTAAGG + Intronic
1040845739 8:51837131-51837153 TTGTTCTGCTTTACATTGGAGGG - Intronic
1042021543 8:64374638-64374660 ATTTTCTCCTTCACATTGTCAGG - Intergenic
1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG + Intronic
1045789053 8:105959420-105959442 TTGTTATACTTTAAGTTGTAGGG - Intergenic
1046347224 8:112946510-112946532 GTTTTCTCATTTAAAATGTAGGG + Intronic
1049332172 8:142060408-142060430 AAGTTCTCCTTTAAATCATCAGG - Intergenic
1050214090 9:3302547-3302569 ATTTTCTCTCTTAAATTGCATGG - Intronic
1050579634 9:7038794-7038816 ATATTCTGATTTAAAATGTAAGG + Intronic
1052409631 9:28106301-28106323 AGATTCTTCTTTAAATTGTGTGG - Intronic
1052591373 9:30500568-30500590 TTGTTCTTGTTTAAATTTTAAGG + Intergenic
1052935134 9:34086775-34086797 ATATTCTCCTTTTAATGGTGGGG - Exonic
1053178884 9:35950621-35950643 TTATTCTCCTTTAAGTTTTAGGG + Intergenic
1053299483 9:36938866-36938888 CTGTTCTCCCTTCAATTTTATGG + Intronic
1054902217 9:70381116-70381138 ATGTTTTCCATTATTTTGTATGG + Intergenic
1054978934 9:71181208-71181230 ATGTTCACTTTTAAATTGTATGG + Intronic
1055087555 9:72329477-72329499 ATGTTAGCCTTTAAAGAGTATGG + Intergenic
1055431967 9:76253054-76253076 TTTGTCTCCTTTAAATTGGAAGG + Intronic
1058246946 9:102638582-102638604 GAGTTCTAGTTTAAATTGTAAGG - Intergenic
1058904749 9:109473711-109473733 AGGTTTTTCTTTAAATTGAATGG - Intronic
1059908549 9:119017000-119017022 ATCTTAACCTTTTAATTGTAGGG - Intergenic
1186456064 X:9710965-9710987 ATGTCATGTTTTAAATTGTAGGG + Intronic
1186889525 X:13946735-13946757 TTATTCTACTTTAAGTTGTAGGG - Intergenic
1187481030 X:19655810-19655832 ATATTCTCTTTTTAATTTTAGGG - Intronic
1187896421 X:23984150-23984172 TTGTTCTCCCTTAAATTCTTTGG - Exonic
1188100396 X:26075570-26075592 ATGTCCTACTTTAGATTGAATGG - Intergenic
1188897927 X:35693490-35693512 ATGTTCTTCTATACAATGTAAGG - Intergenic
1189644357 X:43110539-43110561 CTGTTCTGCTTCATATTGTAGGG - Intergenic
1189736511 X:44075328-44075350 ATTTTCTCCTATAAATTTTAAGG + Intergenic
1190121122 X:47659818-47659840 ATGTTTTTATTTAAATGGTAAGG + Intergenic
1191120628 X:56900040-56900062 TTATTATCCTTTAAATTTTATGG - Intergenic
1193284755 X:79698178-79698200 CTGTTGTCCTTTAAAGTGTTTGG - Intergenic
1193416731 X:81234520-81234542 ATGTTCTCCATTGAATTTTTTGG + Intronic
1194095801 X:89637149-89637171 TTGTTATACTTTAAATTCTAGGG + Intergenic
1195731511 X:107973021-107973043 AGGATCTCCTTTAAATTGGGTGG + Intergenic
1196616471 X:117771617-117771639 ATGATCTCCTGTAAATAGTCAGG + Intergenic
1197570021 X:128137763-128137785 TTATTCTACTTTAAATTTTAGGG - Intergenic
1197602037 X:128542856-128542878 TTGTTTTCCTTTCAATGGTAAGG + Intergenic
1197657313 X:129131125-129131147 TTGGTCTCCTTTTAATTCTATGG + Intergenic
1197854407 X:130899851-130899873 CTCTTGTCCTTTATATTGTATGG - Intronic
1197980578 X:132214971-132214993 ATGTTTTATTTTAAATTGAATGG + Intronic
1199054452 X:143276457-143276479 TTATTCTACTTTAAATTCTAGGG + Intergenic
1200448802 Y:3298520-3298542 TTGTTATACTTTAAATTCTAGGG + Intergenic
1201918442 Y:19207939-19207961 ATGTTTTGATTTAAATTGCATGG - Intergenic
1202115302 Y:21465864-21465886 ATGTGCTCCTGCAAATTGCAGGG - Intergenic