ID: 1018404387

View in Genome Browser
Species Human (GRCh38)
Location 6:163462783-163462805
Sequence ATTATTCCATACCAGGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018404387_1018404390 0 Left 1018404387 6:163462783-163462805 CCACAATCCTGGTATGGAATAAT 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1018404390 6:163462806-163462828 GAGAGCTTGAACTCAGGCAATGG 0: 1
1: 1
2: 1
3: 29
4: 309
1018404387_1018404389 -6 Left 1018404387 6:163462783-163462805 CCACAATCCTGGTATGGAATAAT 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1018404389 6:163462800-163462822 AATAATGAGAGCTTGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018404387 Original CRISPR ATTATTCCATACCAGGATTG TGG (reversed) Intronic
903414091 1:23169421-23169443 ATTATTCCATATCAGGTTCTAGG - Intronic
903800616 1:25964792-25964814 ATTCTTCCATTCCATGAGTGTGG - Intronic
905111651 1:35599201-35599223 ATTATTCCTTCCCAGGCTCGGGG - Intergenic
909336198 1:74477127-74477149 ATTATCCCAAACAAGGATTTTGG + Intronic
910598150 1:89001967-89001989 TTTAATGCATATCAGGATTGAGG + Intergenic
911771517 1:101748725-101748747 ATGTTTCTACACCAGGATTGAGG + Intergenic
911950311 1:104165241-104165263 AATATTCCATACTAGGAAAGTGG - Intergenic
913574349 1:120155556-120155578 ATTTTTCCTTACCAGGAATCAGG + Exonic
914021004 1:143867728-143867750 ATTATTCCTTTCCAGGAAAGGGG + Intergenic
914295617 1:146320359-146320381 ATTTTTCCTTACCAGGAATCAGG + Intergenic
914556657 1:148771140-148771162 ATTTTTCCTTACCAGGAATCAGG + Intergenic
914616177 1:149359090-149359112 ATTTTTCCTTACCAGGAATCAGG - Intergenic
914659498 1:149775656-149775678 ATTATTCCTTTCCAGGAAAGGGG + Intergenic
914782760 1:150800569-150800591 ATTATTCGATTCCATAATTGTGG - Intronic
915138333 1:153749762-153749784 ATTATGCCATTCCAGGATTCAGG + Intronic
917617653 1:176762451-176762473 ATTAATCCATGCCATCATTGAGG - Intronic
917850044 1:179054514-179054536 AATCTTCCAAACCAGGATTCTGG + Exonic
918318768 1:183345439-183345461 ATTAATCCATTCCTGGATTAGGG + Intronic
921433649 1:215091325-215091347 ATTGTTCCATACCAGGGAGGTGG + Intronic
921531551 1:216288515-216288537 AATATTCTATAACTGGATTGTGG + Intronic
921657393 1:217757124-217757146 ATTATTCCATAACAGCACTTTGG - Intronic
924422115 1:243919300-243919322 ATTATTCCAGTTCAGGATTGAGG + Intergenic
924484510 1:244467881-244467903 AATATTCCATACCAGGCAAGAGG + Intronic
924865568 1:247975733-247975755 AATATTCCATGCCAGGAGCGTGG + Intronic
1063205121 10:3823590-3823612 ATCATGTCATACCAGGAGTGTGG - Intergenic
1064968345 10:21037595-21037617 AATGTTCCATACCTTGATTGTGG + Intronic
1065682725 10:28253452-28253474 ATTAATCCAAACCTGGAGTGTGG - Intronic
1068894303 10:62182655-62182677 ATTATTCCAGATGAGGGTTGAGG + Intergenic
1069351712 10:67534255-67534277 ATTATTATATAGTAGGATTGGGG + Intronic
1072543372 10:96415030-96415052 ATGATTCCATTGCAGCATTGTGG - Intronic
1075843594 10:125526675-125526697 ATTATTGCATACCATGCTGGAGG - Intergenic
1081246139 11:40769355-40769377 ATTCTTCCAAACCATGAATGTGG - Intronic
1088487083 11:110351197-110351219 ATTATTCCTAAGCAGGAATGGGG + Intergenic
1089820804 11:121224420-121224442 AATATTCTATACCTTGATTGTGG - Intergenic
1093077392 12:14771903-14771925 ATTATTCCAAGTCATGATTGTGG - Intergenic
1093906752 12:24702508-24702530 ATTGTTCCATACCTTGATTGTGG + Intergenic
1094438507 12:30448491-30448513 AATATTCCAAAGCAGGACTGTGG + Intergenic
1095795461 12:46214564-46214586 AATGTTCTATACCATGATTGTGG + Intronic
1097419113 12:59352140-59352162 ATTATGCCATTTCAGGATTATGG + Intergenic
1099418850 12:82427216-82427238 CTTATTCCATACAAGGAATGTGG - Intronic
1099508941 12:83509728-83509750 ACTATTCCTTACCTGCATTGTGG - Intergenic
1099754622 12:86828902-86828924 AATATTCTAAACCTGGATTGCGG + Intronic
1100131983 12:91506236-91506258 ATTATTTCATTTCAGGATTTGGG + Intergenic
1102934194 12:116882974-116882996 ATACCTCCATCCCAGGATTGGGG + Intergenic
1106235094 13:27854484-27854506 ATTATTCCAAAGTAGGATCGCGG - Intergenic
1107688650 13:42929624-42929646 AATATTACATACCAGGACAGTGG + Intronic
1108287855 13:48926499-48926521 AATATTCCTGACTAGGATTGAGG + Intergenic
1108814972 13:54279308-54279330 ATTATTCCCTTCCATGAGTGTGG + Intergenic
1118912175 14:70070696-70070718 ATTTTTTAATACCAGGAATGGGG - Intronic
1119449798 14:74699504-74699526 ATTATTCCAGTCCACGGTTGAGG - Intronic
1123876750 15:24631012-24631034 ATTCTTCCATACCTTCATTGTGG + Intergenic
1125207878 15:37175558-37175580 ATTATTCTATATCTTGATTGTGG - Intergenic
1127408299 15:58677247-58677269 ATTATTACATATCAGTAGTGGGG - Intronic
1128297794 15:66539514-66539536 ATCATTTCATACCTGGACTGTGG + Intronic
1130083149 15:80752465-80752487 ATTATTAAATAACAGGAATGAGG - Intronic
1130938684 15:88490428-88490450 ATTTTTCCATAGCAGCTTTGTGG + Intergenic
1131784379 15:95896107-95896129 ATTAGTCCACACCAGGCCTGAGG + Intergenic
1132410106 15:101571133-101571155 ATTATTCCAGATCAGGGTGGTGG + Intergenic
1135485795 16:22863578-22863600 ATTAATACAAACCAGGGTTGGGG - Intronic
1138955289 16:61964271-61964293 ATTATTCCAGTTCAGGGTTGAGG + Intronic
1139917344 16:70436980-70437002 AGTCTGCAATACCAGGATTGGGG - Intronic
1141253362 16:82379046-82379068 ATTATTCCTTATCATTATTGTGG + Intergenic
1141808455 16:86357904-86357926 ATTTTTGCATTCCAGGCTTGTGG - Intergenic
1145392158 17:22463796-22463818 GTTTTTCCATAACAGGATTTTGG + Intergenic
1146287491 17:31583839-31583861 AATATTCCACATCATGATTGTGG - Intergenic
1149282762 17:55126515-55126537 AATATTCTATACCATGATTGGGG + Intronic
1151506094 17:74528245-74528267 ATTTTTCCACATCAGGAGTGGGG - Intronic
1155488390 18:26372094-26372116 AATTTTCCATTCCAGGAATGGGG - Intronic
1157869882 18:51220245-51220267 CTTATTACATGCCAGGATTGGGG + Intergenic
1164909959 19:32001474-32001496 AATATTCTAAACCTGGATTGTGG + Intergenic
925210243 2:2039137-2039159 ATTATTCCTTATCAATATTGGGG - Intronic
927907723 2:26873270-26873292 AATATTCCATATCTTGATTGTGG - Intronic
928817057 2:35309994-35310016 ATCATTCCATGCTAAGATTGTGG + Intergenic
928918958 2:36506029-36506051 CTTATTCCAGTCCAGGGTTGAGG + Intronic
929189899 2:39130174-39130196 ATTATTTCTTACCAGCATTGTGG - Intergenic
930431517 2:51282693-51282715 ATTATTCCCTACCTGCAGTGAGG + Intergenic
933697872 2:85233673-85233695 ATTGTTCTATATCATGATTGTGG - Intronic
938851727 2:135267389-135267411 ATTAATCCATTCATGGATTGAGG - Intronic
938875496 2:135527965-135527987 AAAATTCCATCCCAGGATTCTGG - Intronic
939295901 2:140263906-140263928 ATATTTCGATACCAGAATTGTGG - Intronic
940832800 2:158486753-158486775 ATTATTCCATACCATGACAATGG - Intronic
941568372 2:167138314-167138336 ATAACTCCATTCCAGGACTGAGG + Intronic
942092858 2:172510945-172510967 ATTCTTCCATAGGAAGATTGGGG + Intergenic
945260803 2:207841653-207841675 ATTATTCCATATTAGGAATTGGG - Intronic
945699691 2:213154061-213154083 ATGTTTTCATACCAAGATTGGGG + Intergenic
946975653 2:225146769-225146791 ATTCTTCCAAACCATGAATGTGG - Intergenic
947339518 2:229122675-229122697 ATTAGTGGATATCAGGATTGAGG + Intronic
947941314 2:234058235-234058257 GTTCTTCCACACCAGGCTTGGGG + Intronic
1170751840 20:19155389-19155411 ATTTTTCCATAGCATCATTGTGG - Intergenic
1172753259 20:37266031-37266053 AGCATTCCAAAACAGGATTGTGG - Intergenic
1177353988 21:19983321-19983343 ATTTTTCCATACCAAGAGTAGGG + Intergenic
1180700065 22:17776384-17776406 ATTCTTCTATACAGGGATTGTGG + Intergenic
949582229 3:5400380-5400402 ATTTTTCAAAACCAGGAATGAGG - Intergenic
949603225 3:5624365-5624387 AGTATTCCAGTCCAGGAATGTGG + Intergenic
950333491 3:12175746-12175768 ATTAATCCATCCCAGGCTAGAGG - Intronic
951582007 3:24174541-24174563 ATTATTGCAAGCTAGGATTGGGG - Intronic
955080887 3:55656970-55656992 ACTATTCCACAGCAGGATGGTGG + Intronic
956205852 3:66754018-66754040 AATATTCCATCCCAGGATCATGG + Intergenic
956458490 3:69447528-69447550 AATATTCCATATCTTGATTGTGG - Intronic
957149962 3:76474319-76474341 ATTATTATATACCAGTATTTAGG + Intronic
959252177 3:103963075-103963097 ATGATTCCATACCAAGGTGGGGG + Intergenic
959752309 3:109853000-109853022 ATTATTCCATACCAAAATCAGGG - Intergenic
960866282 3:122202887-122202909 ACTATTCTATAACAGTATTGAGG - Intronic
962692550 3:137914532-137914554 AATATTCTATATCTGGATTGTGG - Intergenic
965218632 3:165897894-165897916 ACTATTCTATATCATGATTGCGG - Intergenic
965464647 3:169012823-169012845 AATGTTCTATACCAGGATTGAGG + Intergenic
970920996 4:21394980-21395002 ATTATTAAATATAAGGATTGTGG - Intronic
971348434 4:25834155-25834177 ATTATCCCATTCCTGGACTGGGG + Intronic
972081904 4:35163051-35163073 ATTATTGCATTGCAGTATTGTGG + Intergenic
975791101 4:77951903-77951925 CTTATTCCAGTCCAGGGTTGTGG - Intronic
978834669 4:113134500-113134522 ATTATTCCATACTAAGATAAGGG - Intronic
979222217 4:118240684-118240706 ATTACTCCATACCTGAAATGGGG - Exonic
981815546 4:148826927-148826949 ATTATTTCAGATCAGGAATGTGG + Intergenic
989994139 5:50807649-50807671 ATTATACCAATCCACGATTGAGG - Intronic
996345639 5:122485821-122485843 AATATTCTATATCATGATTGGGG + Intergenic
997179745 5:131815668-131815690 ATTCTTCCTTACCACCATTGTGG - Intronic
1000174112 5:158733753-158733775 AATATTCAATACCTGTATTGAGG - Intronic
1000541566 5:162547603-162547625 AACATTCTATACCAGCATTGTGG - Intergenic
1003616860 6:7662562-7662584 ATTCTTCCAAACCATGAGTGTGG - Intergenic
1004776119 6:18846905-18846927 ATTATTCCATACCCCCATTTAGG + Intergenic
1005614565 6:27560252-27560274 ATTATTCCCCAGCAGGACTGGGG - Intergenic
1006427304 6:33974410-33974432 ATTGTTCCATATCCTGATTGAGG + Intergenic
1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG + Intronic
1006438881 6:34041101-34041123 ATTATCCCAGGCCAGGCTTGGGG - Intronic
1010407626 6:75522774-75522796 ATTATTCCACCCAAGGGTTGAGG + Intergenic
1014621914 6:123677724-123677746 AAGTTTCCATACCAGGAGTGGGG + Intergenic
1014624358 6:123707847-123707869 ATAATTCAATACCAGAATTAAGG - Intergenic
1015771918 6:136777195-136777217 ATTATTGCAAAGCAGGGTTGGGG - Intronic
1015876110 6:137824433-137824455 CTTATTCCATAACAGGAGGGAGG + Intergenic
1016105047 6:140151392-140151414 ATGATTCCATATCAGGATTTAGG + Intergenic
1017270633 6:152500416-152500438 TTTGTTCCTTGCCAGGATTGGGG - Intronic
1018404387 6:163462783-163462805 ATTATTCCATACCAGGATTGTGG - Intronic
1020602495 7:10293407-10293429 ATTCTTCCATAACAGGATATGGG - Intergenic
1021816593 7:24453054-24453076 CTTATTCCAGTTCAGGATTGCGG - Intergenic
1021898344 7:25258474-25258496 ATAATTCCATCTCAGGATTCTGG + Intergenic
1024371083 7:48584639-48584661 ATTATTCCAGTTCAGGGTTGAGG - Intronic
1029947564 7:104549205-104549227 AAGATTCCAGACCAGGATAGAGG + Intronic
1031327617 7:120421823-120421845 GCTAATCCATGCCAGGATTGTGG - Intronic
1040860320 8:51992173-51992195 ATTATTCCATATCTTAATTGTGG - Intergenic
1041933953 8:63316384-63316406 ATTATTGCATCTGAGGATTGTGG + Intergenic
1042887187 8:73565025-73565047 CTTATTCCAGTTCAGGATTGAGG - Intronic
1042994075 8:74674369-74674391 TTCATTACATCCCAGGATTGGGG - Intronic
1043790634 8:84463843-84463865 ATTGTTCTACACCATGATTGTGG - Intronic
1044187118 8:89266809-89266831 AATATTCTATATCATGATTGTGG - Intergenic
1044401054 8:91772326-91772348 GTTATTCTATAAAAGGATTGTGG - Intergenic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1045604613 8:103758301-103758323 ATCACTCAATACCAAGATTGAGG - Intronic
1045846847 8:106646968-106646990 AATACTCCATACCTGGAATGTGG - Intronic
1047151119 8:122264383-122264405 ATTATTCCAGTTCATGATTGTGG + Intergenic
1050235246 9:3571229-3571251 TTTATTCCCTACCTGGAATGTGG - Intergenic
1055481786 9:76715798-76715820 ATTATTTCAAACCATCATTGAGG + Intronic
1056851795 9:90091181-90091203 ATTGTTCCAGACTCGGATTGTGG - Intergenic
1057848591 9:98545669-98545691 CTTATTCCAAACCAGGGGTGTGG - Intronic
1059760905 9:117336529-117336551 ATTCTTACTTACCAGGATTTGGG - Intronic
1059865609 9:118510822-118510844 AATATTTCATACCATGATTTTGG - Intergenic
1186306336 X:8263360-8263382 ATTATGCCATAAAAGCATTGTGG - Intergenic
1190778696 X:53576708-53576730 AGTATGACATACCAGGATGGTGG - Intronic
1191612267 X:63130149-63130171 ATTATTCTAAACCAGAATTCTGG - Intergenic
1191624030 X:63248777-63248799 ATTATTCTAAACCAGAATTCTGG + Intergenic
1193920360 X:87417580-87417602 ATTATTCCAATCCATGAGTGTGG + Intergenic
1194290361 X:92064442-92064464 AATGTTCCATACCTCGATTGTGG - Intronic
1195836739 X:109124168-109124190 ATTATTACATATCATGAATGAGG + Intergenic
1196605347 X:117651340-117651362 ATTCTTCCTTACCTGCATTGTGG - Intergenic
1197676205 X:129333621-129333643 ATTCTTCCATTCCATGAGTGTGG - Intergenic
1199780745 X:151056808-151056830 ATTATTCCAGTTCAGGGTTGTGG - Intergenic
1200392149 X:155955650-155955672 ATAATTCCATGCCATGATTTTGG - Intergenic
1200607875 Y:5289046-5289068 AATGTTCCATACCTTGATTGTGG - Intronic