ID: 1018406633

View in Genome Browser
Species Human (GRCh38)
Location 6:163491175-163491197
Sequence ATTCAATCCATTATATCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018406629_1018406633 26 Left 1018406629 6:163491126-163491148 CCTTTTCAGTGCTTTTCAAACTG 0: 1
1: 0
2: 3
3: 52
4: 488
Right 1018406633 6:163491175-163491197 ATTCAATCCATTATATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018406633 Original CRISPR ATTCAATCCATTATATCTTT TGG Intronic
No off target data available for this crispr