ID: 1018410573

View in Genome Browser
Species Human (GRCh38)
Location 6:163542241-163542263
Sequence GAGGATTAACGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 0, 2: 8, 3: 43, 4: 634}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018410573_1018410577 -9 Left 1018410573 6:163542241-163542263 CCTTCCTCCTTCCGTTAATCCTC 0: 1
1: 0
2: 8
3: 43
4: 634
Right 1018410577 6:163542255-163542277 TTAATCCTCATTCATCTAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018410573 Original CRISPR GAGGATTAACGGAAGGAGGA AGG (reversed) Intronic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900863086 1:5246512-5246534 GAAGAAGAAGGGAAGGAGGATGG - Intergenic
902613694 1:17612084-17612106 GAGAATGAATGGAGGGAGGATGG - Intronic
903350516 1:22713728-22713750 GAGGAGACAAGGAAGGAGGAAGG - Intronic
903670250 1:25031182-25031204 GAGGATGAAGGGATGGAGGCTGG + Intergenic
904379978 1:30104018-30104040 GAGGCTTCCTGGAAGGAGGAGGG + Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905305396 1:37014345-37014367 GAGGAGGAAAGAAAGGAGGAAGG + Intronic
905943880 1:41885686-41885708 AAGGAGGAAGGGAAGGAGGAAGG - Intronic
905943884 1:41885698-41885720 AAGGAGGAAGGGAAGGAGGAAGG - Intronic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907050404 1:51326241-51326263 GAGGCTGGGCGGAAGGAGGATGG + Intronic
907489056 1:54797301-54797323 GAGGGTTGATGGGAGGAGGAGGG + Intronic
907582224 1:55582639-55582661 GAGGGGCAATGGAAGGAGGAAGG + Intergenic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
907957281 1:59241855-59241877 GATGATGAAGGGAAGGAGTAAGG + Intergenic
908796311 1:67833640-67833662 GAGAATTAGAGGAAGGGGGATGG - Intergenic
908916734 1:69136248-69136270 GAGGAGAAAGGGAAGGAGGGAGG + Intergenic
909779066 1:79520078-79520100 GAGGAGGAAGGGGAGGAGGAGGG + Intergenic
909779088 1:79520203-79520225 GAGGAGGAAGGGGAGGAGGAGGG + Intergenic
910779966 1:90920390-90920412 GAGGAAGAAGGGCAGGAGGATGG + Intronic
910841981 1:91569829-91569851 GAAGAGGAACGGAAGAAGGAAGG + Intergenic
911224547 1:95290899-95290921 GAGAAGTAACAGAGGGAGGACGG - Intergenic
911281585 1:95936116-95936138 GAGGATTTAAGCAAGGGGGATGG - Intergenic
911383068 1:97140164-97140186 GAGGGTTAAAGTAAGGAGGCTGG + Intronic
915268240 1:154733814-154733836 GGGGATGAAGGGAGGGAGGAAGG - Intronic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916881241 1:169021492-169021514 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
917016766 1:170540897-170540919 GAGAATTAAAGAAATGAGGAAGG + Intronic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918117443 1:181509115-181509137 GAGGATTAAGAGAAGGACTAGGG + Intronic
918586357 1:186193255-186193277 GAGGGAGAAGGGAAGGAGGAAGG + Intergenic
918725680 1:187919680-187919702 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
918794845 1:188880547-188880569 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919626976 1:199920676-199920698 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
919812091 1:201415113-201415135 GAGGATTATGGCAAGGAGAAAGG - Intronic
920278211 1:204824290-204824312 CAGCATTAAGGGAAGGAGGGAGG - Intergenic
920747918 1:208646446-208646468 GAGGAATAATGGAGGGAGGAAGG - Intergenic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
921374040 1:214455010-214455032 GAGGAAGAACGGGAGGAGTAGGG - Intronic
921382437 1:214538201-214538223 AAGAATGAATGGAAGGAGGAAGG + Intronic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
924200090 1:241649665-241649687 GAAGACAAAAGGAAGGAGGAGGG - Intronic
1062773404 10:123654-123676 GAGGAAGGACGGAAGGAGGAAGG + Intergenic
1063025946 10:2178852-2178874 GAGGATTGAAGGAAGGAGGAAGG - Intergenic
1063711414 10:8482713-8482735 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1064576238 10:16748765-16748787 GAGACTTAAAGGAAGGAGGGAGG - Intronic
1064952856 10:20873469-20873491 GAGGAAGAACAGGAGGAGGAGGG + Intronic
1066365160 10:34769426-34769448 GAGGATAAATGGGAGGAGGTGGG - Intronic
1066462695 10:35625437-35625459 GAGGATGGAGGGTAGGAGGAAGG - Intergenic
1066528710 10:36312305-36312327 GAGGATTCAGGAAGGGAGGAAGG - Intergenic
1067013883 10:42740928-42740950 GAGACTTAAAGGAAGGAGGGAGG + Intergenic
1067163020 10:43842965-43842987 GAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067492365 10:46722880-46722902 AAGGTTTAAAGTAAGGAGGATGG - Intergenic
1067602300 10:47617502-47617524 AAGGTTTAAAGTAAGGAGGATGG + Intergenic
1067814352 10:49461157-49461179 GGGGATGAAAGCAAGGAGGAAGG + Intronic
1068438721 10:57023018-57023040 GAGATTTAAAGGAAAGAGGAAGG + Intergenic
1068493902 10:57760002-57760024 GAGGATGGAGGGCAGGAGGAGGG + Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068895719 10:62198201-62198223 GAAGTTTATCAGAAGGAGGAAGG + Exonic
1069070648 10:63987772-63987794 CAGGATTAAGGGAACAAGGAGGG + Intergenic
1069142593 10:64845174-64845196 GGGGATTAAAGGAGGGAGTATGG - Intergenic
1070100474 10:73381343-73381365 TAGGAAGAAAGGAAGGAGGAAGG + Intronic
1070694050 10:78548663-78548685 AAGGAAGAAAGGAAGGAGGAAGG + Intergenic
1071102744 10:82058656-82058678 GATGACTAAAGGAAGGAGAAGGG - Intronic
1071183986 10:83019501-83019523 GAGGCTTAACTCTAGGAGGAAGG + Intergenic
1071653652 10:87422914-87422936 AAGGTTTAAAGTAAGGAGGATGG + Intergenic
1071715675 10:88093025-88093047 CAGGATTCAAGGTAGGAGGATGG + Intergenic
1072703578 10:97663390-97663412 GAGGATGAAAGGAATGAGAAAGG - Intronic
1073821118 10:107265155-107265177 GGGGATTAAAGGAAGCAGGATGG - Intergenic
1073956021 10:108872309-108872331 GAGAGGTAAGGGAAGGAGGAGGG + Intergenic
1075065627 10:119287255-119287277 GAGGAGGAAGGGAAGGAGGAAGG + Intronic
1075065651 10:119287338-119287360 GAGGAGGAAGGGAAGGAGGAAGG + Intronic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1076252363 10:128994644-128994666 GAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1076318976 10:129564495-129564517 GAGGAAGAAGGGGAGGAGGAGGG - Intronic
1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG + Intergenic
1076867614 10:133175763-133175785 GAGGATGGACGGGTGGAGGATGG + Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077497353 11:2892612-2892634 GAGGAGGGAAGGAAGGAGGAGGG - Intronic
1077657065 11:4029553-4029575 GAGGAGGGACGGAAGGAGGGTGG + Intronic
1078135799 11:8650462-8650484 AAGGAGGAAGGGAAGGAGGAAGG + Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1080604678 11:33855164-33855186 GAGGAAGAACGGAAGGAGGAAGG + Intergenic
1081683258 11:45023502-45023524 GAGGTTCAAGGGAAGGGGGAGGG + Intergenic
1082101753 11:48178576-48178598 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1083058053 11:59842250-59842272 GAGGAGTAAGTGAAGGAAGAGGG - Intronic
1083475038 11:62909973-62909995 GAGGATGAAGGCCAGGAGGATGG + Exonic
1083478448 11:62928480-62928502 AAGGAATGAAGGAAGGAGGAAGG + Intergenic
1084859528 11:72009217-72009239 GAGGTTGAAGGGCAGGAGGAAGG + Intronic
1086068535 11:82772635-82772657 GAGGGTGAACGGTGGGAGGAGGG - Intergenic
1086291707 11:85317757-85317779 GAGGATGAAGGGTAGGAGGAGGG + Intronic
1086331202 11:85756050-85756072 GAGGAGTAAGGGCAGGAGGTGGG - Intronic
1086731832 11:90259565-90259587 GAGGATGAAGGGAGGAAGGAGGG + Intergenic
1087505278 11:99013023-99013045 GAGGAGGAAGGGGAGGAGGAGGG + Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087945001 11:104148735-104148757 GAGGATGAAGGGTGGGAGGAGGG - Intronic
1088449916 11:109970412-109970434 GAGGATTAATCACAGGAGGATGG - Intergenic
1088508291 11:110548360-110548382 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1088725812 11:112633589-112633611 GAGGATTAATACAAGGAGAATGG - Intergenic
1089447567 11:118565636-118565658 GGGGAATAAAGGAAGCAGGACGG + Intronic
1089687617 11:120166755-120166777 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1090260447 11:125315171-125315193 GAGGAGAAAAGGAAGGAGGTGGG - Intronic
1090283192 11:125475583-125475605 GAGGATGAAGGGTGGGAGGAGGG + Intronic
1090387021 11:126363293-126363315 GAGGCAGAAAGGAAGGAGGAGGG - Intronic
1091379218 12:45163-45185 GGGGATTCATGGATGGAGGATGG + Intergenic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091976088 12:4827006-4827028 GAGGAGGAAAGGAAGGAGGGAGG - Intronic
1092745596 12:11669410-11669432 AAGGAAGAAAGGAAGGAGGAAGG - Intronic
1093920179 12:24850756-24850778 GAGGATTTATGGACAGAGGAAGG - Intronic
1095866679 12:46979740-46979762 GAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1095930248 12:47618462-47618484 GAGGAACAAGGGAAGAAGGAAGG - Intergenic
1095990517 12:48031127-48031149 GAGCATTAAAGGAAGGCGGGAGG + Intergenic
1095999390 12:48116161-48116183 GAGGAAGAAAGGAAGGAGGCAGG - Intronic
1096593511 12:52678536-52678558 GAGGATTACCGGAACAAGTAAGG - Exonic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096810066 12:54163587-54163609 GATGTTTAAAGAAAGGAGGAGGG + Intergenic
1097077671 12:56407475-56407497 GGGGATCAAGGGAAGGAGAATGG - Intergenic
1097235695 12:57537972-57537994 GAGGATTAAACAAAAGAGGATGG - Intronic
1097640228 12:62172238-62172260 GAGGATGAAGGAAGGGAGGAAGG - Intronic
1098070413 12:66668538-66668560 GAGGAGGAGGGGAAGGAGGAAGG + Intronic
1098197630 12:68018592-68018614 GAGGAACAGAGGAAGGAGGAAGG + Intergenic
1098216998 12:68231292-68231314 GAGGAGGAAGGGAAGGAGGGAGG + Intergenic
1098528971 12:71519123-71519145 GTGGAATAACAGGAGGAGGATGG - Intronic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100713916 12:97286041-97286063 GAAGAAAAAAGGAAGGAGGAAGG - Intergenic
1101348366 12:103905900-103905922 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1101348370 12:103905915-103905937 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1101925640 12:108969301-108969323 GAGGAAGAAAGGAAGGAGGTAGG - Intronic
1102233846 12:111281895-111281917 GAGAAAGAAGGGAAGGAGGAGGG + Intronic
1102703138 12:114857563-114857585 GAGGATGGAGGGCAGGAGGAGGG - Intergenic
1102992022 12:117322401-117322423 GAGGAGGGAAGGAAGGAGGAAGG - Intronic
1103581879 12:121921480-121921502 GAGGAGGAAGGGGAGGAGGAGGG + Exonic
1103959353 12:124598908-124598930 GAGGATGTAGGGCAGGAGGAGGG + Intergenic
1104139281 12:125972145-125972167 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
1104616356 12:130273306-130273328 GAGGAGGAGAGGAAGGAGGAGGG - Intergenic
1105424828 13:20285166-20285188 GGGGATCGAGGGAAGGAGGATGG + Intergenic
1105812937 13:24010671-24010693 GAGGAAGAAAGGATGGAGGAAGG - Intronic
1105957403 13:25297007-25297029 GAGGTTTTAAGGAAGAAGGAAGG + Intergenic
1105984359 13:25550645-25550667 AAGGAGAAACGGAAGGAGAATGG - Intronic
1106620667 13:31367758-31367780 GGGGATTGAGGGGAGGAGGATGG + Intergenic
1106783549 13:33085205-33085227 GAGAAAGAAAGGAAGGAGGAAGG + Intergenic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107236590 13:38177766-38177788 GAGGGTTCAGGGTAGGAGGAGGG + Intergenic
1107560082 13:41550599-41550621 GAGGATGAAAGGAATCAGGAGGG + Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110149589 13:72234759-72234781 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1111232216 13:85358460-85358482 GAGGGTAAAAGGTAGGAGGAGGG + Intergenic
1111423886 13:88053805-88053827 GAGGATGAAGGGTAGGGGGAGGG + Intergenic
1112682441 13:101782529-101782551 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1113796595 13:113061875-113061897 GAGGAGGAAGGGGAGGAGGAGGG - Intronic
1114382684 14:22224649-22224671 GAGGATGAAGGGTGGGAGGAAGG - Intergenic
1114787263 14:25615305-25615327 GAGGAAAAAAGGAAGAAGGAAGG - Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG + Intergenic
1116131206 14:40856909-40856931 AGGGATCAAGGGAAGGAGGATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117315395 14:54567038-54567060 GAGGAGTAAGAGGAGGAGGAAGG + Intergenic
1117506567 14:56409605-56409627 GAGGATGAAGGGTGGGAGGAGGG + Intergenic
1118394082 14:65321006-65321028 GAGGAGGAGCGGGAGGAGGATGG + Intergenic
1118899447 14:69974267-69974289 GAGGATCAGAGGAAGGAGGCAGG + Intronic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121800197 14:96768652-96768674 GAGGAAGAAGGGAGGGAGGAAGG - Intergenic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1121843864 14:97156270-97156292 GAGGAAGAAAGGAAGGAGGGAGG - Intergenic
1124228827 15:27922955-27922977 GAGGATGAAAGGTGGGAGGAGGG - Intronic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1125316167 15:38433868-38433890 GACTATTAAAGGAGGGAGGAGGG - Intergenic
1125670070 15:41465160-41465182 GAAGAGGAAGGGAAGGAGGAAGG - Intronic
1126370682 15:47943393-47943415 GAGGAAAAAGGAAAGGAGGAAGG + Intergenic
1126634089 15:50765305-50765327 GATGAGTAATGGAAAGAGGAGGG + Intronic
1126957008 15:53944399-53944421 GAGGATGGAAGGCAGGAGGAGGG - Intergenic
1127022858 15:54769426-54769448 GAGGGTGGAGGGAAGGAGGAGGG + Intergenic
1127905321 15:63372082-63372104 GAAGATGACCGGAAGGAGGCAGG - Intronic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1131213294 15:90516313-90516335 AAGGAAGAAAGGAAGGAGGAAGG + Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131702078 15:94948531-94948553 GAGGATGAACGGTAGGAGAAGGG - Intergenic
1132030867 15:98437770-98437792 GAGGATGGACGGATGGATGATGG + Exonic
1132261572 15:100429693-100429715 GAGGATCAACTGAAGGATGGGGG - Intronic
1132282665 15:100633654-100633676 GAGGAAGGAAGGAAGGAGGAAGG + Intronic
1133389860 16:5401479-5401501 GAGGACTAACGGCAGGAGGAGGG - Intergenic
1133532914 16:6672494-6672516 GAGGAAGAAAGGAAGGAAGATGG + Intronic
1133545805 16:6805388-6805410 GAGGATAGAGGGTAGGAGGAGGG + Intronic
1133552188 16:6867416-6867438 GAGGATTAAGGGAAGAAAGGGGG + Intronic
1133997872 16:10761945-10761967 GAGGGGCAATGGAAGGAGGAGGG + Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135068527 16:19332228-19332250 AAGGAATGAAGGAAGGAGGAAGG + Intergenic
1136083643 16:27869025-27869047 GAGGAGGGAAGGAAGGAGGAAGG + Intronic
1136268022 16:29132159-29132181 GAGGATGGAGGGAGGGAGGAAGG + Intergenic
1136402929 16:30028337-30028359 GAGGATTAAAGCAGGGAAGACGG + Intronic
1136595596 16:31247366-31247388 GAGGGTCAAGGGCAGGAGGATGG - Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1137557035 16:49477251-49477273 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557046 16:49477275-49477297 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137858122 16:51817341-51817363 GAGGATGGAGGGAAGGAGGATGG - Intergenic
1138101645 16:54256661-54256683 GAGGATTAGAGAAAGGAGGAGGG - Intronic
1138370214 16:56520630-56520652 GAAAATTAAGGGAAGGAAGAGGG + Intergenic
1139375726 16:66495307-66495329 AAGGATCAAGGGAAGGAGGGAGG - Intronic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139802589 16:69535620-69535642 TAGGATAGAGGGAAGGAGGAGGG + Intergenic
1140562099 16:75995444-75995466 GAGAGTTAACGGGAGTAGGAAGG + Intergenic
1141096831 16:81168714-81168736 GAAGATGAATGGATGGAGGATGG + Intergenic
1141254612 16:82389126-82389148 GAGGATGGAAGGCAGGAGGAGGG + Intergenic
1141336092 16:83156740-83156762 TAGGATTTATGGAAGGAGGCTGG - Intronic
1141421561 16:83921126-83921148 GAGTTTTAATGGAAGGAAGATGG + Exonic
1141421622 16:83921401-83921423 GTGGATGGAAGGAAGGAGGATGG + Exonic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1142251420 16:88993706-88993728 GAGGAGGAAGGGAGGGAGGAGGG - Intergenic
1143002341 17:3802559-3802581 GAGGTTCAACAGAAGTAGGATGG - Intergenic
1143520446 17:7441363-7441385 GAGAATGAAAGGAAGGAAGAGGG - Intronic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144728573 17:17513992-17514014 GAGGATAGATGGATGGAGGAAGG - Intronic
1145969859 17:28950467-28950489 GAGGATCAAGGGTAGGGGGATGG + Intronic
1146488437 17:33262424-33262446 GAGGAGGAAGGGAGGGAGGAAGG + Intronic
1148018379 17:44538421-44538443 TAGGATTTATGGAAGGAAGAGGG - Intergenic
1148134919 17:45286065-45286087 GAGGAAAAAGGGAAGGAGGTGGG + Intronic
1148978360 17:51549099-51549121 GAGGGTTAATGGTAGAAGGAGGG - Intergenic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1150905508 17:69332719-69332741 GGGGATGAAAGGGAGGAGGAAGG - Intergenic
1150908747 17:69366422-69366444 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
1151078482 17:71301463-71301485 GAGGAAGAAAGGAAGGAGGGAGG - Intergenic
1151345775 17:73500404-73500426 GATGGATAATGGAAGGAGGATGG - Intronic
1151981835 17:77516347-77516369 GAGGATGAAGGGTGGGAGGAGGG - Intergenic
1152105773 17:78327983-78328005 GAGGATAAATGCCAGGAGGAAGG + Intergenic
1152609191 17:81307375-81307397 GAAGAGAAAGGGAAGGAGGAGGG - Intergenic
1153054774 18:935126-935148 GAAGATTAAAGGAAAGAGAACGG + Intergenic
1153574120 18:6503974-6503996 GAGGAGGAAGGGAGGGAGGAGGG + Intergenic
1154412209 18:14147520-14147542 AAGGAGGAACGGAAGGAGGGAGG + Intergenic
1155449300 18:25946761-25946783 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1156702911 18:39845768-39845790 GAGGATTAAAGGAAGTATCAGGG - Intergenic
1156967586 18:43114027-43114049 TAGGATTTAAGGAAGGAGGAAGG - Intronic
1157494074 18:48142796-48142818 GAGGAGTGAAGGAAGGAGGGAGG - Intronic
1157636215 18:49157423-49157445 GAGGATTAAATGAATGAGGTAGG - Intronic
1159032244 18:63243362-63243384 GAGGATGAAGGGTGGGAGGAGGG + Intronic
1159113082 18:64083086-64083108 GATGATTAAAGGAAGGTGAATGG - Intergenic
1159531683 18:69663293-69663315 GAGGATGAAGGGTGGGAGGACGG + Intronic
1159689365 18:71466962-71466984 GAGGATTTGAGGAAGGAGCAGGG + Intergenic
1159959064 18:74541485-74541507 GAGGAGTCACAGAAGGAGAAGGG + Intronic
1160356147 18:78229695-78229717 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1160502508 18:79409228-79409250 GAGGAATAATGGATGGATGATGG - Intronic
1160502534 18:79409374-79409396 GAGGAATAATGGATGGATGATGG - Intronic
1160676628 19:394619-394641 AAGGATGAAGGGAAGGATGATGG + Intergenic
1160695185 19:480455-480477 GAGGATGATGGGAAGGATGATGG + Intergenic
1160905680 19:1450660-1450682 TTGGATTAAAGGAAGGAGAAAGG + Intronic
1161135164 19:2615313-2615335 GAGCATTGAAGGCAGGAGGAAGG - Intronic
1161135579 19:2617581-2617603 GAGCATTGAAGGCAGGAGGAAGG - Intronic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161329222 19:3678447-3678469 GAGGATGGAGGGATGGAGGATGG + Intronic
1161329228 19:3678462-3678484 GAGGATGGAGGGATGGAGGAGGG + Intronic
1161370553 19:3908696-3908718 GAGGAGAAAAGGGAGGAGGAGGG - Intronic
1161934619 19:7364016-7364038 GTGGATGAAAGGAAGGAGGATGG + Intronic
1162062982 19:8107915-8107937 GAGGATGAATGGAAGGATGGGGG + Intronic
1162126604 19:8502703-8502725 GAGGAGGAAGGGAAGGAGGTGGG + Exonic
1162341954 19:10096583-10096605 GAGGAGGAACGGAAGGAAGACGG + Intronic
1163596144 19:18222073-18222095 GAGGAACAAAGGAAGGAGGGAGG + Intronic
1163779579 19:19239461-19239483 GAGAAAGAATGGAAGGAGGAGGG - Intronic
1163779599 19:19239524-19239546 GAAGATGAGTGGAAGGAGGAAGG - Intronic
1163779634 19:19239638-19239660 GAAGATGAGTGGAAGGAGGAGGG - Intronic
1163779696 19:19239861-19239883 AAAGATGAATGGAAGGAGGAGGG - Intronic
1163779702 19:19239889-19239911 GAGGAGGAAGGGAAGGAGAAAGG - Intronic
1164744176 19:30599198-30599220 GAGGAAGAAGGGAGGGAGGAAGG - Intronic
1164771967 19:30816339-30816361 AAGGAATAAGGGAGGGAGGAAGG - Intergenic
1164925618 19:32127765-32127787 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1164975640 19:32570989-32571011 GAGGAAACAAGGAAGGAGGAAGG - Intergenic
1166040360 19:40198586-40198608 GGGGAGTAAGGGAGGGAGGAAGG + Intronic
1166520110 19:43474617-43474639 GCTGATTAAGGGAAGGAGGGGGG + Intergenic
1166692747 19:44833531-44833553 GAGGAGGAAGGAAAGGAGGAAGG + Intergenic
1166803842 19:45473372-45473394 GAGGATTAAGGGACGGGGGTGGG + Exonic
1167153943 19:47726642-47726664 GAGGATGTAAGGAAGGAGGAAGG - Intronic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1168682326 19:58325079-58325101 GTGGATTAAGGGAAGGAGATGGG - Intergenic
926244632 2:11113673-11113695 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
926266814 2:11330806-11330828 GAGGAGGAAGGGGAGGAGGAGGG + Intronic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
927406034 2:22768306-22768328 GAGGAATAAAGGAGGGGGGAAGG + Intergenic
927524359 2:23723422-23723444 GAGGAGGAAAGAAAGGAGGAAGG + Intergenic
928249572 2:29663425-29663447 GAGGACGATGGGAAGGAGGAAGG - Intronic
929055902 2:37875700-37875722 GAGCAATAAGGGAAAGAGGAGGG + Intergenic
929448965 2:42023972-42023994 GAGGAAGAAAGGAAGGAGGGAGG + Intergenic
930365619 2:50435802-50435824 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
931014671 2:57962563-57962585 GAGGATGGAGGGAGGGAGGAGGG - Intronic
931316608 2:61139036-61139058 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
932056975 2:68455583-68455605 GAGGATTAGTGGAAAGTGGAAGG - Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
935063234 2:99626375-99626397 GAGGAAGAAGGGAGGGAGGAAGG - Intronic
936233567 2:110724931-110724953 AAGGAAGAACGGAGGGAGGAAGG + Intergenic
936564485 2:113572423-113572445 GGGGATTCATGGATGGAGGATGG - Intergenic
937259412 2:120576124-120576146 GAGGCTTAATGGAGGGAGGTAGG - Intergenic
937690684 2:124751342-124751364 GAAGATAAAGGAAAGGAGGAAGG + Intronic
937755866 2:125538139-125538161 AAGGAGTAATGGAAGGAAGATGG + Intergenic
939960116 2:148558892-148558914 GAGAATTGAAGGAAGGAAGAAGG + Intergenic
940028998 2:149240742-149240764 GAGGATTTAAGCCAGGAGGAAGG + Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941972448 2:171366147-171366169 GAGGATTCTAGGAATGAGGATGG + Intronic
942211799 2:173678381-173678403 AAGGAGGAAGGGAAGGAGGAGGG + Intergenic
942629415 2:177939439-177939461 GAGGAAGAAAGGAAGGAGGGAGG + Intronic
942964592 2:181876324-181876346 GAGGATTAGTGGAAGGAGGAAGG - Intergenic
943532666 2:189103884-189103906 TAGGAGGAAGGGAAGGAGGAAGG - Intronic
943923980 2:193747057-193747079 GAGGATAAAGGGTGGGAGGAGGG + Intergenic
944391288 2:199222415-199222437 GAGGATGAAGGGTGGGAGGAGGG - Intergenic
945142156 2:206698472-206698494 GAGGGTTCCCGGAAGGAGAAGGG - Intronic
945773992 2:214081879-214081901 GAGGATTCAGGGAAAGAGGGTGG + Intronic
945911184 2:215651448-215651470 AAGGAAGAAAGGAAGGAGGAAGG + Intergenic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946142887 2:217706587-217706609 GAGGAGAAAGGGGAGGAGGAAGG + Intronic
947077715 2:226363915-226363937 GAGGAAGGAGGGAAGGAGGAAGG + Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947750258 2:232528408-232528430 GAGGCTTAAGGAAAGGAGGCAGG - Intronic
948277965 2:236724649-236724671 GAGGAATATCTGAAGGAAGATGG - Intergenic
948458434 2:238118001-238118023 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458442 2:238118030-238118052 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458512 2:238118284-238118306 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458630 2:238118715-238118737 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458661 2:238118815-238118837 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458740 2:238119140-238119162 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458754 2:238119183-238119205 GAGGAGGAATGGATGGAGGAGGG + Intronic
1168884421 20:1236698-1236720 GAAGATTAAAGGAAGGAATAAGG - Intronic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169276778 20:4238498-4238520 GAGGAGTAACTGAAAGAGTAAGG + Intronic
1169438429 20:5613695-5613717 AAGGATTTAGGGAAGGAGCATGG - Intergenic
1169816875 20:9666098-9666120 GAAGAAGAAGGGAAGGAGGAAGG + Intronic
1170662665 20:18358243-18358265 GAGGATGAACAGGAGGATGAAGG + Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1172387206 20:34542337-34542359 GGGGACTAAGGGAAGGTGGAAGG - Intergenic
1172815824 20:37685149-37685171 GAGGAGGAAGGGAAGGAAGAGGG + Intergenic
1173002043 20:39111640-39111662 GAGGAGGAAGGGGAGGAGGAAGG + Intergenic
1173438820 20:43057256-43057278 GGGGAATGAAGGAAGGAGGAAGG + Intronic
1173550179 20:43927620-43927642 GAGGAAGGAAGGAAGGAGGAAGG - Intronic
1173719559 20:45242809-45242831 GAGAAGTAAAGGTAGGAGGAAGG - Intergenic
1174166117 20:48584665-48584687 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
1175059626 20:56230355-56230377 GAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1175120157 20:56710814-56710836 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175120182 20:56710889-56710911 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175293671 20:57894652-57894674 AAGGAAGAAGGGAAGGAGGAAGG + Intergenic
1175298807 20:57928507-57928529 GAGGAGAAAAGGGAGGAGGAAGG - Intergenic
1175717139 20:61262766-61262788 GAGGAGAGAGGGAAGGAGGAAGG - Intronic
1176064893 20:63189200-63189222 GAGGATGATCGCCAGGAGGATGG + Intergenic
1176160624 20:63645975-63645997 GAGGAAGAAAGGAAGGAGGGAGG + Intronic
1177942234 21:27425143-27425165 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
1178016106 21:28347533-28347555 GAGAAAGAAAGGAAGGAGGAAGG - Intergenic
1179048694 21:37870034-37870056 GAGGATGAAGGGAAGGAGAAAGG + Intronic
1179346628 21:40564476-40564498 GAGAAGTAGAGGAAGGAGGAGGG - Intronic
1179425557 21:41275509-41275531 GACGATTAAGACAAGGAGGATGG - Exonic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1180066264 21:45414060-45414082 GAGGAGGATCGGGAGGAGGAGGG + Intronic
1181106318 22:20577841-20577863 CAGGATTTATGGAAAGAGGAAGG + Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181534389 22:23534125-23534147 GAGGAAGAAGGGAGGGAGGAAGG + Intergenic
1181624809 22:24116052-24116074 GAGAATTAAAGGAAGGAGGCTGG - Intronic
1182193962 22:28494782-28494804 GAGGAGGAAAGGAAGGGGGAAGG + Intronic
1182268536 22:29138019-29138041 GATGTTTAGAGGAAGGAGGACGG - Intronic
1183266199 22:36827339-36827361 GAGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183296882 22:37035060-37035082 GAGGATTCAGAGAAGGAGGCAGG - Intergenic
1184001173 22:41674712-41674734 GAGGATAAAAGGATGAAGGATGG + Exonic
1184412327 22:44332332-44332354 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
1184449712 22:44575756-44575778 GAGGAAGAAGGGAAGGAGGAAGG + Intergenic
1185116003 22:48938623-48938645 GAGAAGTGAGGGAAGGAGGAAGG - Intergenic
1185261778 22:49869964-49869986 GAGGAGTGAGGGAGGGAGGAAGG - Intronic
1203290081 22_KI270735v1_random:28137-28159 GAGAAAGAAGGGAAGGAGGAAGG - Intergenic
950711928 3:14819294-14819316 GAGGATGAACCCAAGGACGAGGG + Exonic
951520875 3:23609831-23609853 AAGGAAGAAGGGAAGGAGGAAGG + Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952238884 3:31509348-31509370 GAGGATTAACTTAAGTAGCAGGG + Intergenic
952358518 3:32606430-32606452 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
953438217 3:42896658-42896680 CAGGATTAAGGGAATGAGGGGGG + Intronic
953637721 3:44676865-44676887 GAGGACTAATAGACGGAGGAGGG + Intergenic
953796661 3:45991452-45991474 GGGGAAGAAGGGAAGGAGGAGGG - Intronic
954407192 3:50351771-50351793 GAGGTGTAAGGGAAGGAGGGAGG + Intronic
954503482 3:51044429-51044451 GAGGATGGAGGGTAGGAGGAGGG + Intronic
954635414 3:52068393-52068415 GAGGAAGAAAGGCAGGAGGAAGG + Intergenic
954748114 3:52798490-52798512 GAGGAGAAAGGGGAGGAGGAGGG - Intronic
954992199 3:54851252-54851274 GAGGCTTAAGGAAAGGATGAAGG + Intronic
955307446 3:57848530-57848552 GAGGAAAAAGGGAAGGAAGAAGG - Intronic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
956048384 3:65220701-65220723 GAGGATGAGCGGAAGCAGGGTGG - Intergenic
956240950 3:67130104-67130126 GAGTAGTAAAGGAAGGAGGAGGG - Intergenic
956988259 3:74730174-74730196 GAGAGTTAAGGAAAGGAGGAAGG - Intergenic
957508850 3:81160907-81160929 GAGGAGTAAAGGAAGGAAGATGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
957893478 3:86389305-86389327 GAGGATTAGGGGAGAGAGGAAGG - Intergenic
958269906 3:91486796-91486818 GAGTAAGAACGGAAGCAGGAGGG + Intergenic
958822622 3:98993041-98993063 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
958849940 3:99312468-99312490 GAGGATATAGGGAGGGAGGAGGG + Intergenic
959146775 3:102556388-102556410 GAGGTTTAAAGGAAAGAGCATGG + Intergenic
959185257 3:103038662-103038684 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
959440220 3:106365080-106365102 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
959584364 3:108012360-108012382 GAAGAGGAAAGGAAGGAGGAAGG + Intergenic
959901299 3:111664508-111664530 GAGCATAAAGGGAAGGAGGAAGG + Intronic
963265858 3:143239353-143239375 AAGAATGAACGGAAGAAGGAAGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964287450 3:155134292-155134314 GAGGATTAATAGAGGGTGGAGGG - Intronic
964458667 3:156897047-156897069 GAGGATAGAGGGTAGGAGGAAGG + Intronic
966559197 3:181300102-181300124 GAGGAGTAGGGGAAGGAGAAGGG + Intergenic
966739464 3:183218747-183218769 GAGGGTTAGCGGAAGGAAGGGGG - Intronic
966937397 3:184719974-184719996 GAGACTCAAGGGAAGGAGGAAGG + Intergenic
967122753 3:186397983-186398005 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967287595 3:187888642-187888664 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967553744 3:190830994-190831016 GAGAAAGAACGGAAAGAGGAAGG + Intergenic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
967986933 3:195102052-195102074 GAGGAGGAATGGAAGGAGGAAGG + Intronic
967987726 3:195107600-195107622 GAGGAGGAAGGGGAGGAGGAGGG + Intronic
967993829 3:195151872-195151894 GAAGATTAAGGGAGGGAGGGAGG + Intronic
968058921 3:195713331-195713353 GAGGAGTTAGGGCAGGAGGACGG - Intergenic
968837537 4:2976210-2976232 AAGGAAGAAGGGAAGGAGGAGGG - Intronic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
969049583 4:4363300-4363322 GAGGATTAACTGAAGGATTTAGG + Intronic
969143565 4:5100776-5100798 AAGGAATAAAGGAAGGAAGAAGG - Intronic
970029374 4:11658188-11658210 AAGGAGGAACGGAAGGTGGAAGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970410591 4:15803794-15803816 GAGGAGGGAGGGAAGGAGGAAGG - Intronic
972016102 4:34248358-34248380 GAGTAGGAAGGGAAGGAGGAGGG - Intergenic
972388468 4:38590273-38590295 GAGGATGTAAGGAAGGAGGGAGG - Intergenic
972439071 4:39067582-39067604 GAGAATTAACTGAAGAAAGAAGG - Intronic
972693168 4:41419630-41419652 GAGGAAGAAAGGAAGGAGGAAGG - Intronic
972693189 4:41419715-41419737 GAGGAAGAAAGGAAGGAGGAAGG - Intronic
973248273 4:48034080-48034102 GAGCATTAGAGGAAGGAGGCTGG + Intronic
973567602 4:52204003-52204025 GAGGATAAAGGGAAGAAGGAAGG - Intergenic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
975752728 4:77540417-77540439 GAGTACTAGAGGAAGGAGGAAGG - Intronic
977257803 4:94758871-94758893 GAGGATGAAGGGACAGAGGAGGG - Intronic
977499181 4:97816840-97816862 GAGAAAGAAAGGAAGGAGGAAGG - Intronic
978901089 4:113950288-113950310 GAGCATAAAAGGAAGGGGGAGGG - Intronic
979418981 4:120479867-120479889 GAGGCTTATTGGAAGGTGGAAGG - Intergenic
979879118 4:125931727-125931749 GAGGGTGAAGGGTAGGAGGAAGG - Intergenic
979969696 4:127118978-127119000 GAGTTTTAAAGGCAGGAGGAGGG - Intergenic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
980148679 4:129021099-129021121 GAGGATGAACAGAAGTAGGGTGG + Intronic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
981001018 4:139829129-139829151 AAGGAGTAAGGGAGGGAGGAAGG + Intronic
981182763 4:141765094-141765116 GAGGATGAAGGGCAGGAGGAGGG - Intergenic
981754095 4:148122566-148122588 GAGGAAGAAGGGAAAGAGGAAGG - Intronic
983155643 4:164344223-164344245 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
983971041 4:173874711-173874733 GAAGAGGAACGGAAGAAGGAAGG + Intergenic
985163799 4:187071407-187071429 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
986796521 5:11218022-11218044 GAGGAAGAAGGGAGGGAGGAAGG - Intronic
986796528 5:11218044-11218066 GAGGAAGAAGGGAAGGAGGAAGG - Intronic
986896653 5:12379157-12379179 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
988629757 5:32916418-32916440 GTAGATTAACAGAATGAGGATGG + Intergenic
989408485 5:41089790-41089812 GGGGATTAGGGGAAGGAGAAGGG - Intergenic
989738967 5:44746772-44746794 GAGGGTTAAGGGTGGGAGGAGGG - Intergenic
990616157 5:57510703-57510725 GAGGAGGAAAGGAAGGAGGAGGG - Intergenic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
992144764 5:73835081-73835103 CAGCATCCACGGAAGGAGGAGGG + Intronic
992161333 5:74006542-74006564 GAGGACTACTGGAGGGAGGAGGG - Intergenic
992844478 5:80731542-80731564 TAGGATTAATGAAAGAAGGAAGG + Intronic
993061807 5:83047638-83047660 GAAGATTCATGGTAGGAGGAGGG + Intergenic
993465647 5:88243231-88243253 GAGGATGGAAGGTAGGAGGAGGG - Intronic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
995789442 5:115868915-115868937 GAGGATGAAGGGAGGGAGGGAGG + Intronic
996547886 5:124699994-124700016 GAGGAGTAAGGGCAGGATGAGGG - Intronic
998398268 5:141833735-141833757 GAGGAGTGAAGGAGGGAGGAAGG + Intergenic
998471329 5:142386232-142386254 GGGGATGAAGGGAAGGAGGTTGG + Intergenic
999298581 5:150476097-150476119 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1000285683 5:159824291-159824313 GAAGATGAAAGGAAGAAGGAAGG + Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002891251 6:1334524-1334546 AAGGTTTAAAGGAGGGAGGAGGG + Intergenic
1003477610 6:6498538-6498560 GAGGATAAAGGGGAGGAAGAGGG - Intergenic
1003712128 6:8603809-8603831 GAGGAAGGAAGGAAGGAGGAGGG - Intergenic
1004275244 6:14230297-14230319 GAGGATGAAGGGCAGGAGGGAGG - Intergenic
1004945669 6:20609921-20609943 GAGGATGGAGGGCAGGAGGAGGG - Intronic
1005036035 6:21555643-21555665 GAAGATTTAAGGCAGGAGGAAGG + Intergenic
1005379990 6:25224233-25224255 GAGGAGTGAGGGAAGGAGAAGGG - Intergenic
1005891274 6:30140730-30140752 GTGGGTTGAAGGAAGGAGGAAGG + Intronic
1005940758 6:30557533-30557555 GGGCTGTAACGGAAGGAGGAAGG + Intronic
1006025363 6:31143317-31143339 GAGGAGGCCCGGAAGGAGGAGGG - Exonic
1006491942 6:34395105-34395127 GAGGCTTAACTAAAGGAGGCTGG + Intronic
1006525034 6:34597002-34597024 GAGGATGTATGGAGGGAGGAGGG - Intronic
1006827743 6:36948626-36948648 GAGGAAGGAGGGAAGGAGGAAGG - Intronic
1007981720 6:46166208-46166230 GAGGAGGGAGGGAAGGAGGAAGG - Intronic
1008362314 6:50635472-50635494 GAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1008635580 6:53407231-53407253 TGGGATTTACGGGAGGAGGAAGG + Intergenic
1008764434 6:54894098-54894120 GAGGCTTAACTTAAGGATGAGGG + Intronic
1009011693 6:57850976-57850998 GAGGATTAACTCCAGGCGGATGG + Intergenic
1009330111 6:62408703-62408725 GAGGATGGAGGGGAGGAGGAGGG + Intergenic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1010298657 6:74232087-74232109 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1010377377 6:75186969-75186991 GAGGGTTGAAGGTAGGAGGAGGG + Intronic
1010704361 6:79089983-79090005 GAGGAAGAAAGGAAGGAGAAAGG - Intergenic
1010800503 6:80168803-80168825 GAGGAAGAACGGAAGGAGATTGG + Intronic
1011568219 6:88703528-88703550 GACTACTAAAGGAAGGAGGAAGG + Intronic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012370718 6:98503358-98503380 GAGGAAGAAAGGAAGGAAGAAGG - Intergenic
1012469355 6:99553594-99553616 GAAGATTTACTGAAGGAGGAAGG - Intronic
1012633413 6:101502993-101503015 GAGGAATAACAGATGGAGGTGGG + Intronic
1012848940 6:104424225-104424247 AAGGAGGAAGGGAAGGAGGAAGG + Intergenic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1014550180 6:122781271-122781293 GAGGAAGAATGGAAGGAGGAGGG - Intronic
1014657745 6:124129256-124129278 GAGGAGAAAGGGAAGAAGGAAGG + Intronic
1014884838 6:126767116-126767138 GGGGAGGAAGGGAAGGAGGAAGG - Intergenic
1014942300 6:127456950-127456972 GAGGAGAAAGGGAAGGAGGGAGG - Intronic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1015463097 6:133516235-133516257 GAGGGTGAAGGGTAGGAGGAGGG + Intronic
1017602073 6:156094650-156094672 GAGAAGTAGGGGAAGGAGGAAGG - Intergenic
1017819053 6:158036622-158036644 GAGGATGGAGGGTAGGAGGAGGG + Intronic
1018204291 6:161422698-161422720 GAGGAAAAAAGGAAGAAGGAAGG + Intronic
1018304356 6:162439315-162439337 GAGGGGTAAAGGAAGGGGGAAGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018639007 6:165889902-165889924 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639021 6:165889946-165889968 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639042 6:165890020-165890042 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1019549614 7:1595416-1595438 GAGGATGGATGGAGGGAGGATGG - Intergenic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1019721261 7:2573122-2573144 AGGGACTCACGGAAGGAGGAGGG - Intronic
1020459021 7:8407143-8407165 GAGGAGGAAAGGAAGGAGGGAGG - Intergenic
1020646420 7:10819710-10819732 GAGGAATAGCTGAAGTAGGAAGG + Intergenic
1020887719 7:13840066-13840088 GAGGAGAAAAGAAAGGAGGAAGG + Intergenic
1022113387 7:27244463-27244485 GAGGGTTATGGGAAGGAGGCTGG - Intronic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022677285 7:32511775-32511797 GAGGAGTAAGGGGAGGAAGAAGG + Intronic
1023375165 7:39548680-39548702 GAAGATTAATGGAAGGAGAAGGG - Intergenic
1023427093 7:40049213-40049235 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1025236235 7:57236627-57236649 GAGGAATAAGAGAAAGAGGAGGG - Intergenic
1025898078 7:65722598-65722620 AAGGAAAAAGGGAAGGAGGAAGG - Intergenic
1026602925 7:71791550-71791572 GAGGATGGAGGGTAGGAGGAGGG + Intronic
1026632402 7:72048781-72048803 AAGGAAAAAAGGAAGGAGGAAGG - Intronic
1026638870 7:72106846-72106868 GAGGAGGGAAGGAAGGAGGAAGG + Intronic
1026804062 7:73418564-73418586 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028285189 7:88987969-88987991 GAGAAGAAAAGGAAGGAGGAGGG - Intronic
1029356847 7:100058400-100058422 GAGATTTAAGGGCAGGAGGAGGG - Intronic
1029893603 7:103958108-103958130 AAGGATTAACTAAAGCAGGATGG + Intronic
1030376853 7:108762325-108762347 GAGGGTTGAGGGCAGGAGGAGGG + Intergenic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031046949 7:116901510-116901532 GAGGATGAAGGGTGGGAGGAGGG + Intronic
1031083759 7:117282447-117282469 GAGGAGGAGAGGAAGGAGGAGGG + Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG + Intronic
1032655946 7:133929714-133929736 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1032884653 7:136124517-136124539 GAGGATCATCACAAGGAGGAGGG + Intergenic
1033062127 7:138119252-138119274 AAGGAGTGACGGAGGGAGGAAGG + Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1034014369 7:147566305-147566327 GAGGAGTAAGAGGAGGAGGAGGG + Intronic
1034995146 7:155572211-155572233 GAGGAAGGAGGGAAGGAGGAAGG + Intergenic
1037112089 8:15175535-15175557 GAGGATGGAGGGTAGGAGGAAGG + Intronic
1037339817 8:17832286-17832308 CAGAAGGAACGGAAGGAGGAAGG + Intergenic
1037407174 8:18555159-18555181 TAGGATGAACGGAAGGAGAGCGG + Intronic
1037554660 8:20010505-20010527 GAGGCTGAAGGGTAGGAGGAGGG - Intergenic
1037609848 8:20466779-20466801 GATGATTAAGGAAAGGAAGAGGG - Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1038232402 8:25714757-25714779 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
1038898287 8:31812556-31812578 GAGGAGGAAGGGAAGGAGGAAGG - Intronic
1038898291 8:31812568-31812590 GAGGAGGAAGGGGAGGAGGAAGG - Intronic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1039674153 8:39641480-39641502 GAGGATGGAGGGTAGGAGGAGGG - Intronic
1039774286 8:40720406-40720428 GATGATTACAGCAAGGAGGAGGG - Intronic
1040509301 8:48079700-48079722 GAGGAGTAAGGAAGGGAGGAAGG + Intergenic
1041444223 8:57932050-57932072 GAGGAAGAAAGGAAGAAGGAAGG + Intergenic
1042279089 8:67035915-67035937 GAGGAAGAAGGGAAGGAGAAAGG + Intronic
1042492190 8:69412234-69412256 GAGGATGGAGGGTAGGAGGAGGG + Intergenic
1043189177 8:77195405-77195427 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1043195476 8:77287297-77287319 GAGGATGAAAGGAAGGCCGAGGG + Intergenic
1044242782 8:89906421-89906443 GAGGATGAAGGGTGGGAGGAGGG - Intronic
1044458057 8:92412018-92412040 GAGAAGGAAGGGAAGGAGGAGGG + Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044983227 8:97736341-97736363 GAGGGTGAAGGGAAGGGGGAGGG + Intergenic
1045411977 8:101929246-101929268 GAGGAGGAAGGGATGGAGGAAGG + Intronic
1045474644 8:102542581-102542603 GAGGAGTAGGGGGAGGAGGAGGG - Intergenic
1045628175 8:104082230-104082252 GAGAATTAAAGGAAGGAGAGAGG + Intronic
1045770844 8:105738162-105738184 GAGGATTGAGGGTGGGAGGAGGG - Intronic
1046011825 8:108557753-108557775 AGGGAGTAAGGGAAGGAGGAAGG - Intergenic
1047196173 8:122723579-122723601 GGGGATTAGGGGAAGGTGGAAGG - Intergenic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047541782 8:125774642-125774664 GAGGCTGAATGGCAGGAGGATGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1049350664 8:142162831-142162853 GAGGATGGATGGATGGAGGATGG + Intergenic
1049350770 8:142163401-142163423 ATGGATTGACGGATGGAGGATGG + Intergenic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1049371991 8:142272369-142272391 GTGGATGGATGGAAGGAGGAAGG - Intronic
1049372052 8:142272613-142272635 GTGGATGGATGGAAGGAGGAAGG - Intronic
1049474778 8:142791782-142791804 GAGGATGGATGGATGGAGGATGG - Intergenic
1049478835 8:142810453-142810475 GTGGAGGAAGGGAAGGAGGAAGG - Intergenic
1049887935 9:40785-40807 GGGGATTCATGGATGGAGGATGG + Intergenic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050119185 9:2290639-2290661 GAGGAGTTAGGAAAGGAGGAGGG + Intergenic
1050646241 9:7722784-7722806 GAGGATAAAGGGTGGGAGGAGGG - Intergenic
1050912201 9:11085605-11085627 GAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1051884434 9:21875544-21875566 GAGGGTTAAGGGTGGGAGGAGGG - Intronic
1052205689 9:25837160-25837182 CAGGATTGAAGGAAAGAGGAAGG + Intergenic
1052305684 9:27006675-27006697 GAGGAGGAAGGGAAGGAGGCAGG + Intronic
1052918119 9:33939767-33939789 GAGGAGGAAGGGGAGGAGGAAGG + Intronic
1052918124 9:33939779-33939801 GAGGAGGAAGGGGAGGAGGAAGG + Intronic
1052918129 9:33939791-33939813 GAGGAGGAAGGGGAGGAGGAAGG + Intronic
1052918134 9:33939803-33939825 GAGGAGGAAGGGGAGGAGGAAGG + Intronic
1053100533 9:35368202-35368224 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1053391465 9:37739453-37739475 AAGGATTAATGGTAGGAGGCTGG - Intronic
1053516519 9:38735042-38735064 GAGGAAGGAAGGAAGGAGGAAGG - Intergenic
1053580533 9:39399419-39399441 GAGGAAGAAGGGAAAGAGGAAGG - Intergenic
1053750585 9:41250517-41250539 GATGAATGAGGGAAGGAGGAGGG + Intergenic
1053845029 9:42227497-42227519 GAGGAAGAAGGGAAAGAGGAAGG - Intergenic
1054102120 9:60958224-60958246 GAGGAAGAAGGGAAAGAGGAAGG - Intergenic
1054138669 9:61456127-61456149 GAGGATGGAGGGTAGGAGGAGGG - Intergenic
1054335216 9:63800752-63800774 GATGAATGAGGGAAGGAGGAGGG - Intergenic
1054584239 9:66948639-66948661 GAGGAAGAAGGGAAAGAGGAAGG + Intergenic
1055018526 9:71644969-71644991 GAAGAAGAAGGGAAGGAGGAAGG - Intergenic
1055270007 9:74547310-74547332 AAGGATGAAAGGAAGAAGGATGG + Intronic
1056130137 9:83576584-83576606 GAGGATAAAGGGTTGGAGGAGGG - Intergenic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1057029441 9:91763172-91763194 GAGGACTGAAGGTAGGAGGAGGG + Intronic
1057521681 9:95765310-95765332 GAGGAGTAAGGAAGGGAGGAAGG + Intergenic
1058156139 9:101518025-101518047 GAGGAGAAAGGGAGGGAGGAAGG - Intronic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1060878579 9:127101463-127101485 GAGGATTGAAGGATGGAGGGAGG - Intronic
1060943395 9:127556198-127556220 GAGGAATACAGGCAGGAGGAAGG + Intronic
1061911561 9:133727880-133727902 GAGGAATTAGGGATGGAGGATGG + Intronic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062599392 9:137313139-137313161 GAGGCTTGAGGGAAAGAGGAGGG + Intronic
1062615273 9:137393382-137393404 GTGGATGAACGGAAGGGTGAGGG + Intronic
1185499105 X:584181-584203 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1185499183 X:584483-584505 GAGGAAAAAGGGGAGGAGGAGGG + Intergenic
1185661931 X:1735208-1735230 GAGGATGAAGGGGAGGAGGAAGG - Intergenic
1185698412 X:2213255-2213277 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698479 X:2213482-2213504 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698483 X:2213497-2213519 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698487 X:2213512-2213534 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698496 X:2213543-2213565 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698500 X:2213558-2213580 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698519 X:2213621-2213643 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698523 X:2213636-2213658 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698604 X:2213913-2213935 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698627 X:2213991-2214013 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698689 X:2214193-2214215 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185698718 X:2214288-2214310 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1185921668 X:4100001-4100023 GAGGATGAAGGGTGGGAGGAGGG - Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186206328 X:7204657-7204679 GAGGAAAAAAGGAAGGAGGAAGG - Intergenic
1186258500 X:7749578-7749600 AAGGAAGAAAGGAAGGAGGAAGG + Intergenic
1187898816 X:24008665-24008687 GAGAATTCAGGGATGGAGGATGG - Intronic
1188148236 X:26640718-26640740 GAGGATGGATGGTAGGAGGAGGG - Intergenic
1190749870 X:53352734-53352756 GGGGTTTGAGGGAAGGAGGAAGG + Intergenic
1191128616 X:56984553-56984575 GAGATTTATGGGAAGGAGGAAGG + Intronic
1192145333 X:68678362-68678384 GAGTAAAAAGGGAAGGAGGAAGG + Intronic
1192756967 X:74056523-74056545 GAGGAATACAGGGAGGAGGAAGG - Intergenic
1192836840 X:74808839-74808861 GAGCTTTAACGGCTGGAGGAGGG + Intronic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1195465216 X:105172231-105172253 GAGGAGAAAGGGAAGGAGGTTGG + Intronic
1195563652 X:106315931-106315953 GAGGTTGGAGGGAAGGAGGAAGG + Intergenic
1195977373 X:110542269-110542291 GAGGATGGAGGGAGGGAGGATGG - Intergenic
1196765366 X:119237070-119237092 GGGGATTCCTGGAAGGAGGAGGG + Intronic
1197923847 X:131626064-131626086 GAGAATTTAAAGAAGGAGGAGGG + Intergenic
1199197985 X:145054665-145054687 GAGGGTTCAGGGTAGGAGGACGG + Intergenic
1199474348 X:148229296-148229318 CAGGATGAATGGAAGGGGGAGGG - Intergenic
1201066864 Y:10105404-10105426 GATGAAGAAGGGAAGGAGGAGGG + Intergenic
1201451172 Y:14116273-14116295 GAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1201765624 Y:17571311-17571333 GGGGATGAACGGATGGAGGTAGG + Intergenic
1201835928 Y:18334678-18334700 GGGGATGAACGGATGGAGGTAGG - Intergenic
1202234137 Y:22690652-22690674 GAAGAAGAAAGGAAGGAGGAAGG + Intergenic
1202309021 Y:23505514-23505536 GAAGAAGAAAGGAAGGAGGAAGG - Intergenic
1202561779 Y:26165074-26165096 GAAGAAGAAAGGAAGGAGGAAGG + Intergenic