ID: 1018411565

View in Genome Browser
Species Human (GRCh38)
Location 6:163554132-163554154
Sequence GAACCCTAGCTGGCTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018411563_1018411565 -3 Left 1018411563 6:163554112-163554134 CCTCAGGAGCTCAGAGGGGAGAA 0: 1
1: 0
2: 4
3: 41
4: 360
Right 1018411565 6:163554132-163554154 GAACCCTAGCTGGCTGCTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 129
1018411557_1018411565 30 Left 1018411557 6:163554079-163554101 CCCTGGCTTGGTGTCTCTCAGCT 0: 1
1: 0
2: 1
3: 23
4: 287
Right 1018411565 6:163554132-163554154 GAACCCTAGCTGGCTGCTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 129
1018411558_1018411565 29 Left 1018411558 6:163554080-163554102 CCTGGCTTGGTGTCTCTCAGCTA 0: 1
1: 0
2: 0
3: 108
4: 2410
Right 1018411565 6:163554132-163554154 GAACCCTAGCTGGCTGCTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018411565 Original CRISPR GAACCCTAGCTGGCTGCTTC TGG Intronic
900979251 1:6036967-6036989 GAATCCTCTCAGGCTGCTTCTGG - Intronic
904047681 1:27618447-27618469 GAACCCAGGCTGTCTGCTTTAGG + Intronic
904616777 1:31754238-31754260 CAAGCCCAGCTGGCTGCTCCTGG + Intronic
905626002 1:39491191-39491213 GAACCCGGGCCGGCTGCTGCGGG + Intergenic
906526588 1:46496837-46496859 GAGCCCTGGCTTGCTGCTCCCGG + Intergenic
908836335 1:68232476-68232498 GAACCCGAGCCGGCTGCGCCGGG - Exonic
909480532 1:76125174-76125196 GAAACCTTGTTGGCTGCTCCTGG - Intronic
916433950 1:164759456-164759478 GAATCCTGGGTGGCTGGTTCAGG + Intronic
919120944 1:193339505-193339527 AAGCCCTAGCTGACTGCGTCAGG + Intergenic
922164386 1:223102909-223102931 GTTCCCCAGCTGGCTTCTTCTGG - Intergenic
922854815 1:228765807-228765829 GAACCCAAGCTGGGCGCTGCAGG - Intergenic
923586810 1:235280566-235280588 GAACCCAAGATGGCAGCTTCAGG + Intronic
924330395 1:242935581-242935603 GAACCCAGGCTGTCTGATTCTGG + Intergenic
1067769702 10:49114743-49114765 GAACTCTGTCTGGCTGCCTCAGG - Intronic
1068754312 10:60633794-60633816 GAACCCAATATGGATGCTTCAGG - Intronic
1069688324 10:70333597-70333619 GACCCCTGCATGGCTGCTTCTGG - Intronic
1070156894 10:73840917-73840939 GAAGCGTGGCTGGCTGCCTCCGG - Intronic
1070248125 10:74750777-74750799 GAACCCAGGCTGCCTGCTTCTGG + Intergenic
1071913871 10:90268221-90268243 GAAGCTTAGCTGGATGATTCTGG + Intergenic
1073492310 10:103861123-103861145 GAAGACTCGCTGGCTGCCTCTGG + Intergenic
1074014263 10:109517769-109517791 GCAGCTTAGCTGGGTGCTTCTGG + Intergenic
1074079595 10:110157116-110157138 GAAACCCAGCTTCCTGCTTCTGG - Intergenic
1079573917 11:21979453-21979475 GAAGCCTAGCAGGCTGGCTCAGG + Intergenic
1080248541 11:30207081-30207103 CAACCCTAGGTGGCCGCTTAGGG - Intergenic
1083782467 11:64925482-64925504 GAACCCTAACTGGACTCTTCGGG + Exonic
1083869778 11:65479681-65479703 GAGCCCTAGCTCCCTGCTCCAGG - Intergenic
1088644934 11:111910593-111910615 TAAACATAGCTGTCTGCTTCAGG + Intronic
1090700507 11:129290789-129290811 GTTTCCTAGCTGGCTGTTTCTGG - Intergenic
1094543950 12:31386501-31386523 GAACCCTTTCTGGGTGTTTCAGG - Exonic
1095910754 12:47424367-47424389 GCACCCTAGCTGCCTGCCTGTGG + Intergenic
1096222221 12:49838006-49838028 GAATCCTACCTGGTTTCTTCAGG - Exonic
1098501956 12:71203064-71203086 GGAGCCTAGCTAGCTGCTGCTGG + Intronic
1101857647 12:108457185-108457207 GTGTCCTAGCTGGTTGCTTCTGG - Intergenic
1102028054 12:109724599-109724621 GAACCCTGGCAGGTTGCTTCAGG - Intronic
1102919800 12:116783339-116783361 CAACCCTAGGGGGATGCTTCTGG + Intronic
1103267814 12:119645800-119645822 GCACCCAAGCTGTCTGCTCCTGG + Intergenic
1103897112 12:124280020-124280042 GGACCCACGCTGGCTGCCTCAGG - Intronic
1104608162 12:130205033-130205055 GGAGCTGAGCTGGCTGCTTCTGG - Intergenic
1105045614 12:133000993-133001015 GAGCCCAAAGTGGCTGCTTCTGG - Intronic
1105923810 13:24988391-24988413 GCACTCCAGCTGGCTCCTTCTGG + Intergenic
1109430723 13:62230430-62230452 GACCTCTTGCTGGCTTCTTCAGG - Intergenic
1113941093 13:114018984-114019006 GAAGCCCAGCTGCCTGCTTGAGG + Intronic
1114407729 14:22472192-22472214 GAACCCAAGCAGGCTGGCTCCGG - Intergenic
1116779470 14:49220591-49220613 GCACCTTAGCTGGGTGGTTCTGG + Intergenic
1121055328 14:90847098-90847120 GCAGCCTAGCTGGATGGTTCTGG - Intergenic
1124049123 15:26178771-26178793 GAACGGCTGCTGGCTGCTTCTGG + Intergenic
1127982505 15:64045511-64045533 GCACCATAGCTGGCTGCCTCGGG - Intronic
1129038740 15:72666256-72666278 GAACCCTCCCTGGCCGCTCCTGG - Exonic
1129211150 15:74070974-74070996 GAACCCTCCCTGGCCGCTCCTGG + Exonic
1129399253 15:75270113-75270135 GAACCCTCCCTGGCCGCTCCTGG - Exonic
1129728283 15:77915248-77915270 GAACCCTCCCTGGCCGCTCCTGG + Intergenic
1133170527 16:3980102-3980124 CACCTCTAGCTGGCGGCTTCAGG + Intronic
1133234557 16:4381876-4381898 GAACGCTGGCCGGCTGCTCCTGG + Exonic
1133776707 16:8902111-8902133 GATCCCGAGCTGGCTGCTAGTGG - Exonic
1135505550 16:23033075-23033097 TGACCCAAGATGGCTGCTTCAGG + Intergenic
1135922716 16:26665440-26665462 GAACTCAGGCTGGCTGCTGCTGG + Intergenic
1138060993 16:53890044-53890066 GAACTCTAGAAGGCTGCCTCTGG + Intronic
1138578940 16:57927055-57927077 GGACCTAAGCTGGCAGCTTCTGG + Intronic
1139546689 16:67653042-67653064 GAGCCCGAGCTGGCGGCTCCGGG + Exonic
1139661421 16:68423695-68423717 GAACCCCAGATCTCTGCTTCAGG + Intronic
1141188409 16:81805676-81805698 TAGCCAAAGCTGGCTGCTTCTGG + Intronic
1142164368 16:88577931-88577953 GAAACCCTGCTGGCAGCTTCTGG - Intronic
1142171589 16:88625324-88625346 CAACCCACACTGGCTGCTTCTGG - Intronic
1146234080 17:31141699-31141721 GTACCTTAGCTGGATGCCTCTGG + Intronic
1149432629 17:56606434-56606456 GAACCATATCTGGCTACCTCTGG + Intergenic
1152745400 17:82036459-82036481 GAACCCAAGCTGGCTGGGGCTGG + Intronic
1153252732 18:3138880-3138902 GAACCCCAGCAGTCTGGTTCAGG - Intronic
1153836729 18:8970430-8970452 CCACCCTAGAGGGCTGCTTCTGG + Intergenic
1166738904 19:45102481-45102503 GAACAGTAGCTGGCTGTTGCAGG + Intronic
1166874708 19:45890515-45890537 GCACCCTAGCTCCCTGCTCCAGG - Exonic
932089974 2:68797698-68797720 GAAACCTGGCTGGCTGCTGTGGG - Intronic
932667434 2:73708495-73708517 CACCCCTGGCTGGCTGCATCTGG + Intergenic
938135549 2:128753612-128753634 GAAGCCCAGCTGGCTTCCTCTGG - Intergenic
939884871 2:147670724-147670746 GAACCCTAGTTTGCTGCTTAGGG + Intergenic
940847662 2:158659341-158659363 GAAGCCTAGCTGGCTGGCTGAGG - Intronic
941279888 2:163536810-163536832 GAAGTGTAGCTGGCTGCTTCTGG - Intergenic
946458835 2:219851567-219851589 TAACCCTGGCTGCCTGCGTCTGG + Intergenic
947942323 2:234068930-234068952 GAAACTTAGCTGGGTGGTTCTGG + Intronic
1173325856 20:42033007-42033029 GCAACCTAGTTGGATGCTTCTGG - Intergenic
1175804121 20:61817859-61817881 GAACCCTGGCTGGCTCCCTATGG - Intronic
1180613950 22:17115520-17115542 TGACCCTAGCTTGCTGCTTCTGG - Exonic
1182199789 22:28556690-28556712 GCAGCTTAGCTGGCTGATTCTGG + Intronic
1183230097 22:36576712-36576734 GACCCCAAGCGGGCTGCATCTGG - Intronic
951032964 3:17903345-17903367 GAACCCTATCTTGCTTCTCCTGG - Intronic
951225374 3:20114959-20114981 GATGCCTAGCTGGCTGGTTCTGG - Exonic
951846702 3:27092391-27092413 GAAGCATAGCAGACTGCTTCAGG + Intergenic
953403926 3:42651053-42651075 GAACCCAAGCAGCCTGGTTCTGG - Intergenic
955103571 3:55875023-55875045 GATCCCTTGCTGGCTGACTCTGG - Intronic
955270845 3:57497205-57497227 AAATCCTAGCTGGCTTCTTTAGG + Intronic
959447433 3:106457583-106457605 GTGCCTTAGCTGGATGCTTCTGG - Intergenic
962368726 3:134803438-134803460 GATCCCTTGCTGGCTCCCTCAGG - Intronic
967055911 3:185827996-185828018 GAACCCTATCAGGTGGCTTCTGG + Intergenic
967801710 3:193669154-193669176 GAGCCCTGCCTGGCTTCTTCAGG - Intronic
968069034 3:195774426-195774448 GCACCCTAGATGGCTGCCTCTGG - Intronic
975703451 4:77088891-77088913 GAGCTCTAGCTGGGTGGTTCTGG + Intergenic
985839859 5:2298182-2298204 GAAGCCCACCTGGCTGCGTCTGG + Intergenic
986304465 5:6505122-6505144 AACCCCAAGCTGGCTCCTTCAGG + Intergenic
990345515 5:54866938-54866960 GCACCCAAGCTGCCTTCTTCTGG + Intergenic
991427162 5:66503685-66503707 GAAGCCTAGCTGGCTTCATGCGG - Intergenic
992011283 5:72530246-72530268 TAACTATTGCTGGCTGCTTCTGG + Intergenic
992815991 5:80438899-80438921 GAACCCAAGTAGGCTGTTTCTGG - Exonic
994710055 5:103255870-103255892 GAACCATAGGTGGCAGCTCCAGG + Intergenic
995030057 5:107470242-107470264 GAACACTAACTTGCTGCTTCTGG + Intronic
995140168 5:108727385-108727407 GGACTCCAGCTGGCTCCTTCCGG - Intergenic
995487775 5:112656553-112656575 GAAGCTTAGCTGGGTGGTTCTGG + Intergenic
997433815 5:133859448-133859470 GAAGCTTAGCTGGGTGGTTCTGG - Intergenic
998948398 5:147365682-147365704 AGACCCTTGCTAGCTGCTTCTGG + Intronic
1002200351 5:177524449-177524471 GGACCCTGCCTGGCTGCTTGGGG + Exonic
1002382890 5:178842842-178842864 AGAGCCTGGCTGGCTGCTTCAGG - Intergenic
1003400704 6:5788175-5788197 GCACTCCAGCTGGCTCCTTCTGG + Intergenic
1003639648 6:7865842-7865864 GATCCCTGGTGGGCTGCTTCTGG - Intronic
1006548883 6:34803822-34803844 TAATCCAAGCTGACTGCTTCTGG + Intronic
1007785894 6:44279158-44279180 GAGACCTAGCTGACTGATTCAGG - Exonic
1013387004 6:109641726-109641748 GAATCCTTGCTTGCTTCTTCTGG + Intronic
1018411565 6:163554132-163554154 GAACCCTAGCTGGCTGCTTCTGG + Intronic
1019716388 7:2541347-2541369 GGACCCTGGCGGGCTGCGTCCGG - Exonic
1020114264 7:5466835-5466857 GACCTCCAGCTGGCTGCCTCCGG - Intronic
1021000861 7:15328607-15328629 AAACCCTTAATGGCTGCTTCCGG - Intronic
1021433161 7:20584464-20584486 AGACCCTAGCTGGTTGCTGCAGG + Intergenic
1021499787 7:21319866-21319888 AAAGCCTAGCTGGTTCCTTCCGG - Intergenic
1022721612 7:32946454-32946476 GAAACTTATCTGGCTTCTTCAGG + Intergenic
1023680737 7:42684785-42684807 GAAGCCTTGCTTGCTGCTACAGG + Intergenic
1024043465 7:45572807-45572829 GAAACCTTTCTGGCTCCTTCTGG - Intergenic
1028786618 7:94801634-94801656 CAACCCAAGCTTGCAGCTTCAGG - Intergenic
1029147853 7:98459272-98459294 GAGGCCTGGCTGGCTGCTTCGGG + Intergenic
1034629728 7:152521733-152521755 GAGCCTTAGCTGGGTGGTTCTGG + Intergenic
1036199620 8:6757348-6757370 GAACCCTACTTGGCTGCCTGTGG + Exonic
1039331535 8:36543000-36543022 AAAGCCGAGCTGGCTGCTCCCGG + Intergenic
1039841409 8:41295893-41295915 AAACCTAAGCTGGCTGCTTCTGG + Intronic
1046371062 8:113307257-113307279 GTGTCCTAGCTGGCTGCCTCTGG - Intronic
1048375347 8:133818188-133818210 GGACGCTAGGTGGCTGCTGCAGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1054806477 9:69400760-69400782 GCAGCTTAGCTGGGTGCTTCTGG + Intergenic
1062156537 9:135052032-135052054 AAACACCACCTGGCTGCTTCTGG + Intergenic
1062164907 9:135102806-135102828 GAACCCCATCTGCCTGCTTCAGG + Intronic
1186480721 X:9894767-9894789 GAGCCCAAGCTGGCTGCCCCTGG + Exonic
1189166965 X:38870059-38870081 GACCCCTCCCAGGCTGCTTCTGG + Intergenic
1189990555 X:46589911-46589933 GAACTATTGCTGGCTGCTGCTGG - Intronic
1194595840 X:95856252-95856274 GAACCCTAGTATGCTGCTTGTGG + Intergenic
1195078387 X:101348732-101348754 GAACCACAGCTAGCTGCCTCTGG + Exonic
1195234124 X:102880010-102880032 GTACCCAAGCTGGCAGGTTCTGG + Intergenic
1197771743 X:130093694-130093716 GAAGCCTTGCTGCCTGGTTCGGG + Intronic
1201227757 Y:11834715-11834737 GAACCCAAACTGTCTGATTCTGG + Intergenic