ID: 1018414375

View in Genome Browser
Species Human (GRCh38)
Location 6:163588717-163588739
Sequence CAGTGTGACCGTAGAGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018414375_1018414380 14 Left 1018414375 6:163588717-163588739 CCTTATTCTCTACGGTCACACTG No data
Right 1018414380 6:163588754-163588776 GAGAGCCCTCTCTTGAGAAATGG No data
1018414375_1018414381 15 Left 1018414375 6:163588717-163588739 CCTTATTCTCTACGGTCACACTG No data
Right 1018414381 6:163588755-163588777 AGAGCCCTCTCTTGAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018414375 Original CRISPR CAGTGTGACCGTAGAGAATA AGG (reversed) Intergenic
No off target data available for this crispr