ID: 1018416539 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:163606667-163606689 |
Sequence | ATGGCATCCATTTCTCTTGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1018416534_1018416539 | 1 | Left | 1018416534 | 6:163606643-163606665 | CCTAGGAACATGGCGCAGGTTCT | No data | ||
Right | 1018416539 | 6:163606667-163606689 | ATGGCATCCATTTCTCTTGGGGG | No data | ||||
1018416531_1018416539 | 10 | Left | 1018416531 | 6:163606634-163606656 | CCGGGTTTCCCTAGGAACATGGC | No data | ||
Right | 1018416539 | 6:163606667-163606689 | ATGGCATCCATTTCTCTTGGGGG | No data | ||||
1018416533_1018416539 | 2 | Left | 1018416533 | 6:163606642-163606664 | CCCTAGGAACATGGCGCAGGTTC | No data | ||
Right | 1018416539 | 6:163606667-163606689 | ATGGCATCCATTTCTCTTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1018416539 | Original CRISPR | ATGGCATCCATTTCTCTTGG GGG | Intergenic | ||