ID: 1018416539

View in Genome Browser
Species Human (GRCh38)
Location 6:163606667-163606689
Sequence ATGGCATCCATTTCTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018416534_1018416539 1 Left 1018416534 6:163606643-163606665 CCTAGGAACATGGCGCAGGTTCT No data
Right 1018416539 6:163606667-163606689 ATGGCATCCATTTCTCTTGGGGG No data
1018416531_1018416539 10 Left 1018416531 6:163606634-163606656 CCGGGTTTCCCTAGGAACATGGC No data
Right 1018416539 6:163606667-163606689 ATGGCATCCATTTCTCTTGGGGG No data
1018416533_1018416539 2 Left 1018416533 6:163606642-163606664 CCCTAGGAACATGGCGCAGGTTC No data
Right 1018416539 6:163606667-163606689 ATGGCATCCATTTCTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018416539 Original CRISPR ATGGCATCCATTTCTCTTGG GGG Intergenic