ID: 1018418376

View in Genome Browser
Species Human (GRCh38)
Location 6:163620926-163620948
Sequence ACTCTCGTGCTGCCACAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018418376_1018418380 3 Left 1018418376 6:163620926-163620948 CCACTCTGTGGCAGCACGAGAGT No data
Right 1018418380 6:163620952-163620974 TCTGACCCTATTCTGGTTCGGGG No data
1018418376_1018418379 2 Left 1018418376 6:163620926-163620948 CCACTCTGTGGCAGCACGAGAGT No data
Right 1018418379 6:163620951-163620973 CTCTGACCCTATTCTGGTTCGGG No data
1018418376_1018418381 4 Left 1018418376 6:163620926-163620948 CCACTCTGTGGCAGCACGAGAGT No data
Right 1018418381 6:163620953-163620975 CTGACCCTATTCTGGTTCGGGGG No data
1018418376_1018418378 1 Left 1018418376 6:163620926-163620948 CCACTCTGTGGCAGCACGAGAGT No data
Right 1018418378 6:163620950-163620972 TCTCTGACCCTATTCTGGTTCGG No data
1018418376_1018418377 -4 Left 1018418376 6:163620926-163620948 CCACTCTGTGGCAGCACGAGAGT No data
Right 1018418377 6:163620945-163620967 GAGTCTCTCTGACCCTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018418376 Original CRISPR ACTCTCGTGCTGCCACAGAG TGG (reversed) Intergenic
No off target data available for this crispr