ID: 1018420248

View in Genome Browser
Species Human (GRCh38)
Location 6:163634818-163634840
Sequence GCAGCACCTGGACCAGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420248_1018420254 13 Left 1018420248 6:163634818-163634840 CCCGAGGCTGGTCCAGGTGCTGC No data
Right 1018420254 6:163634854-163634876 CCATGCAGCCCTTTCTCCTTAGG No data
1018420248_1018420255 14 Left 1018420248 6:163634818-163634840 CCCGAGGCTGGTCCAGGTGCTGC No data
Right 1018420255 6:163634855-163634877 CATGCAGCCCTTTCTCCTTAGGG No data
1018420248_1018420256 18 Left 1018420248 6:163634818-163634840 CCCGAGGCTGGTCCAGGTGCTGC No data
Right 1018420256 6:163634859-163634881 CAGCCCTTTCTCCTTAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420248 Original CRISPR GCAGCACCTGGACCAGCCTC GGG (reversed) Intergenic
No off target data available for this crispr