ID: 1018420249

View in Genome Browser
Species Human (GRCh38)
Location 6:163634819-163634841
Sequence AGCAGCACCTGGACCAGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420249_1018420254 12 Left 1018420249 6:163634819-163634841 CCGAGGCTGGTCCAGGTGCTGCT No data
Right 1018420254 6:163634854-163634876 CCATGCAGCCCTTTCTCCTTAGG No data
1018420249_1018420256 17 Left 1018420249 6:163634819-163634841 CCGAGGCTGGTCCAGGTGCTGCT No data
Right 1018420256 6:163634859-163634881 CAGCCCTTTCTCCTTAGGGTTGG No data
1018420249_1018420255 13 Left 1018420249 6:163634819-163634841 CCGAGGCTGGTCCAGGTGCTGCT No data
Right 1018420255 6:163634855-163634877 CATGCAGCCCTTTCTCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420249 Original CRISPR AGCAGCACCTGGACCAGCCT CGG (reversed) Intergenic
No off target data available for this crispr