ID: 1018420255

View in Genome Browser
Species Human (GRCh38)
Location 6:163634855-163634877
Sequence CATGCAGCCCTTTCTCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420250_1018420255 2 Left 1018420250 6:163634830-163634852 CCAGGTGCTGCTTGCCCAGACTT No data
Right 1018420255 6:163634855-163634877 CATGCAGCCCTTTCTCCTTAGGG No data
1018420248_1018420255 14 Left 1018420248 6:163634818-163634840 CCCGAGGCTGGTCCAGGTGCTGC No data
Right 1018420255 6:163634855-163634877 CATGCAGCCCTTTCTCCTTAGGG No data
1018420247_1018420255 15 Left 1018420247 6:163634817-163634839 CCCCGAGGCTGGTCCAGGTGCTG No data
Right 1018420255 6:163634855-163634877 CATGCAGCCCTTTCTCCTTAGGG No data
1018420249_1018420255 13 Left 1018420249 6:163634819-163634841 CCGAGGCTGGTCCAGGTGCTGCT No data
Right 1018420255 6:163634855-163634877 CATGCAGCCCTTTCTCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420255 Original CRISPR CATGCAGCCCTTTCTCCTTA GGG Intergenic
No off target data available for this crispr