ID: 1018420313

View in Genome Browser
Species Human (GRCh38)
Location 6:163635154-163635176
Sequence GTTTGAAAGCATGGCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420313_1018420322 26 Left 1018420313 6:163635154-163635176 CCTTCAAGGCCATGCTTTCAAAC No data
Right 1018420322 6:163635203-163635225 CTGAAGGCTGAAGATTTCCCTGG No data
1018420313_1018420316 -10 Left 1018420313 6:163635154-163635176 CCTTCAAGGCCATGCTTTCAAAC No data
Right 1018420316 6:163635167-163635189 GCTTTCAAACTCAAAGGCCAAGG No data
1018420313_1018420318 10 Left 1018420313 6:163635154-163635176 CCTTCAAGGCCATGCTTTCAAAC No data
Right 1018420318 6:163635187-163635209 AGGAGTGTGTGCCTCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420313 Original CRISPR GTTTGAAAGCATGGCCTTGA AGG (reversed) Intergenic