ID: 1018420317

View in Genome Browser
Species Human (GRCh38)
Location 6:163635184-163635206
Sequence TCAGGGAGGCACACACTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420317_1018420326 13 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420326 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
1018420317_1018420332 28 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420317_1018420330 19 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420330 6:163635226-163635248 AACTGTTGGCTGTCGGGGGTCGG No data
1018420317_1018420328 14 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420328 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
1018420317_1018420323 5 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420323 6:163635212-163635234 GAAGATTTCCCTGGAACTGTTGG No data
1018420317_1018420324 12 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420324 6:163635219-163635241 TCCCTGGAACTGTTGGCTGTCGG No data
1018420317_1018420329 15 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420329 6:163635222-163635244 CTGGAACTGTTGGCTGTCGGGGG No data
1018420317_1018420322 -4 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420322 6:163635203-163635225 CTGAAGGCTGAAGATTTCCCTGG No data
1018420317_1018420331 25 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420331 6:163635232-163635254 TGGCTGTCGGGGGTCGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420317 Original CRISPR TCAGGGAGGCACACACTCCT TGG (reversed) Intergenic
No off target data available for this crispr