ID: 1018420318

View in Genome Browser
Species Human (GRCh38)
Location 6:163635187-163635209
Sequence AGGAGTGTGTGCCTCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420311_1018420318 28 Left 1018420311 6:163635136-163635158 CCTAGGTGCTTTCAGTGTCCTTC No data
Right 1018420318 6:163635187-163635209 AGGAGTGTGTGCCTCCCTGAAGG No data
1018420313_1018420318 10 Left 1018420313 6:163635154-163635176 CCTTCAAGGCCATGCTTTCAAAC No data
Right 1018420318 6:163635187-163635209 AGGAGTGTGTGCCTCCCTGAAGG No data
1018420310_1018420318 29 Left 1018420310 6:163635135-163635157 CCCTAGGTGCTTTCAGTGTCCTT No data
Right 1018420318 6:163635187-163635209 AGGAGTGTGTGCCTCCCTGAAGG No data
1018420315_1018420318 1 Left 1018420315 6:163635163-163635185 CCATGCTTTCAAACTCAAAGGCC No data
Right 1018420318 6:163635187-163635209 AGGAGTGTGTGCCTCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420318 Original CRISPR AGGAGTGTGTGCCTCCCTGA AGG Intergenic