ID: 1018420319

View in Genome Browser
Species Human (GRCh38)
Location 6:163635198-163635220
Sequence GAAATCTTCAGCCTTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420319_1018420330 5 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420330 6:163635226-163635248 AACTGTTGGCTGTCGGGGGTCGG No data
1018420319_1018420335 28 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420335 6:163635249-163635271 TGTTGGTGGCGGAGTGTTCTGGG No data
1018420319_1018420328 0 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420328 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
1018420319_1018420332 14 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420319_1018420323 -9 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420323 6:163635212-163635234 GAAGATTTCCCTGGAACTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 161
1018420319_1018420329 1 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420329 6:163635222-163635244 CTGGAACTGTTGGCTGTCGGGGG No data
1018420319_1018420336 29 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420336 6:163635250-163635272 GTTGGTGGCGGAGTGTTCTGGGG No data
1018420319_1018420326 -1 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420326 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
1018420319_1018420333 17 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420333 6:163635238-163635260 TCGGGGGTCGGTGTTGGTGGCGG No data
1018420319_1018420337 30 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420337 6:163635251-163635273 TTGGTGGCGGAGTGTTCTGGGGG No data
1018420319_1018420334 27 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420334 6:163635248-163635270 GTGTTGGTGGCGGAGTGTTCTGG No data
1018420319_1018420324 -2 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420324 6:163635219-163635241 TCCCTGGAACTGTTGGCTGTCGG No data
1018420319_1018420331 11 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420331 6:163635232-163635254 TGGCTGTCGGGGGTCGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420319 Original CRISPR GAAATCTTCAGCCTTCAGGG AGG (reversed) Intergenic