ID: 1018420320

View in Genome Browser
Species Human (GRCh38)
Location 6:163635201-163635223
Sequence AGGGAAATCTTCAGCCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420320_1018420331 8 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420331 6:163635232-163635254 TGGCTGTCGGGGGTCGGTGTTGG No data
1018420320_1018420324 -5 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420324 6:163635219-163635241 TCCCTGGAACTGTTGGCTGTCGG No data
1018420320_1018420338 28 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420338 6:163635252-163635274 TGGTGGCGGAGTGTTCTGGGGGG No data
1018420320_1018420326 -4 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420326 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
1018420320_1018420332 11 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420320_1018420334 24 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420334 6:163635248-163635270 GTGTTGGTGGCGGAGTGTTCTGG No data
1018420320_1018420336 26 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420336 6:163635250-163635272 GTTGGTGGCGGAGTGTTCTGGGG No data
1018420320_1018420335 25 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420335 6:163635249-163635271 TGTTGGTGGCGGAGTGTTCTGGG No data
1018420320_1018420328 -3 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420328 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
1018420320_1018420329 -2 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420329 6:163635222-163635244 CTGGAACTGTTGGCTGTCGGGGG No data
1018420320_1018420333 14 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420333 6:163635238-163635260 TCGGGGGTCGGTGTTGGTGGCGG No data
1018420320_1018420337 27 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420337 6:163635251-163635273 TTGGTGGCGGAGTGTTCTGGGGG No data
1018420320_1018420330 2 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420330 6:163635226-163635248 AACTGTTGGCTGTCGGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420320 Original CRISPR AGGGAAATCTTCAGCCTTCA GGG (reversed) Intergenic